HELP ASAP ANSWER ALL OF THIS FOR 55 POINTS+BRAINLIST




1. Heat is transferred directly from one particle of matter to another by the process of

2. A circular flow of warmer fluid and cooler fluid is called a(n)


3. Heat is always transferred from to


4. is the transfer of energy by electromagnetic waves.


5. Heat that is transferred by the movement of currents within a fluid is called


6. The only form of heat transfer that does not require matter is

7. Water bubbles up through a hot spring at Yellowstone National Park. What method of heat transfer is this?

A conduction B convection

C radiation

D specific heat

In each of the following examples, identify whether heat is being transferred through conduction, convection or radiation. Some may have two possible answers. Choose the answer that best fits the situation.

Answers

Answer 1

Answer:

1. conduction

2. a convection current

3. Heat is always transferred from the object at the higher temperature to the object with the lower temperature

4. noooooo!Heat is always transferred from the object at the higher temperature to the object with the lower temperature

5.convection

6. Thermal radiation

7. convection again!

A. Conduction is the transfer of thermal energy through direct contact. Convection is the transfer of thermal energy through the movement of a liquid or gas.

B. Radiation is the transfer of thermal energy through thermal emission.

C. the heat required to raise the temperature of the unit mass of a given substance by a given amount

Answer 2

1. conduction, 2. convection current, 3. hotter objects to cooler objects. 4. Radiation, 5. convection, 6. radiation, 7. convection.

What are the modes of heat transfer?

There are three main modes of heat transfer:

Conduction: This is the transfer of heat through a material by direct contact between molecules. In this mode, heat flows from hotter to colder regions within the material until the temperature is equalized.

Convection: This is the transfer of heat through a fluid (liquid or gas) by the movement of the fluid itself. This mode of heat transfer can occur by natural convection (due to density differences in the fluid) or forced convection (due to an external source such as a fan).

Radiation: This is the transfer of heat through electromagnetic waves, without the need for a medium to transfer the heat. All objects emit and absorb radiation, and the amount of radiation emitted depends on the temperature of the object. This mode of heat transfer is important for heating and cooling applications, such as radiators or refrigerators.

Here in the question,

1. Heat is transferred directly from one particle of matter to another by the process of conduction.

2. A circular flow of warmer fluid and cooler fluid is called a convection current.

3. Heat is always transferred from hotter objects to cooler objects.

4. Radiation is the transfer of energy by electromagnetic waves.

5. Heat that is transferred by the movement of currents within a fluid is called convection.

6. The only form of heat transfer that does not require matter is radiation.

7. Water bubbling up through a hot spring at Yellowstone National Park is an example of convection.

Therefore, The Answers to those questions are 1. conduction, 2. convection current,3. hotter objects to cooler objects. 4. Radiation, 5. convection, 6. radiation, 7. convection.

To learn about the difference between conduction and convection click:

https://brainly.com/question/13104912

#SPJ3


Related Questions

A toy rocket is launched with an initial velocity of 10.0 m/s in the horizontal direction from the roof of a 38.0-m-tall building. The rocket's engine produces a horizontal acceleration of (1.60 m/s^3)t, in the same direction as the initial velocity, but in the vertical direction the acceleration is g, downward. Air resistance can be neglected.

Required:
What horizontal distance does the rocket travel before reaching the ground?

Answers

Answer:

Explanation:

Consider downward displacement first .

downward displacement h = 38 m .

downward acceleration = g

downward initial velocity u = 0

h = ut + 1/2 g t ²

38 = 0 + 9.8 t ²

t = 1.97 s

During this period , there will be horizontal displacement with initial velocity u = 10 m /s and acceleration a = 1.6 m /s²

s = ut + 1/2 a t²

= 10 x 1.97 + .5 x 1.6 x 1.97²

= 19.7 + 3.10

= 22.8 m

A space vehicle is coasting at a constant velocity of 22.3 m/s in the y direction relative to a space station. The pilot of the vehicle fires a RCS (reaction control system) thruster, which causes it to accelerate at 0.203 m/s2 in the x direction. After 56.7 s, the pilot shuts off the RCS thruster. After the RCS thruster is turned off, find (a) the magnitude and (b) the direction of the vehicle's velocity relative to the space station. Express the direction as an angle (in degrees) measured from the y direction.

Answers

Answer:

Explanation:

Initial velocity in y direction Vy = 22.3 m /s

initial acceleration in x direction ax = .203 m /s ²

time of acceleration t = 56.7 s

final velocity in x direction

v  = u + a t

Vx = 0 + .203 x 56.7 = 11.51 m /s

Final velocity in y direction will remain same as initial velocity in y direction = 22.3 m /s because there is no acceleration in y direction .

Magnitude of final velocity

= √ ( Vx² + Vy²)

= √ (22.3² + 11.51² )

= √ ( 497.29 + 132.48)

= 25.1 m /s

Direction of final velocity  from y direction be Ф

TanФ = Vx / Vy = 11.51 / 22.3 = .516

Ф = 27.3° .

A 5.1 g bullet is fired into a 2.3 kg ballistic pendulum. The bullet emerges from the block with a speed of 221 m/s, and the block rises to a maximum height of 7 cm . Find the initial speed of the bullet. The acceleration due to gravity is 9.8 m/s 2 . Answer in units of m/s.

Answers

Answer:

748.62 m /s.

Explanation:

mass of bullet m = .0051  kg .

mass of block M = 2.3 kg

block rises to a height of .07 m so velocity of block after collision

V = √ 2 gh

=√ (2 x 9.8 x .07 )

= 1.17 m /s

velocity of bullet after collision v = 221 m /s

Now we shall apply law of conservation of momentum to find out the velocity of bullet before collision .

Let it be Vx . then

5.1 x 10⁻³ x Vx + 0 = 5.1 x 10⁻³ x 221 + 2.3 x 1.17

= 1.127 + 2.691 = 3.818

Vx = 748.62 m /s

I need help please will mark brainliest

Answers

Answer:

c

Explanation:

In an early attempt to understand atomic structure, Niels Bohr modeled the hydrogen atom as an electron in uniform circular motion about a proton with the centripetal force caused by Coulomb attraction. He predicted the radius of the electron's orbit to be 5.29 ✕ 10−11 m. Calculate the speed of the electron and the frequency of its circular motion.

Answers

Answer:

The answer is below

Explanation:

Using Coulomb's law of electric field which is:

[tex]F=k\frac{q_1q_1}{r^2}\\\\ k =constant=9*10^9\ Nm^2/C^2,q_1=q_2=1.6*10^{-19}C,r=5.29*10^{-11}m\\\\Substituting\ gives:\\\\F=9*10^9*\frac{(1.6*10^{-19})*(1.6*10^{-19})}{(5.29*10^{-11})^2} =8.22*10^{-8}N\\\\Both\ centripetal\ force\ is\ given\ by:\\\\F=m\frac{v^2}{r} \\\\m = mass\ of \ electron=9.11*10^{-31}g,v=speed\ of\ electron\\\\F=m\frac{v^2}{r} \\\\v=\sqrt{\frac{F*r}{m} } \\\\subsituting:\\\\v=\sqrt{\frac{8.22*10^{-8}*5.29*10^{-11}}{9.11*10^{-31}} } \\\\v=2.18*10^6\ m/s\\\\[/tex]

[tex]But\ \omega=\frac{v}{r}=\frac{2.18*10^6}{5.29*10^{-11}} =4.13*10^{17}\\\\\omega=2\pi f; f=frequency\\\\f=\frac{\omega}{2\pi} =\frac{4.13*10^{17}}{2\pi} \\\\f=6.57*10^{15}\ Hz[/tex]

What is one example of an individual in an ecosystem?

Answers

An individual is any living thing or organism. Individuals do not breed with individuals from other groups. Animals, unlike plants, tend to be very definite with this term because some plants can crossbreed with other fertile plants.

Answer:

a

Explanation:

AAAA


What is the car's acceleration from 0 to 1 second?
A. 8 mph/s
B. 20 mph/s
C. 60 mph/s
D. 10 mph/s

Answers

10 mph/s because there is 60 seconds in a minute then divide by 6 which is 10.

As the distance between the sun and earth decreases, the force of gravity

a
Increases
b
decreases
c
stays the same

Answers

Answer:

B Decrease

Explanation:

ik im right cuz i looked up the answer

why would the bulb not light?

Answers

Answer:

It's not connected to the negative end of the battery

Explanation:

To turn on it would need to connect to the positive (+) and negative (-) ends of the battery

keli learned that an air mass is a very large body of air with similar temperature humidity and pressure and the air mass are constantly in motion she knows that you're messing depending on the temperature and moisture content tent of region where they form she looked up more information about what makes them move what are the major causes for moving & Masten North America choose two that apply.

Answer choices
A. changing humidity
B. low temperature
C. jet storm
D. prevailing westerlies​

Answers

jet stream and prevailing westerlies

Air masses from the tropics and the equator are warm as they form over lower latitudes. The major causes for moving air masses North America exists jet storm.

What is meant by air mass?

An air mass is a volume of air that in meteorology is identified by its temperature and humidity. Many hundreds or thousands of square miles are covered by air masses, which adjust to the properties of the land underneath them. Latitude and their continental or maritime source regions are used to categories them.

Warmer air masses are referred to as tropical, whilst colder air masses are referred to as polar or arctic. Superior and maritime air masses are moist, whereas continental and superior air masses are dry. Air masses with various densities are divided by weather fronts. Once an air mass has left its original location, nearby plants and bodies of water can quickly change the way it behaves. Classification systems address both the properties and modification of an air mass.

Air masses from the tropics and the equator are warm as they form over lower latitudes. They move poleward along the southern edge of the subtropical ridge and are drier and hotter than those that originate over seas. Trade air masses are another name for tropical maritime air masses. The Caribbean Sea, southern Gulf of Mexico, and tropical Atlantic Oceans, east of Florida via the Bahamas, are the origins of maritime tropical air masses that have an impact on the United States.

Monsoon air masses are moist and unstable. Rarely do dry superior air masses touch the ground. A trade wind inversion, which is a warmer and drier layer over the more moderately moist air mass below, is typically created over maritime tropical air masses when they are located above them.

Therefore, the correct answer is option C. jet storm.

To learn more about Air mass refer to:

https://brainly.com/question/19626802

#SPJ2

What is the main cause of ocean currents? Question 2 options:
The prevailing winds
The Coriolis effect
Waves
The sun and the moon

Answers

Coriolis effect

That’s what I remember from whenever I was in that unit.
The answer should be The Coriolis Effect because that is the #1 main cause of ocean currents.

What are the two rules that light follows.​

Answers

ok so i dont know srry5

In a liquid with a density of 1500 kg/m3, longitudinal waves with a frequency of 410 Hz are found to have a wavelength of 7.80 m. Calculate the bulk modulus of the liquid.

Answers

Answer:

The bulk modulus of the liquid is 1.534 x 10¹⁰ N/m²

Explanation:

Given;

density of the liquid, ρ = 1500 kg/m³

frequency of the wave, F = 410 Hz

wavelength of the sound, λ = 7.80 m

The speed of the wave is calculated as;

v = Fλ

v = 410 x 7.8

v = 3,198 m/s

The bulk modulus of the liquid is calculated as;

[tex]V = \sqrt{\frac{B}{\rho} } \\\\V^2 = \frac{B}{\rho}\\\\B = V^2 \rho\\\\B = (3,198 \ m/s)^2 \times 1500 \ kg/m^3\\\\B = 1.534 \ \times 10^{10} \ N/m^2[/tex]

Therefore, the bulk modulus of the liquid is 1.534 x 10¹⁰ N/m²

What happens to the force attraction of the distance two objects is increased?

Answers

Answer:

Explanation:

The attraction weakens. Two objects that are farther apart are not drawn together as strongly as if they were close together.

If two people, mass of 70 kg and 85 kg respectively, approach each other with speeds of 4 m/s and 7 m/s, what is the total momentum of the two person system? Give the momentum of each and then the total momentum.

Answers

Answer:

a. Momentum A = 280 Kgm/s.  

b. Momentum B = 595 Kgm/s.

c. Total momentum = 875 Kgm/s.

Explanation:

Let the two people be A and B respectively.

Given the following data;

Mass A = 70kg

Mass B = 85kg

Velocity A = 4m/s

Velocity B = 7m/s

Momentum can be defined as the multiplication (product) of the mass possessed by an object and its velocity. Momentum is considered to be a vector quantity because it has both magnitude and direction.

Mathematically, momentum is given by the formula;

[tex] Momentum = mass * velocity [/tex]

a. To find the momentum of A;

[tex] Momentum \; A = 70 * 4 [/tex]

Momentum A = 280 Kgm/s.

b. To find the momentum of B;

[tex] Momentum \; B = 85 * 7 [/tex]

Momentum B = 595 Kgm/s.

c. To find the total momentum of the two persons;

[tex] Total \; momentum = Momentum \; A + Momentum \; B [/tex]

Substituting into the equation, we have;

[tex] Total momentum = 280 + 595 [/tex]

Total momentum = 875 Kgm/s.

The range is the horizontal distance from the cannon when the pumpkin hits the ground. This distance is given by the product of the horizontal velocity (which is constant) and the amount of time the pumpkin is in the air (which is determined by the vertical component of the initial velocity, as you just discovered). Set the initial speed to 14 m/s, and fire the pumpkin several times while varying the angle between the cannon and the horizontal.

Required:
For which angle is the range a maximum (with the initial speed held constant)?

Answers

Answer:

Explanation:

For range o a projectile , the formula is as follows

R = u² sin2Ф / g where u is initial velocity of throw , Ф is angle of throw and g is acceleration due to gravity .

Here u = 14 m /s

R = 14² sin2Ф  / 9.8

R = 20 sin2Ф

Now R will have maximum value when sin2Ф has maximum value .

Maximum value of sin2Ф = 1

sin2Ф = 1  = sin 90°

Ф = 45°

So when throw is aimed at 45° , range will be maximum .

What Is a Sound Wave? Learning Goal: To understand the nature of a sound wave, including its properties: frequency wavelength, loudness, pitch, and timbre. Sound is a phenomenon that we experience constantly in our everyday life. Therefore, it is important to understand the physical nature of a sound wave and its properties to correct common misconceptions about sound propagation Most generally, a sound wave is a longitudinal wave that propagates in a medium (ie, air) The particles in the medium oscillate back and forth along the direction of motion of the wave. This displacement of the particles generates a sequence of compressions and rarefactions of the medium Thus, a sound wave can also be described in terms of pressure variations that travel through the medium. The pressure fluctuates at the same frequency with which the particles positions oscillate When the human ear perceives sound. It recognizes a series of pressure fluctuations rather than displacements of individual air particles. Part 1 Figure 1 of 2 > Fi MA length Part A Based on the information presented in the introduction of this problem, what is a sound wave? Propagation of sound particles that are offerent from the particles that comprise the medium Propagation of energy that does not require a medium Propagation of pressure fluctuations in a medium Propagation of energy that passes through empty spaces between the partides that com Submit Request Anst Part B Complete previous parts) Part hall to the other? Does air play a role in the propagation View Available Hints) SUITE Part D The graphs shown in (Figure 1) represent pressure variation versus time recorded by Enter the letters of all the correct answers in alphabetical order.

Answers

Answer:

A)  Propagation of pressure fluctuations in a medium

B) air is the medium in which the wave is transported,

Explanation:

Part A.

A sound wave is a longitudinal oscillation of the molecules that forms in a material medium, they can be solid, liquid or gases, therefore the wave propagates in the same direction as the oscillation of the particles.

The most correct answer is:

* Propagation of pressure fluctuations in a medium

Part b

air is the medium in which the wave is transported, otherwise it cannot propagate

Explain how you could use iron filings and a piece of paper to help reveal the effect of a magnetic field.

Answers

Answer:

you could put the iron filings on the peace of paper and hover a magnet over top of the paper and the iron filings would stand up, or even stick to the magnet

Explanation:

As the distance between the sun and earth decreases, the gravity force between them

a
Increases
b
decreases
c
stays the same

Answers

Answer:

a increases

Explanation:

as distance between two objects increases the gravitational force decreases so when distance decreases the gravitational force increases

What would cause surface ocean water to have a higher salt content?

A.
Surface ocean water will have a higher salt content from the melting of sea ice

B.
Surface ocean water will have a higher salt content from low rates of evaporation and high rates of precipitation.

C.
Surface ocean water will have a higher salt content from water flowing out of a river into the ocean

D.
Surface ocean water will have a higher salt content from high rates of evaporation and low rates of precipitation

Answers

Answer:

d I think? not sure I don't know much abt the ocean

A characteristic of a nebula is that it-

Answers

Answer:

Center of solar system

Explanation:

Answer: b

Explanation:

g In an historical movie, two knights on horseback start from rest 84.1 m apart and ride directly toward each other to do battle. Sir George's acceleration has a magnitude of 0.316 m/s2, while Sir Alfred's has a magnitude of 0.289 m/s2. Relative to Sir George's starting point, where do the knights collide?

Answers

Answer:

The knights will collide at 43.854 meters relative to Sir George's starting point.

Explanation:

Let suppose that initial positions of Sir George and Sir Alfred are 0 and 84.1 meters, respectively. If both knights accelerate uniformly, then we have the following kinematic formulas:

Sir George

[tex]x_{G} = x_{G,o}+v_{o,G}\cdot t + \frac{1}{2}\cdot a_{G}\cdot t^{2}[/tex] (1)

Sir Alfred

[tex]x_{A} = x_{A,o}+v_{o,A}\cdot t + \frac{1}{2}\cdot a_{A}\cdot t^{2}[/tex] (2)

Where:

[tex]x_{G,o}[/tex], [tex]x_{A,o }[/tex] - Initial position of Sir George and Sir Alfred, measured in meters.

[tex]x_{G}[/tex], [tex]x_{A}[/tex] - Final position of Sir George and Sir Alfred, measured in meters.

[tex]v_{o,G}[/tex], [tex]v_{o,A}[/tex] - Initial velocity of Sir George and Sir Alfred, measured in meters per second.

[tex]t[/tex] - Time, measured in seconds.

[tex]a_{G}[/tex], [tex]a_{A}[/tex] - Acceleration of Sir George and Sir Alfred, measured in meters per square second.

Both knights collide when [tex]x_{G} = x_{A}[/tex], then we simplify this system of equations below:

[tex]x_{G,o} + v_{o,G}\cdot t + \frac{1}{2}\cdot a_{G}\cdot t^{2} = x_{A,o}+v_{o,A}\cdot t + \frac{1}{2}\cdot a_{A}\cdot t^{2}[/tex]

[tex](x_{A,o}-x_{G,o}) +(v_{o,A}-v_{o,G})\cdot t +\frac{1}{2}\cdot (a_{A}-a_{G})\cdot t^{2} = 0[/tex] (3)

If we know that [tex]x_{A,o} = 84.1\,m[/tex], [tex]x_{G,o} = 0\,m[/tex], [tex]v_{o,A} = 0\,\frac{m}{s}[/tex], [tex]v_{o,G} = 0\,\frac{m}{s}[/tex], [tex]a_{A} = -0.289\,\frac{m}{s^{2}}[/tex] and [tex]a_{G} = 0.316\,\frac{m}{s^{2}}[/tex], then we have the following formula:

[tex]84.1 -0.303\cdot t^{2} = 0[/tex] (4)

The time associated with collision is:

[tex]t \approx 16.660\,s[/tex]

And the point of collision is:

[tex]x_{G} = 0\,m + \left(0\,\frac{m}{s} \right)\cdot (16.660\,s)+ \frac{1}{2}\cdot \left(0.316\,\frac{m}{s^{2}} \right) \cdot (16.660\,s)^{2}[/tex]

[tex]x_{G} = 43.854\,m[/tex]

The knights will collide at 43.854 meters relative to Sir George's starting point.

In a particular metal, the mobility of the mobile electrons is 0.0033 (m/s)/(N/C). At a particular moment, the electric field everywhere inside a cube of this metal is 0.033 N/C in the x direction. What is the average drift speed of the mobile electrons in the metal at this moment

Answers

Answer:

the average drift speed of the mobile electrons in the metal is 1.089 x 10⁻ m/s.

Explanation:

Given;

mobility of the mobile electrons in the metal, μ = 0.0033 (m/s)/(N/C)

the electric field strength inside the cube of the metal, E = 0.033 N/C

The average drift speed of the mobile electrons in the metal is calculated as;

v = μE

v =  0.0033 (m/s)/(N/C) x 0.033 N/C

v = 1.089 x 10⁻ m/s.

Therefore, the average drift speed of the mobile electrons in the metal is 1.089 x 10⁻ m/s.

When external forces acting on an object are balanced, what will happen to the object's
motion?
(7 Points)
The object will speed up.
The object will slow down.
The object will change direction.
The object's motion will remain the same
The object will stop

Answers

Answer:

The objects morion will remain the same

Explanation:

What is the efficiency of a machine that has an output work of 1675 J and an input work
of 1895 J?

Answers

Answer:

1.13%

explanation:

work output/work input =100%

A star's emission line of 400 nm appears shifted to 404 nm in the spectrum. What can you conclude from this shift?
A. The star is approaching you with the speed of 3000 km/s.
B. The star is approaching you with the speed of 30300 km/s.
C. The star is receding from you with the speed of 3000 km/s.
D. The star is receding from you with the speed of 30300 km/s.

Answers

Answer:

C. The star is receding from you with the speed of 3000 km/s

Explanation:

To get this answer we use the doppler effect equation . The formula for a receding emissor is given in the attachment.

We solve for V

V = 3x10⁶m/s

V = 3000km/s

We have the wavelength to be shifting towards red. Therefore we conclude that it is receding. We say the star is receding with speed of 3000km/s towards you.

Thank you!

In January 2017, when Clemson won the football championship, Coach Dabo Swinney decided to buy pizza for all students at Clemson to celebrate. So, From his office(Death Valley), he drove 100 m North to reach HWY 93, 200 m East to reach the 133 Junction(Downtown) and 500 m North to reach Papa John's to place his order. What was the total displacement of Coach Swinney

Answers

Answer:

Explanation:

We shall represent each move of coach in vector form , considering unit vector i towards east and unit vector j towards north .

he drove 100 m North

First displacement D₁ = 100 j

200 m East to reach the 133

second displacement D₂ = 200 i

500 m North to reach Papa John's

third displacement

D₃ = 500 j

Total displacement ( resultant displacement )

= D₁ + D₂ + D₃

= 100 j + 200 i + 500 j

= 200 i + 600 j

magnitude of resultant displacement

= √ ( 200² + 600² )

= √ 40000 + 360000

= 632.45  m

a childs weight is 331 N. what is the childs mass in kg?

Answers

Answer:

the child's mass is 33.1 kg

As the distance between the sun and earth decreases, the speed of the planet

a
increases
b
decreases
c
stays the same

Answers

Answer:

Explanation:

Increases. The force of gravity is distance dependent. Therefore, a smaller 'r' value will result in a larger force. Net force is proportional to the acceleration, so the planet will increase its speed.

A baseball is hit when it is 2.5 ft above the ground. It leaves the bat with an initial velocity of 145 ft/sec at a launch angle of 23°. At the instant the ball is hit, an instantaneous gust of wind blows against the ball, adding a component of -14i (ft/sec) to the ball’s initial velocity. A 15-ft-high fence lies 300 ft from home plate in the direction of the flight.
a. Find a vector equation for the path of the baseball.
b. How high does the baseball go, and when does it reach maxi-mum height?
c. Find the range and flight time of the baseball, assuming that the ball is not caught.
d. When is the baseball 20 ft high? How far (ground distance) is the baseball from home plate at that height?
e. Has the batter hit a home run? Explain.

Answers

Answer:

Explanation:

Take base of the ground as origin .

component of initial velocity along i and j direction is 145 con23 and 145 sin23 . Along j , gravity acts but along i , no force acts .  

The path  of ball in vector form

s = (145 cos23- 14 )t  i + ( 2.5 + 145sin23 t - 1/2 g t² ) j

t is time period .

b )

vertical component of initial velocity = 145 sin 23 =

for vertical displacement

v² = u² - 2gH

For maximum height , v = 0

0 = (145 sin 23 )² - 2 g H , H is maximum height attained .

H = 3209.56 / 2 x 9.8

= 163.75 m

Total height attained = 163.75 + 2.5 = 166.25 m

if time be t for reaching maximum height

v = u -gt

0 = 145 sin 23 - gt

t = 145 sin23 / g

= 5.78 s

c )

For time of flight , vertical displacement = 2.5 m

2.5 = - 145 sin 23 t + 1/2 g t²

2.5 = -56.65 t + 4.9 t²

4.9 t² - 56.65 t - 2.5 = 0

t = 11.60s

horizontal displacement during this period = 145 cos23 x 11.60 = 1548.28 m

Range = 1548.28 m.

Other Questions
Plsssssss Help!!!!Look at the map. How might the Gupta empire have been able to flourish through trade? Identify geographic features to support your answer. transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC Hey can somebody get this for me been stuck for five min Select the correct answer from the drop-down menu.What is implied by the underlined section in the passage?Caesar's statement to Brutus implies that imagine being in spanish course on edmentum its pretty hard not gonna kap features of liberalism theory A square has side lengths as shown in the picture and a perimeter of 54.8 centimeters. Write an equation to find the measure of each side length. On January 1, Year 1, a contractor began work on a $3.2 million construction contract that is expected to be completed in 3 years. The contractor concludes that it is appropriate to recognize revenue over time using the input method based on costs incurred (cost-to-cost method). At the inception date, the estimated cost of construction was $2.4 million. The following data relate to the actual and expected construction costs: Year 1 Year 2 Year 3 Costs incurred $720,000 $1,170,000 $1,110,000 Expected future costs $1,680,000 $810,000 $0 For this long-term construction contract, the contractor needs to calculate the estimated dollar values of the revenue and gross profit (loss) to be recognized each year. Complete the contractor's long-term construction contract using the information above. Write the appropriate amounts in the associated cells. Indicate losses by using a leading minus (-) sign. Round all amounts to the nearest dollar. If no entry is necessary, enter a zero (0). Revenue Gross profit (loss) Year 1Year 2 Need help with english class Your teacher has given you two mineral samples. He has told you thatthey have the same crystal structure and hardness.Which other observation would suggest that they are MOST LIKELY thesame mineral?They have the same color.They have the same shape.They have the same size.They have the same mass. 6. To what modern day American event might the medieval tournaments be compared? Une correctamente la pregunta con la respuesta.1. Con quin hablabas? 2. Qu haca tu hermano? 3. Que hacan tus padres? 4. Con quin hablabais? Hablaba con mi hermano. Hablbamos con el estudiante nuevo.Jugaba el ftbol.Caminaban por la playa. A factory uses a special kind of lubricant to maintain its two milling machines. Weekly lubricant usage for each machine is an independent random variable (zero correlation). The first machine has a mean usage of 50.6 gallons and standard deviation of 12 gallons. The second machine has a mean usage of 64.4 gallons and standard deviation of 16 gallons.Suppose that at the beginning of the week, the factory has a total of 135 gallons of lubricant in stock. The factory will not receive any replenishment of lubricant from its supplier until the end of the week. Assume that the total lubricant usage (of the two machines combined) follows a normal distribution. What is the probability that the factory will run out of lubricant before the next replenishment arrives? What is the highest common factor of 72 and 90 The following stem-and-lead plot shows the One record attendance for original Charity Drive meetings what is the mode of these values?A.)48B.) 84C.) 70D.) 66 If you going to answer one question say it in the comments it's gonna be the waste of time bc the answer is going to be deleted 76% of 250 is what number? An illustration of a cell interacting with its environment is provided.Call membraneThe illustration best represents which of the following?Water moving into a cell by the process of osmosis2 .Passive transport of solute into the cell by diffusionActive transport of solute into the cell using energyWater leaving the cell by the process of osmosis A container of water and an equal-sized container of oil are heated at the same rate. After several minutes, the temperature of the oil has risen 20 degrees C, but the temperature of the water has only increases by 8 degrees C. What explains this?Question 6 options:Heat moves from the water to the oil.It takes more energy to increase the temperature of water than to increase the temperature of oilThe water contains more atoms, so it has more thermal energyMore heat was added to the oil than to the water. What is the distance between the points (4, -8) and (10,8)?