I need help it’s due in 30 minutes

I Need Help Its Due In 30 Minutes

Answers

Answer 1

Answer:

yeet

Step-by-step  

i dont know


Related Questions

A triangle on a coordinate plane is translated according to the rule T–8, 4(x, y). Which is another way to write this rule? (x, y) → (x + 4, y – 8) (x, y) → (x – 4, y – 8) (x, y) → (x – 8, y + 4) (x, y) → (x + 8, y – 4)

Answers

Answer:

C (x, y) - (x - 8, y + 4)

Answer:

C (x, y) - (x - 8, y + 4)

Step-by-step explanation:

Got it right on Edge

Which conic section is represented by the following equation?

5x^2 – x + 5y^2 – 3y + 4 = 0

circle
ellipse
parabola
hyperbola

Answers

Answer:

3 rd one

Step-by-step explanation:

The conic section represented by the given equation is Circle.

What is Circle?

Circle is a two dimensional figure which consist of set of all the points which are at equal distance from a point which is fixed called the center of the circle.

Standard form of a circle is,

(x - h)² + (y - k)² = r²

where, (h, k) is the center of the circle and r is the radius of the circle.

Expanding, we get,

x² - 2hx + h² + y² - 2ky + k² = r²

x² - 2hx + y² - 2ky + (h² + k² - r²) = 0

The given equation is,

5x² – x + 5y² – 3y + 4 = 0

This is same as the standard form of the circle.

Hence the given equation is that of a circle.

Learn more about Circles here :

https://brainly.com/question/13658927

#SPJ2

Tickets to a show cost $5.50 for adults and $4.25 for students. A family is purchasing 2 adult tickets and 3 student tickets. Estimate the total cost.

Answers

Step-by-step explanation:

they paid 23.75 dollars. I hope it helps l!

Step-by-step explanation:

They paid 23.75 dollars. I really really hope this helps l!



True or false;
The x-intercept of a function ALWAYS occurs where y is equal to zero.
True
False

Answers

I think the answer is (true)
Have a great day!

The x-intercept of a function always occurs where y is equal to zero is true.

Given,

The x-intercept of a function always occurs where y is equal to zero.

We need to find whether the given statement is True or False.

What is x-intecept and y-interept?

The x-intercept is the point where the line passes through the x-axis.

We need to put y = 0.

The y-intercept is the point where the line passes through the y-axis.

We need to keep x = 0.

Check the statement.

The x-intercept of a function always occurs where y is equal to zero.

This is a true statement because in order to find the x-intercept we need always keep y = 0.

Thus the given statement-

The x-intercept of a function always occurs where y is equal to zero is true.

Learn more about intercepts of a function here:

https://brainly.com/question/14180189

#SPJ2

Sudha earns ` 189 in a day and Radha earns ` 112 in a day. About how much will each of them earn in 30 days

Answers

Answer:

the sudha and radha earns 5,670 and 3,360 respectively

Step-by-step explanation:

Since in the question it is mentioned that

Sudha earns 189 in a day

And, radha earns 112 in a day

so in 30 days, sudha earns

= 189 × 30 days

= 5,670

And, radha earns

= 112 × 30 days

= 3,360

Therefore the sudha and radha earns 5,670 and 3,360 respectively

Please help !! giving brainiest to whoever helps
Find the value of x.Then, find the measure of STW.

Answers

Answer:

<R+<S=<T(since exterior angle of triangle is equal to the sum of two opposite interior angle)

44+9x+3=14x+7

44+3-7=14x-9x

40=5x

x=40/5=8

.STW. ==14×8+7=119

a motorcyclist sets out on a road trip traveling at a constant rate of 45 mph. one half hour after she leaves, her friend discovers that the motorcyclist forgot her duffel bag driving at a rate of 60 mph the friend sets out in the car to catch up with her

Answers

Answer:

1. 45

2. 60

Step-by-step explanation:

i did it and got it right

Answer:

the answer is 45 and 60

Step-by-step explanation:

What's the surface area???

Answers

Answer:

do you have to times it or add??

PLEASE ANSWER!!! Will give brainliest :)

Answers

8$

Hope this helps!!!
8 bucks I believe my g

The vegetable garden has 95 ripe plants. The number of tomatoes is 16 fewer than twice the number of squashes. How many of each vegetable are ripe?​

Answers

Answer:

Tomatoes = 39.5

Squash = 55.5

Step-by-step explanation:

T (tomatoes) = S - 16

S + T = 95

we plug it in now

S + (S - 16) = 95

2s = 95 + 16

2s = 111

s = 55.5??

hm. Let's go with it

T = 55.5 - 16

T = 39.5

39.5 + 55.5 = 95

I...guess?

PLEASE HELP ME

7. What is the Range?


Answers

Answer:

the last one

Step-by-step explanation:

the range for is 5,10,15,20,25

The amounts below show the change (measured in feet) in water level over four months. What is the
average monthly change in water level?
-0.84, 1.25, -1.59, 0.42

Answers

Answer:

try your best then try it hard

Answer:

-0.19

Step-by-step explanation:

why does -6 - (-2) equal -4?

Answers

Answer:

when you subtract a negative number the two negative signs cancel out and it turns to a positive number

Step-by-step explanation:

in -6 - (-2)

the two - signs cancel out so it ends up being

-6+2 which is why it equals -4

The two negative (-) signs cancel out.
In this case, when the signs cancel out, we get:
-6 + 2
And that’s how you get the answer -4

(Pretty much: -6 - (-2) is equal to -6 + 2. Both of which equal -4)

Find the modulus of 6 + 3i

Answers

Answer:

the modulus of 6 + 3i=√(6²+3²)=√45=3√5

Answer:

D - 6+3i ; 3 squareroot of 5

Step-by-step explanation:

Xavier is using square tiles to cover a table top. The tiles are 1 1/2in. On each side. The table top is 7 1/2 inches wide and 13 1/2 inches long. How many tiles dose Xavier need to use to cover the whole table?

Answers

Answer:

._________________________*___*___________________

Answer:

45 Tiles

Step-by-step explanation:

7 1/2 × 13 1/2 = 101 1/4

Area = 101 1/4

1 1/12 × 1 1/2 = 2 1/4

Tile Area = 2 1/4

101 1/4 ÷ 2 1/4 = 45

good luck, i hope this helps :)

Solve the system below for x: (2 pts)
y = 6x + 4
y = 5x - 1
O X=-3
O X = -3/11
0 x = -5
x = -5/11

Answers

Answer:

x=-5

Step-by-step explanation:

6x+4=5x-1

x+4=-1

x=-5

X=-5
Step by step explanation
6x+4 =5x-1
X+4=-1
X=-5

A recipe for a cake calls for 3 cups of water. Elisa accidentally put in 6 cups. How many extra cups did she put in? What equation would depict this scenario?
c-3=6
c-6=3
c+3=6
c+6=3

Answers

The answer is c+3=6

Answer:

1.Elisa accidentally put in 3 extra cups of water

2.C+3=6

HELP HELP HELP PLEAASE

Answers

Answer:

Step-by-step explanation

Kf i help u wojld u help me

Answer: your answer will be 72 divided by 8

Step-by-step explanation: because they wanna know how many pages she put stickers on in if you divide it will tell you how many pages she put stickers on witch is 9

I have 2 lines in this graph I need to know which line has a slope of one and which has a slope of 2​

Answers

Answer:

what graph

Step-by-step explanation:

Evaluate the expression 5 (m - 2) + 10w when m = 8.4 and w= 1.25.

Answers

Based on the calculations, the evaluation of the given mathematical expression is 44.5.

Given the following data:

Expression = [tex]5 (m - 2) + 10w[/tex]m = 8.4.w = 1.25.

To evaluate the given mathematical expression:

How to evaluate a mathematical expression.

In this exercise, you're required to evaluate and solve the given mathematical expression by substituting the values of the variables as follows:

[tex]5 (8.4 - 2) + 10(1.25)\\\\5 (6.4 ) + 12.5\\\\32 + 12.5=44.5[/tex]

Read more on expressions here: brainly.com/question/13170908

What is the value 8-[12-(-4)]

Answers

Answer:

-8

Step-by-step explanation:

im smart

Answer: i searched it up on gogle it said -8 but i don't know so sorry

Step-by-step explanation:

16 pretzels weigh 16 ounces. fill in the rest of the table given this ratio.
there are 4 answers. do not round. pls help

Answers

Answer:

64  20  16   1       4

16   5     4  .25      1

Step-by-step explanation:

64 divided by 16 is 4. So you multiply 5 by 4 to get 20 pretzels and divide 1 by 4 to get .25 oz.

"Twelve minus the product of ten and a number is the same as two multiplied by the difference of twice that
number and one"

Answers

Answer:

answer:1) 2) 3) 4)

Step-by-step explanation:

Write the expressions "Four times the difference of a number and 7 is 32", "One third of a number is 12 less than the number itself", "Ten increased by the quotient of a number and 2 is -15", and "One less than the product of a number and 3 is 5 more than the number itself".

2

SEE ANSWERS

Answer

4

calculista

Genius

19K answers

423.1M people helped

Part 1) "Four times the difference of a number and  is "

Let

x--------> the number

we know that

the expressions is equal to

therefore

the answer part 1) is

Part 2) "One third of a number is  less than the number itself"

Let

x--------> the number

we know that

the expressions is equal to

therefore

the answer part 2) is

Part 3) "Ten increased by the quotient of a number and  is "

Let

x---------> the number

we know that

the expressions is equal to

therefore

the answer Part 3) is

Part 4) "One less than the product of a number and  is  more than the number itself"

Let

x---------> the number

we know that

the expressions is equal to

therefore

the answer Part 4) is

cliffffy4h and 4 more users found this answer helpful

THANKS

4

0.0

(0 votes)

Answer

3.0/5

4

tardymanchester

Ambitious

1K answers

4.6M people helped

Answer:

1)

2)

3)

4)

Step-by-step explanation:

Given : Expressions in words.

To find : The expressions value?

Solution :

Let x be the number,

According to question,

1) "Four times the difference of a number and 7 is 32"

2) "One third of a number is 12 less than the number itself"

3) "Ten increased by the quotient of a number and 2 is -15"

4) "One less than the product of a number and 3 is 5 more than the number itself"

factor the polynomial

n ^ 4 - 49n ^ 2 = 0

Answers

Answer:

I have no clue on how to answer this bc I thiugh i knew how to answer

After a trip to the orchard, Regan and her aunt Cindy made applesauce with the apples they
picked. They used the same amount of cinnamon, but Regan used more apples than Aunt
Cindy. Whose applesauce tasted more like cinnamon?
Regan's applesauce tasted more like cinnamon,
Aunt Cindy's applesauce tasted more like cinnamon.
Neither. Both applesauces tasted the same.

Answers

Answer:

Aunt Cindy would taste more like cinnamon

I need help with linear graphs and functions​

Answers

Ok what do you need help with?

Help you with what, you need to show the linear graphs and functions to help you with it.

Quadrilateral ABCD is a rectangle. BD = 6x – 14 and AC = 8x - 20.

What is BD?


2

3

4

6

Answers

Answer 4

Step-by-step explanation:

Answer:

it is c.4

Step-by-step explanation:

Add the Polynomials


27.) 3y - 5 and 7y +8



28.) - 8xy - 4 and xy - 1



29.) 5a^3 -3a +7 and 7a^3 - 10a -8



30.) - 6x^3y + x^2 y^2 - 5xy and 8 x^3y - 10x^2 y^2 + 6



31.) x^2 -2x + 1 and x^4 + x^3 -x^2 + 5



32.) a^3b^2 - a^2b^3 and a^3b^2 - 5a^2b^3 + 7

Answers

hope it's helpful ❤❤❤❤❤❤

THANK YOU.

6 A rectangular room is 2 m longer than it is
wide. Its perimeter is 70 m. If the width of
the room is w m, express its length in terms
of zo. Hence find the width of the room.

Answers

Answer:

W = 16.5 meters

Step-by-step explanation:

let w be the width and then the length is w+2

Perimeter = 70 = 2w + 2(w+2)

70 = 2w + 2w + 4

4w = 66

w = 16.5 meters

I’m confused with this question.

Answers

Answer:

I'm pretty sure SSS since it's all sides that are equal to each other.

Other Questions
Plsssssss Help!!!!Look at the map. How might the Gupta empire have been able to flourish through trade? Identify geographic features to support your answer. transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC Hey can somebody get this for me been stuck for five min Select the correct answer from the drop-down menu.What is implied by the underlined section in the passage?Caesar's statement to Brutus implies that imagine being in spanish course on edmentum its pretty hard not gonna kap features of liberalism theory A square has side lengths as shown in the picture and a perimeter of 54.8 centimeters. Write an equation to find the measure of each side length. On January 1, Year 1, a contractor began work on a $3.2 million construction contract that is expected to be completed in 3 years. The contractor concludes that it is appropriate to recognize revenue over time using the input method based on costs incurred (cost-to-cost method). At the inception date, the estimated cost of construction was $2.4 million. The following data relate to the actual and expected construction costs: Year 1 Year 2 Year 3 Costs incurred $720,000 $1,170,000 $1,110,000 Expected future costs $1,680,000 $810,000 $0 For this long-term construction contract, the contractor needs to calculate the estimated dollar values of the revenue and gross profit (loss) to be recognized each year. Complete the contractor's long-term construction contract using the information above. Write the appropriate amounts in the associated cells. Indicate losses by using a leading minus (-) sign. Round all amounts to the nearest dollar. If no entry is necessary, enter a zero (0). Revenue Gross profit (loss) Year 1Year 2 Need help with english class Your teacher has given you two mineral samples. He has told you thatthey have the same crystal structure and hardness.Which other observation would suggest that they are MOST LIKELY thesame mineral?They have the same color.They have the same shape.They have the same size.They have the same mass. 6. To what modern day American event might the medieval tournaments be compared? Une correctamente la pregunta con la respuesta.1. Con quin hablabas? 2. Qu haca tu hermano? 3. Que hacan tus padres? 4. Con quin hablabais? Hablaba con mi hermano. Hablbamos con el estudiante nuevo.Jugaba el ftbol.Caminaban por la playa. A factory uses a special kind of lubricant to maintain its two milling machines. Weekly lubricant usage for each machine is an independent random variable (zero correlation). The first machine has a mean usage of 50.6 gallons and standard deviation of 12 gallons. The second machine has a mean usage of 64.4 gallons and standard deviation of 16 gallons.Suppose that at the beginning of the week, the factory has a total of 135 gallons of lubricant in stock. The factory will not receive any replenishment of lubricant from its supplier until the end of the week. Assume that the total lubricant usage (of the two machines combined) follows a normal distribution. What is the probability that the factory will run out of lubricant before the next replenishment arrives? What is the highest common factor of 72 and 90 The following stem-and-lead plot shows the One record attendance for original Charity Drive meetings what is the mode of these values?A.)48B.) 84C.) 70D.) 66 If you going to answer one question say it in the comments it's gonna be the waste of time bc the answer is going to be deleted 76% of 250 is what number? An illustration of a cell interacting with its environment is provided.Call membraneThe illustration best represents which of the following?Water moving into a cell by the process of osmosis2 .Passive transport of solute into the cell by diffusionActive transport of solute into the cell using energyWater leaving the cell by the process of osmosis A container of water and an equal-sized container of oil are heated at the same rate. After several minutes, the temperature of the oil has risen 20 degrees C, but the temperature of the water has only increases by 8 degrees C. What explains this?Question 6 options:Heat moves from the water to the oil.It takes more energy to increase the temperature of water than to increase the temperature of oilThe water contains more atoms, so it has more thermal energyMore heat was added to the oil than to the water. What is the distance between the points (4, -8) and (10,8)?