I need help pls I need it for school thank uu

I Need Help Pls I Need It For School Thank Uu

Answers

Answer 1
C is the answer for sure I think

Related Questions

4(r - 3k) = r - 5k
Solve for r

Answers

Answer:

r= 7k/3

Step-by-step explanation:

Answer:

r=7k/3

Step-by-step explanation:

4r-12k=r-5k

4r=r-5k+12k

4r=r+7k

4r-r=7k

3r=7k

r=7k/3

Connie deposited $1200 in a new account that earns 3% simple interest. After 7 years, how much interest will she have earned?​

Answers

Answer:

$252

Step-by-step explanation:

First, converting R percent to r a decimal

r = R/100 = 3%/100 = 0.03 per year,

then, solving our equation

I = 1200 × 0.03 × 7 = 252

I = $ 252.00

The simple interest accumulated

on a principal of $ 1,200.00

at a rate of 3% per year

for 7 years is $ 252.00.

Is a b c or d?

(Please explain)

Answers

Equation: 5 + 8x < 3(2x + 4)


• So let’s first distribute:

Multiply 3 by (2x + 4)

That will be 6x + 12.


Put into the question: 5 + 8x < 6x + 12


• Now we can move the numbers around and UNDO to solve for x.

I will move the coefficient first, so subtract 6x from both side, so that it is easier:

5 + 8x < 6x + 12
- 6x < - 6x

That will be: 5 + 2x < 12


Now we’ll subtract the 5 from both side:

5 + 2x < 12
- 5 < -5

That will left with: 2x < 7


Now we divide both side by 2 to left with x.

2x < 7
—- —-
2 2

Now that will be: x is less than 3.5

x < 3.5


Since the inequality is open, the dot is white, or not shaded.

And since x is less than 3.5, any number less than 3.5 is the answer, so A is the answer.

Help me please with this

Answers

Since both angle are congruent (equal/same), which means that both side is equal to 40 degrees, we will put the equation like this:

5x - 5 = 40

Now we’ll solve for x:

5x - 5 = 40
+ 5 + 5 (Add 5 to both sides)

5x = 45
—- —— (Five both side by 5)
5 5

x = 9

Now we left with x, so x is equal to 9.

Solve the equation below and determine the number of solutions.
10y -14 =10y +28

Answers

Answer:

10y-14=10y+28

10y-14+14=10+28+14

answer= 42

Calculate the volume of the cube

Answers

Answer:

try 18

Step-by-step explanation:

because their are 6 sides on the cube and 6 ties 3 equals 18

Help plssssssssssssss this counts for my grade

Answers

Answer:

8.04063*10^2

Step-by-step explanation:

Move the decimal so there is one non-zero digit to the left of the decimal point. The number of decimal places you move will be the exponent on the

10. If the decimal is being moved to the right, the exponent will be negative. If the decimal is being moved to the left, the exponent will be positive.

Answer:

804.063

Step-by-step explanation:

8 x 100 = 800, 4 x 1 = 4, 6 x 1/100 = 0.060, and 3 x 1/1,000 = 0.003.

The positive integer less than 7

Answers

Answer:

6,5,4,3,2,1

Step-by-step explanation:

Any number below 7 that is positive

6,5,4,3,2,1 is the correct answer

Select all of the trips that would take 2 hours.

Multiple select question.

A)
Drive 60 miles per hour between Buffalo and Seneca Falls, which are 120 miles apart.


B)
Walk 3 miles per hour to school, which is 1.5 miles away.


C)
Take a train going 80 miles per hour from Albany to New York City, which are 160 miles apart.

Answers

Answer:

A)

&

C)

Step-by-step explanation:

120÷60=2

160÷80=2

y/9 = 4/12 what is the value of y?

Answers

Answer:

y = 3 is the answer

If f and g are two functions defined by
f(x) = 3x + 5 and g(x) = x +1, then g(f(x) is

Answers

Answer:

9x^2 +30x +26.  g(f(x)) = (3x + 5)^2 + 1

Step-by-step explanation:

The value of function g(f(x)) will be (3x + 8).

What is Function?

A relation between a set of inputs having one output each is called a function.

Given that;

The value of functions are;

f(x) = 3x + 5 and g(x) = x + 1

Now, Find the value of function f(g(x)) by substituting the given values as;

f(g(x)) = f (x + 1)

        = 3 (x + 1) + 5

        = 3x + 3 + 5

        = 3x + 8

Thus, The value of function g(f(x)) will be (3x + 8).

Learn more about the function visit:

https://brainly.com/question/20384115

#SPJ2

someone help ple it's easy ​

Answers

ABCG i think im so sorry if im wrong

(3x^3+2x^2-3x+4)divided by (x+2)

Answers

Answer:

3x^3+2x^2-3x+4/x+2

Step-by-step explanation:

3x^4+2x^3-3x^2+2x+4/x should be your answer

Belle borrowed $18.275 to buy a new car. The interest rate she agreed to pay is 5%. If she takes 5 years to pay back the loan, how much will she owe?​

Answers

Answer:

$22843.75

Step-by-step explanation:

I'm assuming that $18.275 is $18,275

First, converting R percent to r a decimal

r = R/100 = 5%/100 = 0.05 per year,

then, solving our equation

I = 18275 × 0.05 × 5 = 4568.75

I = $ 4,568.75

The simple interest accumulated

on a principal of $ 18,275.00

at a rate of 5% per year

for 5 years is $ 4,568.75.

Answer:

$95943.75

Step-by-step explanation:

(assuming that its actually 18,275 and not 18.275)

18,275*1.05(5)

the amount borrowed (18,275)* the interest rate (1.05) *the number of years (5)

1.
Which of the following CANNOT be classified as a parallelogram?
A rhombus
B rectangle
C Square
D trapezoid

Answers

d. a trapezoid is not a parallelogram

an object has a mass of 3 g and a volume of 4 ml, what is it's density?​

Answers

Answer:

Step-by-step explanation:

Density is mass divided  by volume

d = 3/4 = 0.75 g/mL

Step-by-step explanation:

density=mass/volume=3/4 g/ml

need help geometry be serious

Answers

Angle A would be the correct one

A shoe store is selling a pair of shoes for $60 that has been discontinued by 25%. What was the original selling price?
show your work plssss!!

Answers

Answer:

$80

Step-by-step explanation:

The shoe is being sold for 75% (100%-25%) of the original price. So in order to calculate the original price, divide the discounted price ($60) by 75%.

60/0.75 = 80

Solve the equation. Show your work, or explain your reasoning.
-4(y - 2) = 12

Answers

Answer:

y=-1

Step-by-step explanation:

Divide both sides by 4

y-2=-3

Then move -2 to -3 and change it's sign to a +

y=-3+2

Then solve for y

36 : 52 = __:__
a) 18:26
b) 2:3
d) 2:2
d 9:13

Answers

The answer to the following question is letter D

X + 2 ½ = 5 ⅔; x = ?

Answers

Answer:

3.16 or 19/6 / 3 1/6

Step-by-step explanation:

Finish the lyrics and find out the song :


Handsome is he
There's no question this Ali's alluring
Ali Ababwa
Never ordinary, never boring
That physique!
Everything about that man
How can I spe-

Answers

Answer:

Make way for Prince Ali

Say hey, it's Prince Ali

Hey! Clear the way in the old Bazaar

Hey you, let us through!

It's a brand new star

Oh come

Be the first on your block to meet his eye

Make way, here he comes!

Ring bells, bang the drums!

You're gonna love this guy

Prince Ali, fabulous he, Ali Ababwa

Show some respect, boy, genuflect

Down on one knee

Now, try your best to stay calm

Brush up your friday salaam

Then come and meet his spectacular coterie!

Prince Ali, mighty is he, Ali Ababwa

Strong as ten regular men, definitely

He's faced the galloping hordes

A hundred bad guys with swords

Who sent those goons to their lords?

Why, Prince Ali

Fellas, he's got

(Got seventy-five golden camels)

Uh-huh, now the ladies, what he got?

(Purple peacocks, he's got fifty-three)

Uh-huh, uh-huh, uh-huh

When it comes to exotic-type mammals

Everybody help me out!

He's got a zoo?

I'm telling you, it's a world-class menagerie

Prince Ali, handsome is he, Ali Ababwa

That physique! How can I speak?

Weak at my knees! You yummy boy

So get on out in that square

Adjust your veil and prepare

To gawk and grovel and stare at Prince Ali, oops

He's got ninety-five white Persian monkeys

(He's got the monkeys, a bunch of monkeys)

And to view them he charges no fee

(He's generous, so generous)

He's got ten thousand servants and flunkies

(Proud to work for him)

They bow to his whim, love serving him

They're just lousy with loyalty to Ali

Prince Ali

Prince Ali

We're waiting for you!

We're not going until you go

You can do it

There it is

Prince Ali, amorous he, Ali Ababwa

Heard your princess was hot! Where is she?

And that, good people, is why

He got all cute and dropped by

With sixty elephants, llamas galore (For real?)

With his bears and lions, a brass band and more (What?)

With his forty fakirs, his cooks, his bakers

His birds that warble on key

Make way for Prince Ali!

Step-by-step explanation:

Find the surface area of the cylinder. Use 3.14 for P.
A: 56.52 mm²
B: 62.8 mm²
C: 59.66 mm²
D: 65.3 mm²​

Answers

Answer:

d

Step-by-step explanation:

10. Zeke is calculating the interest earned on a deposit of $5,200 in an account that earns 3.15%
simple interest after 48 months.
I = prt
I = 5,200(.03 15) (48)
I= 7,862.4
Zeke finds the interest earned to be $7,862.40 as shown in his work above. Find and describe the
mistake in Zeke's work:
Find the correct amount of interest earned:

Answers

Answer:

655.20

Step-by-step explanation:

Answer:

686.81

Step-by-step explanation:

The interest of this Question is 686.81.

P: 5200

T:4 Years

R: 0.0315

A=5200(1+0.0315)^4 = Total Value - P = The interest. AKA 686.81

Evaluate 3/7r + 5/8s when r= 14 and s= 8

Answers

Answer:

11

Step-by-step explanation:

Step 1:

3/7r+5/8s

Step 2:

So u multiply 3/7 by 14

3/7 x 14= 42/7= 6

Step 2.5:

Now u multiply 5/8 by 8

5/8 x 8= 40/8= 5

Step 3:

6+5=11

Help please. 7th grade

Answers

It is C.8 lines just count how many lines the shape has

A person travels 10 miles due north, then 5 miles due west, then 14 miles due north and then 12 miles due east. How far is that person from their starting point?’ I will give brainlest to the best answer.

Answers

Answer:

Step-by-step explanation:

North and Souths get added together. North is positive and South is negative.

East and West get added together. East is positive and West is negative.

This will get us two numbers for a triangle that we can make starting at the origin and ending where the two numbers take us.

10 miles north + 14 miles north = 24 miles north

10 + 14 = 24

5 miles west + 12 miles east = 7 miles east

-5 + 12 = 7

See attached image for picture and rest of work.

Help Help Help HelpHelp HelpHelp HelpHelp HelpHelp HelpHelp HelpHelp HelpHelp HelpHelp HelpHelp HelpHelp HelpHelp HelpHelp HelpHelp HelpHelp HelpHelp HelpHelp HelpHelp HelpHelp HelpHelp HelpHelp Help

Answers

Answer:

120 birds

Step-by-step explanation:

35/100x= 42

x= 42*20/7= 120 birds

if mine helps please mark as brainliest

Answer:

Imari counted 13 cardinals, 35, sparrows, 23 chickadees, 8 blue jays, 4 woodpeckers, and 17 Robins.

Step-by-step explanation: So if you added all of that up, Imari counted 100 birds in total. It is just simple math. And that name "chickadees" is a funny name. HAHAHHAHAHAHAHH HAve a good day.

Gina has two job offers as a dog walker. She wants to earn at least $75 each week. The first offer pays $15 each week plus $3 per dog walked. Let x represent the number of dogs walked.

Answers

Answer:

Gina should take the first option because she gets to walk less dogs and make $75

Step-by-step explanation:

lol

You pick a marble from this bag. What is the probability you will choose either a plain black or plain white marble? Simplify your answer.

Answers

Answer:

50% chance for both

Step-by-step explanation:

If its two marbles then you have a 50% chance of picking up either the black or white. If four marbles are in the bag it would be 25%, if 10 then you have 10% and so on.

If you pick a marble from this bag. The probability you will choose either a plain black or plain white marble will be 0.5.

What is probability?

It is defined as the ratio of the number of favorable outcomes to the total number of outcomes, in other words, the probability is the number that shows the happening of the event.

It is given that, a person has to pick a marble from this bag.

We have to find the probability you will choose either a plain black or plain white marble

The probability that you'll select a basic black or plain white marble,

P=favourable outcome / total outcome

P=(either plain black or plain white marble) / 2

P=1/2

P=0.5

Thus, if you pick a marble from this bag. The probability you will choose either a plain black or plain white marble will be 0.5.

Learn more about the probability here:

brainly.com/question/11234923

#SPJ6

Other Questions
transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC Hey can somebody get this for me been stuck for five min Select the correct answer from the drop-down menu.What is implied by the underlined section in the passage?Caesar's statement to Brutus implies that imagine being in spanish course on edmentum its pretty hard not gonna kap features of liberalism theory A square has side lengths as shown in the picture and a perimeter of 54.8 centimeters. Write an equation to find the measure of each side length. On January 1, Year 1, a contractor began work on a $3.2 million construction contract that is expected to be completed in 3 years. The contractor concludes that it is appropriate to recognize revenue over time using the input method based on costs incurred (cost-to-cost method). At the inception date, the estimated cost of construction was $2.4 million. The following data relate to the actual and expected construction costs: Year 1 Year 2 Year 3 Costs incurred $720,000 $1,170,000 $1,110,000 Expected future costs $1,680,000 $810,000 $0 For this long-term construction contract, the contractor needs to calculate the estimated dollar values of the revenue and gross profit (loss) to be recognized each year. Complete the contractor's long-term construction contract using the information above. Write the appropriate amounts in the associated cells. Indicate losses by using a leading minus (-) sign. Round all amounts to the nearest dollar. If no entry is necessary, enter a zero (0). Revenue Gross profit (loss) Year 1Year 2 Need help with english class Your teacher has given you two mineral samples. He has told you thatthey have the same crystal structure and hardness.Which other observation would suggest that they are MOST LIKELY thesame mineral?They have the same color.They have the same shape.They have the same size.They have the same mass. 6. To what modern day American event might the medieval tournaments be compared? Une correctamente la pregunta con la respuesta.1. Con quin hablabas? 2. Qu haca tu hermano? 3. Que hacan tus padres? 4. Con quin hablabais? Hablaba con mi hermano. Hablbamos con el estudiante nuevo.Jugaba el ftbol.Caminaban por la playa. A factory uses a special kind of lubricant to maintain its two milling machines. Weekly lubricant usage for each machine is an independent random variable (zero correlation). The first machine has a mean usage of 50.6 gallons and standard deviation of 12 gallons. The second machine has a mean usage of 64.4 gallons and standard deviation of 16 gallons.Suppose that at the beginning of the week, the factory has a total of 135 gallons of lubricant in stock. The factory will not receive any replenishment of lubricant from its supplier until the end of the week. Assume that the total lubricant usage (of the two machines combined) follows a normal distribution. What is the probability that the factory will run out of lubricant before the next replenishment arrives? What is the highest common factor of 72 and 90 The following stem-and-lead plot shows the One record attendance for original Charity Drive meetings what is the mode of these values?A.)48B.) 84C.) 70D.) 66 If you going to answer one question say it in the comments it's gonna be the waste of time bc the answer is going to be deleted 76% of 250 is what number? An illustration of a cell interacting with its environment is provided.Call membraneThe illustration best represents which of the following?Water moving into a cell by the process of osmosis2 .Passive transport of solute into the cell by diffusionActive transport of solute into the cell using energyWater leaving the cell by the process of osmosis A container of water and an equal-sized container of oil are heated at the same rate. After several minutes, the temperature of the oil has risen 20 degrees C, but the temperature of the water has only increases by 8 degrees C. What explains this?Question 6 options:Heat moves from the water to the oil.It takes more energy to increase the temperature of water than to increase the temperature of oilThe water contains more atoms, so it has more thermal energyMore heat was added to the oil than to the water. What is the distance between the points (4, -8) and (10,8)? A scalar is a mathematical term for:a. measurementb. Magnitude and Directionc. A number and a unitd. A Scale