1. 2 NH3 → N2 + 3 H2
If 2.8248 moles of H2 are produced, how many moles of NH3 were reacted?
2. CaCO3 → CaO + CO2
If 288.53 grams of CaCO3 are reacted, how many moles of CaO will be produced?
3. 2 KClO3 → 2 KCl + 3 O2
If 92.25 grams of KCl are produced, how many grams of O2 will also be produced?
4. 2 As + 6 NaOH → 2 Na3AsO3 + 3 H2
If 3.0482 moles of NaOH are reacted with 212.2 grams of As, how many moles of H2 will be produced?
5. Sn + 2 CuCl → SnCl2 + 2 Cu
If 2.1492 moles of CuCl are reacted with 355.58 grams of Sn, how many moles of SnCl2 will be produced?

Answers

Answer 1

Answer:

BRO IM IN ONLY 7TH GRADE

Explanation:


Related Questions

What is invection or the definition

Answers

Answer:

here are some synonyms of invective are abuse, billingsgate, obloquy, and vituperation.

What is the main problem with renewable energy
sources?

Answers

Answer:

biggest problem with mainstream renewable energy is intermittency.

Answer:

the biggest problem with mainstream renewable energy is intermittency.

Wind power is only generated when it's windy.

Solar power is only generated when it's sunny.

This creates several fundamental issues.

What temperature kelvin would .97mol of gas be to occupy 26L at 751.2mmHg?

Answers

Answer: 322.56 Kelvin

Explanation:

Use the Ideal Gas Law

[tex]PV=nRT[/tex]

R is the gas constant

T is the temperature in Kelvins

P is the pressure in atmospheres

V is the volume in liters

n is the number of moles of gas

First, the mm of mercury need to be converted to atmospheres using the conversion factor 1atm = 760 torr.

[tex]751.2mmHg (torr) =0.988atm[/tex]

Now plug everything in

[tex](0.988)(26)=(0.97)(0.0821)T\\T=322.56K[/tex]

A solution has [H+] = 7.65*10^-3 what is the [OH-] in the solution?

Answers

Answer:

The hydroxide ion concentration in an aqueous solution, [OH-], in mol L-1, can be calculated if the pOH of the solution is known.

pOH is defined as the negative logarithm (to base 10) of the hydroxide ion concentration in mol L-1 pOH = -log10[OH-]

Explanation:

How does plate movement affect earths crust?

Answers

the answer is yes it does affect hope this helps did this before!

A soccer player applies a force of 56.6 N to a soccer ball while kicking it. If the ball has a mass of 0.46 kg, what is the acceleration of the soccer ball?

Answers

Answer:

[tex]a=123.04\ m/s^2[/tex]

Explanation:

Given that,

Force applied to a soccer player, F = 56.6 N

The mass of the ball, m = 0.46 kg

We need to find the acceleration of the soccer ball. The force acting on the ball is given by :

F = ma

Where

a is the acceleration

[tex]a=\dfrac{F}{m}\\\\a=\dfrac{56.6 }{0.46 }\\\\a=123.04\ m/s^2[/tex]

So, the required solution is [tex]123.04\ m/s^2[/tex].

Which of the following is not a benefit of using biofuels instead of fossil
fuels?
A. Biofuels produce less carbon dioxide when combusted.
B. Biofuels are more sustainable than fossil fuels.
C. Biofuels are renewable.
D. Fossil fuels may be used in the production of biofuels,

Answers

Answer: Fossil fuels may be used in the production of biofuels.

Explanation: Defeats the purpose of using biofuels over fossil fuels if one contains the other.

Answer:

D

Biofuel Disadvantages:

Labor costs are high, and storage space is limited. Excessive water use, particularly in dry areas. Increasing biomass for biofuel production raises agricultural land requirements. 

The diagram below shows the different phase transitions that occur in matter.
Solid
3
Liquid
16
Gas
Which arrow represents the transition in which dew is formed?
1
O2
4
6

Answers

Answer:

C.4

Explanation:

The arrow 4 represents the transition in which dew is formed.

What is Dew?

This is formed as a result of condensation which takes place in the morning or evening and is usually seen on exposed surfaces as water droplets.

The air particles in the form of vapor under low temperatures results in the formation of the substance. The arrow 4 thereby depicts it and makes it the most appropriate choice.,

Read more about Dew here https://brainly.com/question/2696211

Can somebody please draw a mechanism for this reaction (synthesis of varenicline)?​

Answers

Answer:

that is kinda hard I need to serch it up hold on

A sample of neon gas occupies a volume of 752 mL at 25 degrees Celsius. What volume will the gas occupy at -10 degrees Celsius?

Answers

Answer:

New volume v2 = 300.8 ml

Explanation:

Given:

Old volume v1 = 752 ml

Old temperature T1 = 25°C

New temperature T2 = -10°C

Find:

New volume v2

Computation:

Using Ideal gas law formula

V1T2 = V2T1

(752)(-10) = (V2)(25)

New volume v2 = 300.8 ml

The diagram represents liquid water in a pan on a hot plate. The liquid water is boiling and changing into water vapor. The process of boiling water is considered to be a.

Answers

Answer:

Sorry i might be wrong but I believe the answer is evaporation

Explanation:

Its says the diagram So is there a diagram u can show us?

Answer:

physical change, because a new substance is formed

Explanation:

facell's surface area-to-volume ratio increased from 3:1 to 4:1, what impact would that have on the transport of materials across the cell membrane? A. It would be unchanged B. transport would increase C. transport would decrease D. none of the above​

Answers

Answer:

Concentration gradient, size of the particles that are diffusing, and temperature of the system affect the rate of diffusion. Some materials diffuse readily through the membrane, but others require specialized proteins, such as channels and transporters, to carry them into or out of the cell.

Explanation:

Hopefully this helps :)

9. Do all enzymes function at the same pH?

Answers

Each enzyme has an optimum pH but it also has a working range of pH values at which it will still work well. This depends on the type of enzyme. The enzyme pepsin breaks down proteins in the acidic conditions of the stomach. ... Catalase has an optimum pH of 9 and a working range of between pH 7-11.        Hope this was helpful

Explanation:

Mercury metal is poured into a graduated cylinder that hold exactly 22.5 mL. The mercury used to fill the cylinder weighs 306.0 g. From this information, calculate the density of mercury.

Answers

Answer: density = mass/volume

Explanation:

In which location would fishermen most likely catch a greater number of fish?
O A. at the shoreline
B. in an upwelling
C. in the intertidal zone
D. on the deep-ocean floor

Answers

A am pretty sure because I go fishing and yea

5. Molds and bacteria contain hydrolytic enzymes used to breakdown proteins,
lipids, etc.
a) (5 Points) Why does food not spoil as fast when it is refrigerated as it
would at room temperature?
b) (5 Points) Meat begins to feel slimy and it smells when it is spoiled due to
a decomposition reaction with oxygen and carbon dioxide. Why would
meats spoil less rapidly when left unsliced?

Answers

Answer:Temperature affects storage time and food deteriorates faster at higher temperatures. Microorganisms grow rapidly at room temperature . Thus to slow microbial growth, enzymatic and oxidative processes, food must be stored at room temperature.

Due to decomposition reactions with oxygen or carbon dioxide in the air, meat begins to feel slimy and smell spoiled. ... Because of its smaller surface area, the unsliced meat would have less collisions and therefore, a slower reaction rate.

Explanation:

1) El CO2 que los astronautas exhalan se extrae de la atmósfera de la nave espacial por reacción con KOH según la reacción: CO2 (g) + 2 KOH (l) → K2CO3 (s) + H2O (l) a) Cúantos gramos de CO2 se pueden extraer con 500 g de KOH ? b) Cuántos gramos de agua se producen? 2) Cuando se hacen reaccionar hidrógeno y nitrógeno se produce amoniaco, un fertilizante benéfico para las plantas. ¿Cuántos moles de hidrógeno se requieren para que reaccionen con 12.75 moles de nitrógeno? La reacción es la siguiente: N2 + 3 H2 → 2NH3 3) El propano (C3H8) es usado como combustible en los hogares, reacciona con el oxigeno para producir dióxido de carbono (CO2) y agua (H2O) mediante la siguiente reacción: C3H8 + 5 O2 → 3 CO2 + 4 H2O a) Si se queman 2 Litros de propano (C3H8) calcula los litros de CO2 que se emiten a la atmósfera.

Answers

Answer:

a. 4.46 moles de CO₂

b. 80.2 g de H₂O

38.25 moles de H₂

5.55 L de dióxido de carbono

Explanation:

Comenzamos con la reacción: CO₂ (g) + 2 KOH (l) → K₂CO₃ ↓ (s) + H₂O (l)

a. Podemos ver que la relación estequiométrica es 2 a 1.

Pasamos la masa de KOH a moles → 500 g . 1mol/ 56.1g = 8.91 moles

2 moles de KOH necesitan 1 mol de dióxido

Entonces, 8.91 moles necesitarán (8.91 . 1)/2 = 4.46 moles

Convertimos los moles en masa → 4.46 mol . 44g /1mol = 196 g de CO₂

b. Como no tenemos información de los reactivos, trabajamos con el KOH (recorda que siempre hacemos los cálculos con el reactivo limitante).

La relacion estequiometrica también es 2 a 1.

Con 2 moles de KOH producimos 1 mol de agua

Entonces 8.91 moles producirán la mitad, 4.46 moles

Pasamos a gramos  → 4.46 mol . 18g /1mol = 80.2 g de H₂O

N₂ + 3H₂ → 2NH₃

En esta relacion, la relación de moles es 1 a 3.

1 mol de N₂ necesita 3 moles de H₂ para llevar a cabo la reacción

12.75 moles de nitrogeno reaccionarán con (12.75 . 3)/ 1 = 38.25 moles de H₂

La siguiente es una reacción de combustión:

C₃H₈ + 5O₂ → 3 CO₂ + 4 H₂O

Como en este caso tenemos volumen, necesitamos averiguar la densidad del propano para sacar la masa y de ahi los moles:

Densidad del propano es 1.83 g/L

Si tenemos 2 Litros de gas, entonces tendremos el doble de masa

2L .  1.83 g/L = 3.66 g

Convertimos a moles → 3.66 g . 1 mol/44g = 0.083 moles

1 mol de propano produce 3 moles de dióxido.

0.083 moles producirán (0.083 .3) /1 = 0.249 moles

Convertimos a gramos → 0.249 moles . 44g/ 1mol = 10.98 g

La densidad del CO₂ es 1.976 g/L

d = m/V → V = m/d →  10.98 g / 1.976 L = 5.55 L

what are the reactions in a chemical reaction

A. the new substances that are produced
B. the substances that interact
C. the catalysts
D. the chemical formula of the substances ​

Answers

Answer:

B

Explanation:

chemical reaction a process in which one or more substance the recessed ants are converted to one or more different substances the products substances are either chemical elements or compounds a chemical reaction rearranges the consulstituent atoms of reactants to create different substances products

How many molecules are in 83.2 g of chlorine gas (Cl2)?

Group of answer choices
1.42 x 10^24 molecules
1.78 x 10^28 molecules
7.04 x 10^23 molecules
14.2 x 10^24 molecules

Answers

Answer:

Try everything or guess, that will always work

1.42 x 10^24 molecules

1.78 x 10^28 molecules

7.04 x 10^23 molecules

14.2 x 10^24 molecules

Explanation:

where do genes come form?

Answers

Answer:

im rly good with this stuff and i'm working on genetics and phenotypes and stuff.

Explanation:

information that determines your traits basically from your parents

The specific heat of liquid H2O is 4.184 J/g°C. If 32.7 grams of water are heated from
12 °C to 77 °C, how much energy is required?

Look at picture
ASAP please will mark as brainlist don’t got much time

Answers

Answer:

8893.092J

Explanation:

energy= mass × specific heat capacity of water × change in temperature

=32.7×4.184×(77-12)

=8893.092J

Most gases exist as molecules, for example, fluorine is F2.
Explain why the elements in Group 0 exist as single atoms.

Answers

They are all stable and have eight valence electrons

Group 0 is the noble gas elements in periodic table. They are all unreactive because, they have completely filled electronic configuration and thus they are stable. This stability to be a single element make them so.

What are noble gases?

Noble gases are helium, neon, argon, krypton and xenon. They are 18th group elements in periodic table. Also called zero group elements. The general electronic configuration of these elements is ns² np⁶.

Noble gases contains eight electrons in their valence shell and thus completed octet. Atoms with less number of electrons in valence shell tends to attain octet by losing or gaining electrons to their valence shell.

Every elements except noble gases are electron deficient or electron rich. The electron rich elements will lose their electron to attain stability and the elements with less electrons gain them through bonding. That's why they are existing as molecules.

Therefore, the elements of zero group are highly stable and they do not lose or gain electrons to form molecules.

To find more about noble gases, refer the link below:

https://brainly.com/question/11764545

#SPJ2

Oliver builds a circuit connecting a light bulb to a battery with wires, leaving a gap in one of the wires. He places several objects across the gap to close the loop. He wants to see which objects allow electricity to flow and turn on the light bulb. Why do some materials allow electricity to flow through while others do not?
Plz help

A. Electricity will flow if the atoms in the material are bound tightly to each other.

B. Electricity will flow if the atoms in the material are bound loosely to each other.

C. Electricity will flow if the electrons are bound tightly to their atoms in the material.

D. Electricity will flow if the electrons are bound loosely to their atoms in the material.

Answers

Answer:

It is c

Explanation:

An object has a mass of 100kg and a volume of 10m^3.

What is its density?

SHOW WORK FOR FULL CREDIT

Answers

Answer:

Mass = 100g

Volume = 10 cm³

Density = Mass/Volume

           = 100/10

           = 10 cm-³

breathe in air container more ____ than breathed out air
a hydrogen
b oxygen
c carbon dioxide
d helium

Answers

Answer:

c

Explanation:

carbon dioxide ......

Does this make sense?

Answers

Makes sense to me but I would try and add another sentence in the middle to smooth it out some

Answer:

Yes, but you have a bit of grammar mistakes.

Explanation:

Mount. Vesuvius were an African boundary....

Write the combustion equation for propane (C3H8). What is the sum of the coefficients for the reactants and products? Group of answer choices 13 14 10 11 12

Answers

Answer:

13

Explanation:

Let's consider the unbalanced equation for the combustion of propane.

C₃H₈ + O₂ ⇒ CO₂ + H₂O

We will begin balancing H atoms by multiplying H₂O by 4.

C₃H₈ + O₂ ⇒ CO₂ + 4 H₂O

Now, we balance C atoms by multiplying CO₂ by 3.

C₃H₈ + O₂ ⇒ 3 CO₂ + 4 H₂O

Finally, we get the balanced equation multiplying O₂ by 5.

C₃H₈ + 5 O₂ ⇒ 3 CO₂ + 4 H₂O

The sum of the coefficients is 1 + 5 + 3 + 4 = 13.

Swinging a golf club toward a golf
ball and hitting it off the tee.

Answers

What u have to tell us what to do

What is the mass percentage composition of O in L-carnitine (C7H15NO3), a compound that is taken as a dietary supplement to re- duce muscle fatigue?
Answer in units of %. Your answer must be within ± 3.0%

Answers

Answer:

3.5% not sure but thank it is

hiii please help i’ll give brainliest

Answers

Answer:

the applied force is greater than the force of friction

Explanation:

Other Questions
transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC Hey can somebody get this for me been stuck for five min Select the correct answer from the drop-down menu.What is implied by the underlined section in the passage?Caesar's statement to Brutus implies that imagine being in spanish course on edmentum its pretty hard not gonna kap features of liberalism theory A square has side lengths as shown in the picture and a perimeter of 54.8 centimeters. Write an equation to find the measure of each side length. On January 1, Year 1, a contractor began work on a $3.2 million construction contract that is expected to be completed in 3 years. The contractor concludes that it is appropriate to recognize revenue over time using the input method based on costs incurred (cost-to-cost method). At the inception date, the estimated cost of construction was $2.4 million. The following data relate to the actual and expected construction costs: Year 1 Year 2 Year 3 Costs incurred $720,000 $1,170,000 $1,110,000 Expected future costs $1,680,000 $810,000 $0 For this long-term construction contract, the contractor needs to calculate the estimated dollar values of the revenue and gross profit (loss) to be recognized each year. Complete the contractor's long-term construction contract using the information above. Write the appropriate amounts in the associated cells. Indicate losses by using a leading minus (-) sign. Round all amounts to the nearest dollar. If no entry is necessary, enter a zero (0). Revenue Gross profit (loss) Year 1Year 2 Need help with english class Your teacher has given you two mineral samples. He has told you thatthey have the same crystal structure and hardness.Which other observation would suggest that they are MOST LIKELY thesame mineral?They have the same color.They have the same shape.They have the same size.They have the same mass. 6. To what modern day American event might the medieval tournaments be compared? Une correctamente la pregunta con la respuesta.1. Con quin hablabas? 2. Qu haca tu hermano? 3. Que hacan tus padres? 4. Con quin hablabais? Hablaba con mi hermano. Hablbamos con el estudiante nuevo.Jugaba el ftbol.Caminaban por la playa. A factory uses a special kind of lubricant to maintain its two milling machines. Weekly lubricant usage for each machine is an independent random variable (zero correlation). The first machine has a mean usage of 50.6 gallons and standard deviation of 12 gallons. The second machine has a mean usage of 64.4 gallons and standard deviation of 16 gallons.Suppose that at the beginning of the week, the factory has a total of 135 gallons of lubricant in stock. The factory will not receive any replenishment of lubricant from its supplier until the end of the week. Assume that the total lubricant usage (of the two machines combined) follows a normal distribution. What is the probability that the factory will run out of lubricant before the next replenishment arrives? What is the highest common factor of 72 and 90 The following stem-and-lead plot shows the One record attendance for original Charity Drive meetings what is the mode of these values?A.)48B.) 84C.) 70D.) 66 If you going to answer one question say it in the comments it's gonna be the waste of time bc the answer is going to be deleted 76% of 250 is what number? An illustration of a cell interacting with its environment is provided.Call membraneThe illustration best represents which of the following?Water moving into a cell by the process of osmosis2 .Passive transport of solute into the cell by diffusionActive transport of solute into the cell using energyWater leaving the cell by the process of osmosis A container of water and an equal-sized container of oil are heated at the same rate. After several minutes, the temperature of the oil has risen 20 degrees C, but the temperature of the water has only increases by 8 degrees C. What explains this?Question 6 options:Heat moves from the water to the oil.It takes more energy to increase the temperature of water than to increase the temperature of oilThe water contains more atoms, so it has more thermal energyMore heat was added to the oil than to the water. What is the distance between the points (4, -8) and (10,8)? A scalar is a mathematical term for:a. measurementb. Magnitude and Directionc. A number and a unitd. A Scale