How does mitosis introduce genetic variation into offspring

Answers

Answer 1

Answer:

it is when a domminant allele mixes with a recesive allele creating a new pattern or genetic variation such as spot colors of a dog


Related Questions

A Maximum-Minimum thermometer has two stems which record the highest and lowest temperatures during a period of time. A small metallic piece in each stem indicates the temperature. A. 55o C, 35o C, 45o C B. 45o C, 25o C, 35o C C. 55o C, 25o C, 35o C D. 45o C, 25o C, 30o C 4. M

Answers

Answer:

The correct option is A: 55° C, 35° C, 45° C

Explanation:

The Six's thermometer is a device to record maximum and minimum values of temperature within a given period of time. It is a glass tube in a U shaped manner that contains mercury, which is dependent on the expansion of alcohol in order to register a maximum reading. It is made use of for the purpose of meteorology, horticulture etc.

The metallic piece in each stem indicates the temperature of 45°C, 25°C, 35°C. That is option B.

A maximum-minimum thermometer is an instrument used to measure both the minimum and maximum temperature of a given area for a period of time.

The maximum-minimum thermometer is used in the following fields:

Horticulture: This is useful in the sustainable production of cultivated food and ornamental plants as temperature of the area in use needs to be monitored.

Meteorology: This is useful in this field to monitor the temperature of different locations.

The range for a maximum-minimum thermometer is -30°C to 50°C.

Therefore, the metallic piece in each stem will indicate the temperature of 45°C, 25°C, 35°C which is within the range.

Learn more about thermometers here:

https://brainly.com/question/25034625

Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC
A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code.
B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein.
C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein.
D) Both B and C are possible outcomes.

Answers

Answer:

Option A

Explanation:

DNA sequence: GTCACCGGTCTATACATAAGC.

If the bases of codon 5 under a mutation of C to T, the outcome would be?

Bases of the sense codon 5 is TAC, since codons of the sense strand is the same as that of the mRNA except with the replacement of uracil in place of thymine. This codon TAC codes for tyrosine.

If a mutation occurs changing C to T, then the bases would be TAT coding also for tyrosine too due to the nature of redundancy of the genetic code. Thus, there would be no change to the protein sequence although a change would occur in the DNA sequence.

Redundancy of the genetic code indicate that more than one codon can code for an amino acid as there are 64 codons and 20 amino acids.

2. Exocrine glands, such as sweat glands, secrete fluids
glands secrete hormones directly into the bloodstrea
3. The _______ gland plays an important role in puberty
4. Epinephrine, triggering the "fight or flight" response
glands, which sit on top of the kidneys.
5. Most glands that secrete hormones operate using fe
When hormone concentrations are high, the gland w
the hormone.
6. Many cells produce chemicals called_____ hormon
impact inflammation and reproduction.
7. The gland that helps regulate growth, body temperat
lod the

Answers

Answer:

pituitary gland

Prostaglandins

oestrogen and testosterone

Explanation:

The pituitary gland plays an important role in puberty. Puberty refers to the time in which a boy or girl sexually mature. Many cells produce chemicals called Prostaglandins hormone which impact inflammation and oestrogen and testosterone are the hormones which is responsible for the maturation of eggs in female and sperm in male. these hormones plays a vital role in the growth and development of human body.

Answer:

1.Hormones

2. endocrine

3. pituitary

4. adrenal

5. less

6. prostaglandins

7. thyroid

8. Steroidal hormones enter the cell directly and interact with DNA inside the nucleus. These hormones change gene expression, affecting the RNA that is produced and the proteins that are translated in a cell. Nonsteroid hormones do not enter the cell. Instead, they bind to specific receptors on the outside of the cell membrane. This triggers molecules called secondary messengers, such as cAMP, to begin their work of relaying information in the cell, where other chemicals, messengers, and proteins are involved to create a cellular response.

Explanation:

Penn Foster

In 1998, paleoanthropologist Rick Potts published an article in The Yearbook of Physical Anthropology, a peer-reviewed journal. The article was titled “Environmental Hypotheses of Hominin Evolution.” In his paper, Potts claimed that great variations in environmental conditions over time were responsible for the adaptability of humans and the success of our species. Which would most likely be found in his paper?

Answers

This question is incomplete because the options are missing; here is the missing section:

Which would most likely be found in his paper?

A. A review of modern human anatomical structure.

B. Evidence of changing environmental conditions, with references.

C. The reasons competing hypotheses are wrong.

D. His opinion of what will happen to the survival of the human race.

The answer to this question is B. Evidence of changing environmental conditions, with references.

Explanation:

In texts such as scientific articles, the central point is expressed by the main claim or hypothesis as this is supported and explained through evidence in the articles. This means Potts article focuses on the environmental changes and how these contributed to the human species adaptability.

Due to this, it is expected the article explains the changes in environmental conditions, and the connection of these to adaptability. Moreover, because this is a scientific article all ideas should be supported with evidence collected by the author including references to other reliable sources. Thus, "evidence of changing environmental conditions, with references" is expected to be found in this article.

Answer: B

Explanation: I took the test :)

What was an unintended negative environmental consequence of improved technology in agriculture?
A. Farmers went bankrupt purchasing expensive equipment.
B. Modern technology allowed for larger expanses of land to become cultivated, so farming took over many natural areas that were important for wildlife
C. Machines took away jobs commonly performed by farm workers
D. Machines diminished the quality of the crops.​

Answers

The correct answer is B. Modern technology allowed for larger expanses of land to become cultivated, so farming took over many natural areas that were important for wildlife.

Explanation:

In the last decades, the creation of agricultural technology has increased the efficiency of growing crops. This means now, all the process is more efficient, which leads to more products to be sold and an increase in profit. However, the possibility of large scale agriculture has caused more land is used for this purpose. This often implies natural ecosystems such as forests are destroyed and the land of these ecosystems, which is usually rich in minerals, is used for extensive agriculture. This is a negative consequence of agricultural technology as natural areas important for wildlife are taken for human profit.

Answer:

B

Explanation:

Penn Foster

Genral Science

Page 14

Which statement best describes the relationship of photosynthesis and energy? 1. The process of photosynthesis is energy-storing because the process converts light energy into chemical energy, which is stored in the bonds of glucose. 2.The process of photosynthesis is energy-releasing because the process converts light energy into free energy that can be used for cell functions. 3.The process of photosynthesis is energy-conserving because no energy is used throughout the process of forming glucose and oxygen molecules. 4.The process of photosynthesis is energy-wasting because photosynthesis is an inefficient process that depletes the cell of energy stored in the bonds of glucose.

Answers

Answer:

3 is appropriate statement that describes photosynthesis

the correct answer for this question is 1. The process of photosynthesis is energy-storing because the process converts light energy into chemical energy, which is stored in the bonds of glucose.

Hemoglobin is the blood protein responsible for the transport of oxygen. Carbon monoxide disturbs oxygen transport by

Answers

Answer:

Answered below

Explanation:

Hemoglobin is found in the red blood cells and is responsible for the transportation of oxygen from the lungs to the various body cells.

Oxygen binds to hemoglobin because it has a high affinity for it. This aids its transportation. When it gets to the cells it unbinds and get transported into the cell for use in energy production.

Carbon monoxide is an odourless, dangerous gas which has more affinity for hemoglobin than oxygen. Therefore when carbon monoxide is inhaled, it quickly binds to hemoglobin, thereby displacing oxygen. It binds to hemoglobin for a longer period and due to this, the body does not get any oxygen and cells begin to die.

Symptoms of carbon monoxide poisoning include dizziness, headaches, fatigue and coma.

Which of the following answers correctly lists the four main types of macromolecules?

A.
DNA, RNA, triglycerides, water

B.
Monosaccharides, water, DNA, triglycerides

C.
Water, oxygen gas, ammonia, carbon

D.
Carbohydrates, lipids, proteins, nucleic acids

Answers

Answer:

D. carbohydrates, lipids, proteins, and nucleic acids

[tex]hope \: it \: helps[/tex]

Answer:

D

Explanation:

They are the main types of macromolecules

The type of teeth seen in blank are usually broad and flat

Answers

Answer:

Molars

Explanation:

Molars are the teeth furthest back in our mouth. Their broad, flat surfaces help grind food as we eat...

hope this answer correct :)

Classify the following organisms into their respective kingdoms (i) Yeast (ii) Penicillium (iii) Rhizobium (iv) Mushroom (v) Amoeba (vi) fish

Answers

Answer:

(i) Yeast- Kingdom Fungi

(ii) Penicillium- Kingdom Fungi

(iii) Rhizobium- Kingdom Eubacteria

(iv) Mushroom- Kingdom Fungi

(v) Amoeba- Kingdom Protista

(vi) fish- Kingdom Animalia

Explanation:

Living organisms were classified into a large group called KINGDOM, which represent the largest and most generic grouping consisting of organisms that share a few similarities. The kingdoms that living organisms were classified into are as follows: Plantae, Animalia, Fungi, Protista, Eubacteria, Archaebacteria, etc.

Based on the question, the mentioned organisms are classified into the following kingdoms:

(I) Yeast: Yeast is a unicellular microbe classified under the Kingdom Fungi due to possession of chitin in its cell wall and other similar features with members of kingdom Fungi.

ii) Penicillium- Penicillium is a genus classified under the Kingdom Fungi.

(iii) Rhizobium- Rhizobium is a genus of prokaryotic organism (lack membrane-bound nucleus and organnelles) classified under the Kingdom Eubacteria.

(iv) Mushroom- Mushrooms are saprophytic (heterotrophic) species of organisms classified under the Kingdom Fungi.

(v) Amoeba- Amoeba is a genus of unicellular eukaryotes classified under the Kingdom Protista.

(vi) fish- Fishes are organisms classified under the Kingdom Animalia

What are the different alleles available for the cross shown in this Punnett square? a and a A and a A and A

Answers

Answer:

A and a

Explanation:

Answer:

b

Explanation:

Several statements related to the process of cellular respiration are listed. Classify each statement as true or false.

Answers

Answer:

option 1, 2, 4, and 5 are true while 3 is false.

Explanation:

statements are given below.

1) Anaerobic respiration occurs by either lactic acid or alcohol fermentation.

2) Glycolysis is the first step in anaerobic respiration only.

3) only anaerobic respiration produces a net gain of ATP.

4) anaerobic respiration occurs in the cells cytoplasm.

5) aerobic respiration always include the citric acid cycle.

Anaerobic respiration occurs by either lactic acid or alcohol fermentation and produces very low amount of ATP due to the absence of oxygen. Glycolysis refers to the breakdown of glucose molecule in pyruvate and ATP molecules. It only occurs in anaerobic respiration because it does not requires oxygen. Both aerobic and anaerobic respiration produces energy in the form of ATP. Aerobic respiration occurs in the mitochondria of the cell while anaerobic respiration occurs in the cytoplasm. Citric acid cycle is main part of aerobic respiration.

In the presence of saturating amounts of oxaloacetate, the activity of citrate synthase from pig heart tissue shows a sigmoid dependence on the concentration of acetyl‑CoA. When succinyl‑CoA is added, the curve shifts to the right and the sigmoid dependence is more pronounced.

Choose the statements that are reasonable explanations for the right-ward shift of the velocity curve caused by succinyl-CoA.

a. Succinyl-CoA competes with dissociation of CoA as a product of the reaction.
b. Succinyl-CoA binds covalently to the enzyme.
c. Succinyl-CoA binds at a regulatory site other than the active site.
d. Succinyl-CoA competes with acetyl-CoA for binding at the active site.
e. Succinyl-CoA competes with oxaloacetate for binding at the active site.

Answers

Answer:

c. Succinyl-CoA binds at a regulatory site other than the active site

Explanation:

The sigmoid saturation curve is a property of of allosteric enzymes which reflects the cooperaive interactions between the protein subunits in the enzymes.

Allosteric enzymes function through reversible, non-covalent binding of regulatory compounds called allosteric modulators.

Allosteric enzymes  have different binding site for the substrate and for their allosteric modulator.

In the citric acid cycle, succinyl-CoA serves as as allosteric inhibitor of citrate synthase which catalyses the production of citrate from oxaloacetate and acetyl-CoA.

From the given options:

a. Succinyl-CoA competes with dissociation of CoA as a product of the reaction is wrong because it has its own binding site as an allosteric modulator.

b. Succinyl-CoA binds covalently to the enzyme is wrong because allosteric enzymes functions through non-covalent interactions.

c. Succinyl-CoA binds at a regulatory site other than the active site is true because citrate synthase is an allosteric enzyme

d. Succinyl-CoA competes with acetyl-CoA for binding at the active site is wrong because acetyl-CoA binds to the active site while succinyl-Coa binds to the regulatory site.

e. Succinyl-CoA competes with oxaloacetate for binding at the active site is wrong because oxaloacetate binds to the active site while succinyl-Coa binds to the regulatory site.

Identify the type of system used for mass production. Tommy owns a toy factory and uses a in which all the machines and workers at workstations process each manufactured item in the same order. This system is suitable for mass production.

Answers

Pretty sure it’s assembly line :)

In the process of urine formation:_____.
a. first filtrate is formed, then tubular fluid, then urine.
b. tubular fluid is formed, then filtrate, then urine.

Answers

Answer:

b i think is your answer

Explanation:

Which type of organism developed first?

Answers

al

answer: algae

explanation: because the were the first ones to adapt with water and land...

Why was there not a significant difference in the reaction rate with 800 mg of substrate as compared to 400 m. of substrate? What would you need to add to see an increase in the reaction rate with 800 mg of substrate?

Answers

Answer:

A. Concentration of substrate can affect the rate of reaction by two condition given below-

1. At low concentration of substrate, there will be increase in the rate of reaction by increasing the concentration of substrate. There would be catalytic site of enzyme available to bind to substrate.

2. The enzyme becomes saturated with substrate as the substrate concentration increases. At a point when the rate of product formation now depends on the activity or the available active sites of the enzyme itself, so, increasing more substrate will not leads to any effect on the rate of the reaction to any significant level.

Thus, there was not a significant difference in the reaction rate with 800 mg of substrate as compared to 400 m as at 400 mg all the catalytic site or active site are bound already.

B. Increasing the enzyme concentration will lead to increase the rate of reaction at 800 mg as there will be more active sites to bound to substrate.

CH 7 What will be the effect if a
toxin make a pore ( o ) in the
inner membrane of the
mitochondria​

Answers

Answer:

Mitochondria is known as the powerhouse of the cell as it provides energy to the cell for performing different functions.

If a toxin causes pore in the inner membrane of the mitochondria and  increases the permeability of the mitochondrial membranes. The permeability of mitochondrial membranes leads to mitochondrial swelling and causes cell death through necrosis and apoptosis.

Briefly explain what was done in the experiment where pigeons could choose which button to peck in the Skinner box. How does this relate to self-control?

Answers

In this experiment, Skinner placed a pigeon inside a box that contained a button that when pressed released water or food. This pigeon went through periods of deprivation of water and food, but over time, he realized that when he pecked the button he had access to these two elements. Skinner called this behavior operant behavior, which is the behavior that occurs controlled by its consequences.

Although Skinner did not specifically study self-control, with this experiment, we can make a connection between operant behavior and self-control, since both are behaviors shown as a way to change the environment in which they are inserted, but this change also affects them.

HELP ASAP DUE NOW PLSSS HELP 10 points and brainlist Which arrows show matter moving from a producer to an omnivore? Select all that apply.

Answers

Answer:

my best guess is number answer 2 and answer 4

because crows love to eat desert woodrats and for the last one i watched it in national geo, its like a cycle grass hopper died by a mouse dies by a rattle snake.

Where near your home do you think the highest level of photosynthesis is happening? Think about
where in your area photosynthetic organisms are growing.

Answers

Answer:

Depends where the individual lives.

If the person lives in a rural area near a forest, photosynthesis would most likely occur in the forest.

If the person lives in an urban area in a city, a park or garden would have the highest level of photosynthesis occurring.

Answer:

There is a wonderful big park near my house with a lot of trees and plants, and I believe there is where the most photosynthesis occurs.

Explanation:

A teenager throws a 7.26 kg rock into a lake, trying to make a big splash. If the rock is travelling at a speed of 7.5 m/s, how much kinetic energy does the rock have?

Answers

Explanation:

K.E = 1/2mv²

1/2 x 7.26 x 7.5²= 204.19j

Question
Select the correct answer.
Which of the following conditions would likely lead to the slowest rate of weathering?
a dry, temperate region with few hills or valleys
a steep mountain in a region with a cold climate
a hilly region that receives heavy, acidic precipitation
a region with heavy rainfall, where temperatures vary greatly
Submit

Answers

The condition above which would likely lead to the slowest rate of weathering is region with heavy rainfall, where temperatures vary greatly.

What is weathering?

Weathering simply refers to the deterioration of rocks, soils and minerals substances through contact with water or even biological organisms.

So therefore, the condition above which would likely lead to the slowest rate of weathering is region with heavy rainfall, where temperatures vary greatly

Learn more about weathering:

https://brainly.com/question/2341950

SPJ1

Answer:

A dry temperate region with few hills or valleys

Explanation:

this is right on plato

Which of the following sources would be most likely to have reliable data

Answers

What are the options we are working with?

3. List the molarities at which water exited the potato strips. Why did water move out of the potato strips? Were these solutions hypotonic, hypertonic, or isotonic?

Answers

Answer:

The water came out of the strips of the potatoes because a process of balance and oxygen balance called osmosis occurs.

Explanation:

The potato was subjected to a hypertonic environment and it is considered hypotonic, that is why the water seeks to go out to the outside in order to generate that it finds a balance in relation to a solvent solvent.

The possibility of magnifying contaminating sequences present in a nucleic acid pool is a drawback associated with PCRs high level of sensitivity (i.e., potential for exponential amplification).
A. True
B. False

Answers

Answer:

True

Explanation:

The Polymerase Chain reaction (PCR) is a technique widely used in molecular biology to identify specific DNA fragments generally in a size range of 100 to 1000 base pairs (bp). PCR sensitivity refers to the potential of the PCR technique to specifically amplify the desired sequence in the sample. PCR is a highly sensitive (and also specific) method with values around 100% if the experimental conditions are proper. However, to reach these values, it is imperative to work in optimal conditions by eliminating contaminant factors in the sample which may alter PCR amplification.

Which of these statements best sums up evolution?
rapid change in species’ habits and features
rapid development of vestigial structures in a species
change in a population through new species being made
change in a population through genetic variation over time

Answers

Answer:

change in a population through genetic variation over time

Explanation:

took the test

how many lactobacillyus present in 1 lire of curd packet

Answers

A genus of gram-positive, microaerophilic, rod-shaped bacteria occurring widely in nature. Its species are also part of the many normal flora of the mouth, intestinal tract, and vagina of many mammals, including humans. Pathogenicity from this genus is rare.

hope it helps

A community is a _______________________. Select one: a. group of populations b. group of ecosystems c. group of conspecific organisms d. individual form of life

Answers

Maybe option d. individual form of life

Answer:

A. group of population

Explanation:

Communities are made up of all the populations of different species in a given area.

Which correctly describes malignant tumors?

Answers

Answer:

Malignant means that the tumor is made of cancer cells, and it can invade nearby tissues. Some cancer cells can move into the bloodstream or lymph nodes, where they can spread to other tissues within the body—this is called metastasis.

Malignant tumors is a cancer cells
Cancer cells are cells which when it divides it divides more than the needed cell as it causes didorder
Other Questions
You are returning from Mexico and want to convert 5,00 pesos to US dollar . The rate of exchange that day is 1 pesos is 0.55 . How many dollars will you receive for your pesos ? Define Prejudice and Discrimination, discuss why they exist and possible solutions for eliminating or at least reducing acts of discrimination. There is a high pressure system that is located south of your planned route in the Northern Hemisphere on a west-to-east cross-country flight. To take advantage of favorable winds, you would plan your route: - on the north side of the high pressure area - on the south side of the high pressure area - through the middle of the high pressure area What is the midpoint of the segment shown below? (3, 7) (2, -1) plss help me do this prove identity trigonometric equation[tex]2 \tan(x) = \frac{ \cos(x) }{ \csc(x - 1) } + \frac{ \cos(x) }{ \csc(x + 1) } [/tex] A company sells widgets. The amount of profit, y, made by the company, is related to the selling price of each widget, x, by the given equation. y=-x^2+72x-458 We need to sell each widget at $ ___ in order to make a maximum profit of $ ____ Find the area of the polygon shown in the figure. Currently Acre is charged $3,693,600 Depreciation on the Income Statement of Andrews. Andrews is planning for an increase in this depreciation. On the financial statements of Andrews will this? Match the transactions below with the journal or ledger in which it would be entered. Monthly adjustment for supplies used Cash receipt posting to an individual customer account Record sale on account to customer Record purchase on account from vendor Record payment received from customer Record payment made to vendor Cash payment posting to an individual vendor account General journal Accounts receivable subsidiary ledger Revenue journal Purchases journal Cash receipts journal Cash payments journal Accounts payable subsidiary ledger Group of answer choices Monthly adjustment for supplies used Point AAA is at {(2,-8)}(2,8)left parenthesis, 2, comma, minus, 8, right parenthesis and point CCC is at {(-4,7)}(4,7)left parenthesis, minus, 4, comma, 7, right parenthesis.Find the coordinates of point BBB on \overline{AC} AC start overline, A, C, end overline such that the ratio of ABABA, B to BCBCB, C is 2:12:12, colon, 1. Identify two structural features of purines and pyrimidines. Purines contain only three ring nitrogen atoms. contain only two ring nitrogen atoms. contain four ring nitrogen atoms. contain two heterocyclic rings. contain one heterocyclic ring. Which of the following statements about partnership financial statements is true? The owners equity statement is called the partners capital statement. Only the total of all partner capital balances is shown in the balance sheet. Details of the distribution of net income are shown in the partners capital statement. The distribution of net income is shown on the balance sheet. describe the y-intercept in terms of knots and rope length a store offers a discount of 10% to customers who spend more than $20. If a customer's bill was $80, what will he actually pay? a box container both cube and five side pyramid the total number of objects is 17 the total number of side for the cube and pyramid is 95 how many cubes are in the box WILL MARK AS BRAINLIEST 4. Suppose there is a card game where you are dealt a hand of three cards. You have already learned that the total number of three-card hands that can be dealt from a deck of 52 cards is: 52C3=52!/49!3! 52C3=22100 Calculate the probability of getting a hand that has exactly two aces in it (A A X). Do this by finding out the number of possible hands that have exactly two aces, and then dividing by the total possible number of three-card hands that is stated above. Part A: Use the multiplication principle to tell the total number of three-card hands (permutations) that can be made with two aces. (2 points) Part B: In the answer from Part I, each two-ace hand got counted twice. For example, A A X got counted as a separate hand from A A X. Since order should not matter in a card hand, these are really the same hand. What is the actual number of two-ace hands (combinations) you can get from a deck of 52 cards?(2 points) Part C: Find the probability of drawing a three-card hand that includes two aces from a deck of 52 cards. Write your answer as a fraction. (2 points) Select the correct answer. The president of the United States is the head of which branch of the government? A. executive B. legislative C. judiciary D. parliamentary help me help me help me ww What is the 13th term of this arithmetic sequence? 132, 135, 138, 141, a 168 b 172 c 176 d 179