Dialysis is a passive process that favors the transport of small molecules across a semipermeable membrane.
Glycogen is a complex carbon hydrates found in animals true or false?
Answer:
true
Explanation:
Explanation:
i think true i think please mark me brainlist thank you
what hormones are responsible for inducing and regulating labor
Please help
I don't know which one is the answer :(
Answer:
I believe that your answer is C.
Explanation:
Keep in mind that Steve is working with crops (wheat specifically) and Devan has helped him repair his machinery so that Steve can harvest the wheat properly.
discribe the processes of transcriotion and translation
Explanation:
Basic Biology
BASIC BIOLOGY
Inspired by life
TRANSCRIPTION AND TRANSLATION
Genes provide information for building proteins. They don’t however directly create proteins. The production of proteins is completed through two processes: transcription and translation.
Transcription and translation take the information in DNA and use it to produce proteins. Transcription uses a strand of DNA as a template to build a molecule called RNA.
The RNA molecule is the link between DNA and the production of proteins. During translation, the RNA molecule created in the transcription process delivers information from the DNA to the protein-building machines.
DNA → RNA → Protein
DNA and RNA are similar molecules and are both built from smaller molecules called nucleotides. Proteins are made from a sequence of amino acids rather than nucleotides. Transcription and translation are the two processes that convert a sequence of nucleotides from DNA into a sequence of amino acids to build the desired protein.
These two processes are essential for life. They are found in all organisms – eukaryotic and prokaryotic. Converting genetic information into proteins has kept life in existence for billions of years.
DNA and RNA
RNA and DNA are very similar molecules. They are both nucleic acids (one of the four molecules of life), they are both built on a foundation of nucleotides and they both contain four nitrogenous bases that pair up.
A strand of DNA contains a chain of connecting nucleotides. Each nucleotide contains a sugar, and a nitrogenous base and a phosphate group. There is a total of four different nitrogenous bases in DNA: adenine (A), thymine (T), guanine (G), and cytosine (C).
A strand of DNA is almost always found bonded to another strand of DNA in a double helix. Two strands of DNA are bonded together by their nitrogenous bases. The bases form what are called ‘base pairs’ where adenine and thymine bond together and guanine and cytosine bond together.
Adenine and thymine are complementary bases and do not bond with the guanine and cytosine. Guanine and cytosine only bond with each other and not adenine or thymine.
There are a couple of key differences between the structure of DNA and RNA molecules. They contain different sugars. DNA has a deoxyribose sugar while RNA has a ribose sugar.
What does costal cartilage connect?
Answer:
a. Ribs to the sternum
Explanation:
Answer:
Ribs to the sternum
Explanation:
Plz help:
b. Compare dominant and recessive traits –
c. Compare pure and hybrid offspring –
Answer:
b. What is the difference between dominant and recessive traits? Dominant traits are always expressed when the connected allele is dominant, even if only one copy of the dominant trait exists. Recessive traits are expressed only if both the connected alleles are recessive.
c. In the simplest possible terms, purebreds are the offspring that result from mating between genetically similar parents while hybrids are the offspring that are the result of mating between two genetically dissimilar parents.
Explanation:
Answer:
b. Dominant traits are always expressed when the connected allele is dominant, even if only one copy of the dominant trait exists. Recessive traits are expressed only if both the connected alleles are recessive.
Explanation:
c. purebreds are the offspring that result from mating between genetically similar parents while hybrids are the offspring that are the result of mating between two genetically dissimilar parents.
which statement about food production since 1960 is true?
Answer:
During this time our food production has grown even faster than our population
Explanation:
hope this helps you if it does please mark brainiest
which muscle group relates best with the term midline?
The oblique is the muscle group that best relates with the term midline.
The anterolateral abdominal wall contains a muscle group in which there are flat muscles whose fibers originate in the posterolateral part, pass forward and become an aponeurosis towards the midline:
The external oblique muscle is the thickest and most superficial of the three muscles on the lateral wall of the abdomen.It follows an inferomedial direction and the muscle-tendon limit descends in such a way that, towards the midline and also below the height of the anterior superior iliac spine, it is completely transformed into an aponeurosis.The aponeurosis of the external oblique joins that of the internal oblique and passes in front of the rectus abdominis; its fibers intersect in the midline with those on the opposite side and contribute to the linea alba.
Therefore, we can conclude that the oblique is the muscle group that best relates with the term midline.
Learn more here: https://brainly.com/question/19486604
Which of the following elements is not a metalloid?
Answer:
gallium
Explanation:
match the pairs-rhizobium-
a)nitrogen fixation
b) bakery products
c) food poisoning
Answer:
A
Explanation:
Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:
Answer:
y is there so much letters?
what are the two major anatomical subdivisions of the nervous system?
Answer: The nervous system has two main parts:
The central nervous system is made up of the brain and spinal cord.
The peripheral nervous system is made up of nerves that branch off from the spinal cord and extend to all parts of the body.
Explanation:
easy question - giving brainly if correct !!
Answer:
i think its C
Explanation:
i would go with c
Give me an example of seedless vascular plants...
Mosses,Hornworts,Liverworts
Explanation:
Seedless vascular plants embrace ferns,Horsetails and club mosses.
Answer:
mosses,liverworts
Explanation:
Interpreto la imagen: 1. ¿Qué sensaciones te transmite la
fotografía? 2. ¿en dónde se encuentra el fósil del ser vivo
que se observa en la fotografía? 3. ¿A qué reino de la
naturaleza pertenecía el ser vivo de la fotografía? ¿Por qué?
4. ¿Cómo explicarías a una persona que es la evolución a
partir de esta fotografía? 5. La fotografía muestra un fósil
de cocodrilo de la especie C.Robustus, evidencia
paleontológica que demuestra la existencia de estos
animales desde el triásico y el jurásico en el planeta tierra.
¿Por qué crees que, a una institución como el laboratorio
de Ciencias de la Tierra de Lyon, en Francia, le puede
interesar estudiar un espécimen como este?.
Answer:
what image
Explanation:
list three ways that organisms use energy
Answer + Explanation:
Organisms use energy to survive, grow, respond to stimuli, reproduce, and for every type of biological process. The potential energy stored in molecules can be converted to chemical energy, which can ultimately be converted to kinetic energy, enabling an organism to move.
cells only keep a small amount of _____ on hand and regenerate it as needed using energy stored in carbohydrates and other molecules.
Answer:
ATP is your answer
Explanation:
whats the answer ugh
Answer:
Phalanges: long bones
Sternum: flat bone
Vertebrae: Irregular bone
A spacecraft can travel 20km/s how many km can this spacecraft travel in 1 hour?
Answer:
This spacecraft can travel
[tex]72000km[/tex]
In recent years, poaching in Africa has declined. Will the decrease of poaching lead to a return of more elephants with tusks in future generations?
Help this is due in an hour….
Answer:
I'm sure it's A
Explanation:
which high grade, foliated metamorphic rock has visible crystals?
Answer:
Gneiss
Explanation:
Gneiss forms at the highest pressures and temperatures and has crystals large enough to see with the unaided eye. Gneiss features minerals that have separated into bands of different colors. The bands of colors are what define foliation within gneiss.
Hope this helps! : )
Gneiss crystals are large enough to be seen without magnification. Gneiss has color-banded minerals. Color bands define gneiss foliation.
What is Gneiss?The metamorphic rock known as gneiss is quite common and can be found all over the world. It is produced when procedures of high temperature and high pressure metamorphism are applied to formations that are made up of rocks that are either igneous or sedimentary in nature.
Gneiss is formed at temperatures and pressures that are higher than those required to make schist. Gneiss almost always has a banded texture that is defined by alternating darker and lighter colored bands and does not have a clear cleavage. Gneiss may also lack a distinct cleavage.
Gneisses are frequently found in the crust of continental shields that formed in the distant past. Gneisses like the Acasta Gneiss are among the oldest rocks on Earth and are classified as Proterozoic.
Learn more abut Gneisses, here:
https://brainly.com/question/22489042
#SPJ5
in an otherwise normal cell, what happens if one mistake is made during dna replication?
Answer:
Most mistakes are corrected, and if they are not, they may result in a mutation, defined as a permanent change in the DNA sequence. Mutations can be of many types, such as substitution, deletion, insertion, and trinucleotide repeat expansions. Mutations in repair genes may lead to serious consequences such as cancer.
Explanation:
I need some help summarizing the following topics
•Biology Foundations
•Cells
•Energy and Transport
• Reproduction and Cell Division
• Classical Genetics
• Molecular Genetics
• Human Body Systems
• Ecology
Answer:
guess we were in the same boat I have
Explanation:
Chris to ryx Dr and decor is nuryslam is a day at a retirement party and I have to go to khow about the election results and I we are and decor and I have a lot earlier today
what is the transfer of energy in the form of electromagnetice waves
Answer: Electromagnetic radiation.
Explanation: The transfer of energy by electromagnetic waves is called electromagnetic radiation. Electromagnetic waves can transfer energy through matter or across empty space.
when two strains of bacteria with genotypes abcd and abcd are grown together in the lab, a small number of bacteria with the genotype abcd eventually arise. how does this likely occur?
Answer:
These enzymes work in two ways. Some are pre-replicative and search the DNA for nucleotides with unusual structures
Explanation:
This happened through a lateral transfer of genes.
We can arrive at this answer because:
Lateral gene transfer is a system for exchanging genetic material between unrelated bacteria.Bacteria are beings that reproduce without the exchange of genetic material, but in some cases, this can be done with the lateral transmission of genes.This transmission can be done through the process of conjugation, translation, or transformation.The result is that new bacteria are created with a mixture of genes from two unrelated bacteria.
More information:
https://brainly.com/question/848637?referrer=searchResults
plants use the ____________ to make organic molecules.
_____ is the process by which energy is stored in inorganic molecules is used to produce carbohydrate food molecules
Answer:
Chemosynthesis
Chemosynthesis is used to produce food using the chemical energy stored in inorganic molecules.
that is the answer
Photosynthesis is the process by which energy stored in inorganic molecules is used to produce carbohydrate food molecules.
What is photosynthesis?Photosynthesis is the primary process by which plants, algae, and some bacteria capture and store energy from the sun.
During photosynthesis, light energy is absorbed by pigment molecules in the chloroplasts of plant cells. This energy is then used to convert carbon dioxide (CO2) and water (H2O) into glucose (C6H12O6) and oxygen (O2). The glucose produced during photosynthesis is used by the plant as a source of energy and is also stored as a carbohydrate reserve. The oxygen produced during photosynthesis is released into the atmosphere as a byproduct.
Learn more about photosynthesis, here:
https://brainly.com/question/29764662
#SPJ5
what are some reasons implicit stereotypes might differ from explicit stereotypes?
Answer:
Implicit stereotypes are automatically activated and operate indirectly, and thus individuals may not be aware that they possess such beliefs. In contrast, explicit stereotypes are accessible to conscious awareness and are what individuals report when asked about group differences.
Explanation:
Please rate, thank me, have a good day
Implicit stereotypes operate automatically and indirectly, so people may not realize they have them. When asked about group differences, people report explicit stereotypes.
What are stereotypes?A stereotype is a preconceived notion or combination of traits that many people hold to be indicative of a certain kind of person or object. Stereotypes are traits that society automatically ascribes to particular groups of people in order to categorize them according to factors like age, weight, occupation, skin tone, gender, etc.
Since implicit stereotypes function subtly and automatically, people may not even be aware that they hold such beliefs. Conversely, explicit stereotypes are cognizable and are what people report when questioned about group differences.
Learn more about stereotypes, here:
https://brainly.com/question/2070574
#SPJ2
These types of consumer relationships can affect the size of prey and plant populations in a community and determine the places these prey and plant species live. For example, certain plants only grow in steep hillside in a habitat because they are eaten near the stream in the valley, or deer live in the forest to better hide from wolves in the open fields.
a. Parasitism and Commensalism
b. Mutualism and Herbivory
c. Predation and Parasitism
d. Predation and Herbivory