Answer:
1.(a ) alpha-ketoglutarate dehydrogenase
(c) malate dehydrogenase
(d) isocitrate dehydrogenase
2. b. isocitrate dehydrogenase d. alpha-ketoglutarate dehydrogenase
3. b. citrate synthase (c) succinyl-CoA synthesase
4. b. alpha-ketoglutarate dehydrogenase c. citrate synthase d. malate dehydrogenase
5. a. aconitase
Explanation:
The citric acid cycle is responsible for the oxidation of acetyl-CoA produced from pyruvate from glycolysis. The citric acid cycle has eight steps requiring nine enzymatic reactions involving eight enzymes.
The enzymes in the citric acid cycle are: citrate synthase , aconitase, isocitrate dehydrogenase, alpha-ketoglutarate dehydrogenase , succinyl-CoA synthesase, succinate dehydrogenase , fumarase , and malate dehydrogenase .
1. The dehydrogenation reactions of isocitrate dehydrogenase, alpha-ketoglutarate dehydrogenase , and malate dehydrogenase produces NADH from isocitrate, alpha-ketoglutarate and malate respectively.
2. Oxidative decorboxylation (removal of carbon as CO₂) also occurs in the reactions of isocitrate dehydrogenase and alpha-ketoglutarate dehydrogenase to produce alpha-ketoglutarate and succinyl-CoA respectively.
3. Coenzyme-A (CoA-SH) is produced in the reactions of citrate synthase and succinyl-CoA sythetase to produce citrate and succinate respectively.
4. The enzymes alpha-ketoglutarate dehydrogenase has alpha-ketoglutarate as substrate , whereas citrate synthase and malate dehydrogenase has oxaloacetate as substrate. These substrates are alpha-keto acids.
5. Aconitase catalyzes the conversion of citrate to isocitrate by first a dehydration and then a hydration reaction.
felice has a scar on her arm that happened when she broke a glass at the age of 3. at the age of 8, she asked her mom why she has a scar, and her mom responded that she was bitten by the neighbor's dog. since then, whenever she is asked about the scar, she has a distinct memory of what happened on the day the dog bit her (even though this never happened). this illustrates: the equipotentiality hypothesis the encoding specificity principle the misinformation effect levels of processing theory
Answer:
the misinformation effect
Explanation:
In psychology, misinformation effect occurs when false memories are formed as a result of the misleading information that was provided after the original event has taken place. This effect was studied by a psychologist named Elizabeth Loftus.
Elizabeth Loftus in her series of experiments discovered that false memories about an event can be induced by suggesting or giving wrong information about it. Hence, the involved persons remember a wrong information about the experienced event based on what they were led to remember via wrong information.
This is the case Felice, who was fed with a wrong information about the scar on her arm. This information make her have a false memory of the event i.e dog bite instead of a broken glass
A sequence of DNA ( 3' CCTCCGATGA 5' ) is used as a TEMPLATE strand for dideoxy sequencing. The products are made and the products are run in 4 different lanes (labelled "A", "G", "C", and "T") of an electrophoretic gel. Which lane will contain the product that ran furthest down the gel
Answer:
The reaction with adenine dideoxynucleotides will run furthest in the gel
Explanation:
In dideoxy sequencing (also known as Sanger sequencing), the DNA template is used to run four different reactions in which only one class of dideoxynucleotide (ddNTP) is added. These four different ddNTPs (i.e., ddATP, ddCTP, ddTTP or ddGTP) act as terminators during DNA synthesis. Moreover, the additional factors required for DNA synthesis including standard deoxynucleotides (dNTPs), DNA polymerase and site-specific primers are added in equal volumes to prepare these four different reactions. Thus, during electrophoresis, the sizes of the DNA bands will depend on the specific ddNTP used in each reaction. In this case, the reaction containing ddATP (capable of terminating DNA synthesis at the 5' end) will run furthest in the gel.
Complete the following vocabulary exercise related to DNA replication.Match the words in the left-hand column with the appropriate blank in the sentences in the right-hand column.
1. During DNA replication, an open section of DNA, in which a DNA polymerase can replicate DNA, is called a_______ .
2. After replication is complete, the new DNAs, called_______ , are identical to each other.
3. The enzyme that can replicate DNA is called_______ .
4. _________are the short sections of DNA that are synthesized on the lagging strand of the replicating DNA.
5. The new DNA strand that grows continuously in the 5' to 3' direction is called the________.
leading strand
okazaki fragments
replication fork
DNA polymerase
daughter DNA
Answer:
1. During DNA replication, an open section of DNA, in which a DNA polymerase can replicate DNA, is called a replication fork.
2. After replication is complete, the new DNAs, called daughter DNA , are identical to each other.
3. The enzyme that can replicate DNA is called DNA polymerase.
4. Okazaki fragments are the short sections of DNA that are synthesized on the lagging strand of the replicating DNA.
5. The new DNA strand that grows continuously in the 5' to 3' direction is called the leading strand.
Explanation:
Hope it helps.
DNA replication is the process by which a cell makes an exact copy of its DNA.
It is a fundamental process in all living organisms that allows for the accurate transmission of genetic information from one generation to the next. During DNA replication, the double-stranded DNA molecule unwinds and separates into two individual strands.
Each of the original strands serves as a template for the synthesis of new DNA occurs. This replication process follows a semi-conservative mechanism.
The correct options are:
Replication forkDaughter DNADNA polymeraseOkazaki fragmentsLeading strandLearn more about DNA replication, here:
https://brainly.com/question/30111562
#SPJ6
In jimsonweed, purple flower (P) is dominant to white (p), and spiny pods (S) are dominant to smooth (s).
A true-breeding plant with white flowers and spiny pods is crossed to a true-breeding plant with purple flowers and smooth pods. Determine the phenotype of:__________.
a) the F1 generation;
b) the F2 generation;
c) the progeny of a cross of the F1 plants back to the white, spiny parent; and
d) the progeny of a cross of the F1 back to the purple, smooth parent.
Answer:
See attached image for detailed punnet squares and diagrams
a) F1 generation: Purple flower and spiny pods (PpSs) offsprings
b) F2 generation: Puple flower, spiny pods (9), Purple flower, smooth pods (3), White flower, spiny pods (3), white flower, smooth pods (1).
c) The progenies are: PpSS (4), PpSs (4), ppSS (4), and ppSs (4)
d) The progenies are: PPSs (4), PPss (4), PpSs (4), Ppss (4)
Explanation:
This question involves two distinct genes in jimsonweed; one coding for flower colour and the other for pod texture. The alleles for purple colour (P) and spiny pods (S) are dominant over the alleles of white flower (p) and smooth pods (s) in the two genes respectively.
A true-breeding plant with white flowers and spiny pods will have genotype: ppSS while a true-breeding plant with purple flowers and smooth pods will have genotype: PPss. In a cross between these two parents, the following combinations of gametes will be produced:
ppSS- pS, pS, pS and pS
PPss- Ps, Ps, Ps, PS
a) Hence, the F1 offsprings from this cross will possess a heterozygous genotype: PpSs, which is phenotypically purple-flowered and spiny-pod.
b) if the F1 offsprings are self-crossed i.e. PpSs × PpSs, gametes PS, Ps, pS, ps will be produced by each parent. These gametes will be used in a punnet square (see attached image) to produce the following F2 offsprings in proportion:
Purple flower, spinny pods (9)
Purple flower, smooth pods (3)
White flower, spiny pods (3)
White flower, smooth pods (1)
c) if the F1 offsprings are crossed back with the white, spiny parent i.e. PpSs × ppSS. The following progeny of offsprings will be produced: (see attached image)
PpSS (4),
PpSs (4),
ppSS (4), and
ppSs (4)
d) if the F1 offsprings are crossed back with the purple, smooth parent i.e. PpSs × PPss, the following progeny will be produced:
PPSs (4),
PPss (4),
PpSs (4), and
Ppss (4)
The true breeding plant.
As per the question, the jimson weed is a purple flower with capital P and is dominant to white (p) and a spiny pods of (S) which are dominant to smooth (s). The Punnett square method is used for the method. The true breeding have seperate types of genetic make ups.
Answer is F1 generation (PpSs), F2 generation has 9 purple flowers.
True-breeder plant with the white flowers and spiny pods s crossed to a true-breeding plant with the F1 gene will be a flower and spiny pods (Pp Ss) offspring. For the F2 gene Purple flower, spiny pods (9), Purple flower, smooth pods (3), White flower, and spiny pods (3), the white flower, and a smooth pods (1).The progenies are of PpSS (4), PpSs (4), pp SS (4), and ppSs. The progenies follow PPSs (4), the PP ss (4), PpSs (4), Ppss.Learn more about the purple flower.
brainly.com/question/14774402.
what is the effect of the bio geochemical Cycles
Answer:
plss mark me as BRAINLIEST
Explanation:
Human activities have greatly increased carbon dioxide levels in the atmosphere and nitrogen levels in the biosphere. Altered biogeochemical cycles combined with climate change increase the vulnerability of biodiversity, food security, human health, and water quality to a changing climate.
Which of the following techniques involves hybridizing a cDNA sample to a chip containing thousands of single-stranded DNA sequences, allowing one to study the expression of thousands of genes simultaneously?
A) PCR
B) Southern blot
C) FISH
D) Agarose gel electrophoresis
E) DNA microarray
Answer: Option E.
DNA micro array.
Explanation:
DNA microarray is a technique that involves hybridizing cDNA into a chip that contains thousands of single stranded DNA sequences. This technique enables one to study expression of thousands of genes at the same time.looks for extra (duplicated) or missing (deleted) chromosomal segments, sometimes called copy number variants (CNVs).
DNA microarrays are microscope slides which are printed with thousands of tiny spots in specific different positions, and each of the spots contain a known DNA sequence or gene.
primary use of DNA microarrays is transcriptional profiling.
The basic principle behind the DNA microarray is “ nucleic acid hybridization.
For 2 minutes write down every sound you hear. Write in dot points.
What was the quietest noise? What was the loudest noise? Did you have any distractions?
an example could be:
quietest noise - a clock
loudest noise - family members talking
distractions - a TV show
Organize the levels of classification listed below in descending order.
a. Order
b. Genus
c. Phylum
d. Species
e. Class
f. Domain
g. Kingdom
h. Family
Answer:
f. Domain
g. Kingdom
c. Phylum
e. Class
a. Order
h. Family
b. Genus
d. Species
Which could best be used to explain why bacteria can infect a person very quickly? outer capsule binary fission protective covering genetic recombination
Answer:
The answer is binary fission.
Explanation:
Binary fission is the process of reproduction by bacteria in which they divide into two cells.
They do this about every 20-30 minutes, this fast rate of reproduction could be best be used to explain why bacteria can infect a person very quickly.
Answer:
B. Binary Fission
Explanation:
Um. BeCaUsE
Would any of these genotypes affect your species’ survival in its natural habitat? Explain why or why not.
Hello. You did not enter the answer options, but I can help you by saying that a genotype would affect the survival of a species in its natural habitat if that genotype establishes a disadvantageous characteristic for that habitat.
For example: We know that the Arctic foxes have genotypes that allow them to have a white color very advantageous for their natural habitat. That's because the white color, makes the fox camouflage itself in the environment surrounded by snow and equally white. This allows the fox to go unnoticed by possible predators, that is, its genotype favors the survival of the species. On the other hand, if the arctic fox genotype established a red color in the animal, it would affect its survival, in relation to its natural habitat. This is because it had not allowed the animal to camouflage itself in the environment, leaving it exposed to predators.
Yellow dung flies (Scathophaga stercoraria) are diploid organisms with 12 chromosomes in their diploid cells. Without taking into account recombination, how many different genetic gametes can this fly generate based on the arrangement of its chromosomes in the metaphase plate during meiosis
In the given case, the sum of the number of gametes possible in the fruit fly is 2¹² or 4096.
Determination of the number of genetic gametes:
At metaphase I, the arrangement of chromosomes takes place at the equatorial plate and at the equator, the orientation of homologous pairs takes place randomly. This orientation helps in finding the genes found within a gamete as each of the gametes will get only one chromatid of a chromosome.
Now by independent assortment, the variation occurs within the gametes, which suggests that the alleles of distinct genes separate independently from one another at the time of cell differentiation. Due to independent assortment, the number of different kinds of gametes possible within the chromosomes can be determined by using the formula, 2ⁿ, where n is the number of chromosomes present within a set.
Thus, based on the given information, the number of chromosomes present in a fruit fly is 12. Thus, the sum of the number of gametes possible in the mentioned fruit fly is 2¹² or 4096.
Find out more information about determination of gametes here:
https://brainly.com/question/6760841
g The pH of the space between the inner and outer mitochondrial membrane is ______________ the pH of the mitochondrial matrix.
Answer:
lower than
Explanation:
The protons obtained from the spit of hydrogen atoms, to protons and electrons, (which was transported to the Matrix of the mitochondria by NADH and FADH2 ) are pumped by PMF into the intramembrane space.
The constant pumps by the PMF,due to the electron transport chains set up high concentration of Hydrogen ions in the intramembrane space.If pH is -log[H+] then the high the number of H+/protons,the stronger the acidity,and lower the pH of the medium.
This set up higher electrochemical gradient compare to the matrix.Thus H+ diffuses down the gradients into the matrix.
This generate energy needed for the synthesis of ATPs by ATPase synthase in the matrix
A certain strain of E. coli is constitutive for the enzymes for lactose metabolism. On an F' plasmid you have the choice of adding one (but only one) element of the lac system to make the bacteria a merodiploid for that element. Assume the original E. coli has wild-type structural loci. If your goal is to determine whether the lac operon is constitutive because of a mutant regulator OR because of a mutant operator, which one wild-type element of the lac operon would you add using sexduction?
a. operator region
b. regulator (repressor)
c. gene promoter region
d. structural genes
Answer:
The correct option is B: regulator (repressor)
Explanation:
A regulator gene would be required to control the expression by either increasing or decreasing the transcription of that particular gene. In doing so, the amount of protein product made by the gene can be regulated. In the wild-type case, the gene lacl is responsible for generating the mRNA which translates to a Lac repressor protein that binds at the operator region.
The terms ________ and immunoglobulin are often used interchangeably. They are found in the blood and tissue fluids, as well as many secretions.
Answer:
the answer is antigen.
Describe the flow of energy from a glucose molecule to ATP during respiration, and compare this to the flow of energy from glucose to acids and alcohols during fermentation. Specifically, what carries the energy from glucose to ATP - what energy conversions must occur during the process. Compare the ATP production during respiration with ATP production during fermentation.
Answer:
Glycolysis is the first step of the cellular respiration in an organism which is metabolic pathway that is completed in the cytosol of the cell that leads to the converting glucose to the pyruvate in order to produce energy in form of ATP:
1. Glucose-6-phosphate is ---> fructose-6-phosphate
2. fructose-6-phosphate ---> fructose-1,6-biphosphate
3. fructose-1,6-biphosphate ---> glyceraldehyde-3-phosphate(GAP) and dihydroxyacetone phosphate (DHAP).
4. GAP is oxidised ----> 3-bisphosphoglycerate + NADH
5. 3-bisphosphoglycerate ----> 1,3-bisphophoglycerat
6. 1,3-bisphophoglycerate ----> 3-phosphoglycerate
7. 3-phosphoglycerate ----> 2-phosphoglycerate
8. 2-phosphoglycerate ----> phosphoenolpyruvate (PEP)
9. phosphoenolpyruvate to ADP ----> pyruvic acid + ATP
Formation of ATP occurs in both pathways or process that are respiration and fermentation. Fermentation is a catabolic pathway leads to the degradation of sugars (partial) that result in the gain of energy and this energy are absorbed in ATP. There are difference of the amount of energy or ATP produce in these process in respiration 38 ATP are produced whereas during fermentation only 2 ATP are produced.
The process of DNA replication is described. Identify the enzyme that participates in each part of the replication process. DNA partially unwinds as the hydrogen bonds between complementary bases are broken. This process is catalyzed by the enzyme
Answer:
Helicase
Explanation:
DNA replication is the process in which DNA makes copies of itself.
The process of DNA replication is supported by several enzymes.
The initial step of DNA replication is unwinding of double stranded DNA which is catalyzed by helicase enzyme. Helicase enzymes breaks the hydrogen bond between the DNA strands and prepare them for replication process.
Hence, the correct asnwer is "Helicase".
How long does it take you on average to take a dump?
Answer:
15 min
Explanation:
Answer:
5-20 minutes
Explanation:
On a good day with not much poop and it's easy to come out it will take around 5 minutes. On a bad day though with lots of poop and where it's very hard to come out to the point where you have to constipate yourself, it will take around 20 minutes.
You ran an experiment in lab that produced the following gel-electrophoresis results. The smallest band recorded was 2.03 kb and the largest band recorded was 17.15 kb.Which well contained a 17.15kb fragment but not a 2.03kb fragment?
A. 1
B. 2
C. 3
D. 4
Answer: C
Explanation:
Gel-electrophoresis separate macromolecules according to their size and charge. In the exposed example, the well that contains a 17.15kb fragment but not a 2.03kb fragment is number 2 (Option B) (based on the attached image).
---------------------------------
Gel-electrophoresis is a technique widely used in labs to separate macromolecules, like DNA, RNA, and proteins.
This technique is based on the size and charge of the molecules. It expresses a pattern of differentiation according to the length of the fragments.
Once placed in the gel, molecules start their migration. Smaller molecules will travel faster and farther than the bigger ones.
So whenever we see a gel-electrophoresis result, we know that the largest fragments are placed in the first position, while the smallest ones are in the last position.
In the exposed example, we know that the smallest fragment is 2.03kb, while the largest one is 17.15kb.
We assume that largest fragment will be placed in the first position, and the smallest one will be placed in the last position.
First position⇒ Biggest fragment ⇒17.15kb⇒ They hardly migrateLast position⇒Smallest fragment ⇒2.03kb⇒Migrate faster and fartherWe need to find a well that has fragments of 17.15 kb but not fragments of 2.03 kb.
So let us find the well in which there are molecules in the first position but not in the last one.
Note: In the attached files, you will find a gel-electrophoresis result image on which I base my answer. If this image is different from yours, choose the correct well in your gel-electrophoresis following the same reasoning.
The correct well is Two (Option B). Molecules have migrated to the first position but not to the last one.
-------------------------------------
Related link: https://brainly.com/question/2960312?referrer=searchResults
A person who has Diabetes has difficulty controlling the glucose levels in their blood and must take Insulin to regulate it. Which characteristic of life do they need assistance with?
Based on the given information I believe this will help:
Insulin is a hormone made by the pancreas that allows your body to use sugar (glucose) from carbohydrates in the food that you eat for energy or to store glucose for future use. Insulin helps keeps your blood sugar level from getting too high (hyperglycemia) or too low (hypoglycemia).
If you have more sugar in your body than it needs, insulin helps store the sugar in your liver and releases it when your blood sugar level is low or if you need more sugar, such as in between meals or during physical activity.
If your body does not produce enough insulin or your cells are resistant to the effects of insulin, you may develop hyperglycemia (high blood sugar), which can cause long-term complications if the blood sugar levels stay elevated for long periods of time.
Treatment:
People with type diabetes cannot make insulin because the beta cells in their pancreas are damaged or destroyed. Therefore, these people will need insulin injections to allow their body to process glucose and avoid complications from hyperglycemia.
Match the following respiratory conditions to the
1. Emphysema
a. A condition in which an attack can trigger constri
2. Pneumonia
b. The inflammation of bronchioles in the lungs
3. Bronchitis
c. The buildup of fluid in the alveoli of the lungs
4. Asthma
d. A condition often caused by smoking, featuring d
Answer:
D
C
B
A
Alveoli
larynx
mucus
nitrogen
diaphragm
Air enters the body through the mouth or nose and passes through the pharynx and larynx. Then it travels down the trachea and branches through the bronchi into the two lungs. In the lungs, small alveoli are the site of gas exchange where carbon dioxide diffuses into the lungs for exhalation, while oxygen from the air diffuses into the capillaries surrounding the alveoli to be pumped throughout the body.
Explanation:
Emphysema is caused by smoking. Pneumonia is buildup of fluid in the alveoli of the lungs, bronchitis is inflammation of bronchioles in the lungs, and asthma is condition in which an attack can trigger constrict air passage. The correct match is 1-d, 2-c, 3-b, and 4-a.
What is respiration?The process by which cells shatter down sugar and obtain energy by using oxygen.
There are several conditions that can affect the respiratory conditions. Some can be listed as:
Smoking causes emphysema. Pneumonia is the accumulation of fluid in the alveoli of the lungs.Bronchitis is the inflammation of the bronchioles in the lungs.Asthma is a condition in which an attack can cause constrictions in the airways.Thus, the correct match is 1-d, 2-c, 3-b, and 4-a.
For more details regarding respiration, visit:
https://brainly.com/question/12605249
#SPJ5
In the process of cellular respiration, glucose is broken down into simpler compounds. Respiration is carried on in the presence (aerobic) or absence (anaerobic) of free oxygen.
a. True
b. False
Answer:
a. True
Explanation:
Cellular Respiration is the process by which cells of all living organisms obtain the required energy for their metabolic activities. Respiration is a catabolic process whereby glucose is broken down to release Its high energy and used to synthesize a usable form of energy by the cell (ATP).
Cellular respiration occurs in living cells with oxygen (aerobic) or without oxygen (anaerobic). In aerobic respiration, three processes viz: Glycolysis, Kreb's cycle and Oxidative phosphorylation are involved. Oxygen is the final electron acceptor in the Electron transport chain of the Oxidative phosphorylation.
On the other hand, anaerobic respiration is employed by certain bacteria in the absence of oxygen. In anaerobic respiration, another final electron acceptor is used other than oxygen.
Both processes yield Adenosine triphosphate (ATP).
is lactase exergonic
Answer:
The correct answer is - yes lactase action is exergonic.
Explanation:
Lactase is an enzyme located in the small intestine of mammals including humans, however it is produced by many organisms in their body. Lactase is an essential enzyme as it helps in the digestion of the whole milk by breaking down the lactose, sugar present in milk.
Exergonic reactions are the reaction that releases energy by the breaking of molecules in any reaction. Generally, catabolic reactions are exergonic lie lactase catabolizes the lactose present in milk and release energy.
Thus, the correct answer is - yes lactase action is exergonic.
In chickens, a condition referred to as "creeper" exists whereby the bird has very short legs and wings, and appears to be creeping when it walks. If creepers are bred to normal chickens, one-half of the offspring are normal and one-half are creepers. Creepers never breed true. If bred together, they yield two-thirds creepers and one-third normal. Propose an explanation for the inheritance of this condition.
Answer Explanation:
Due to technical difficulties, the answer and explanation for this problem are available in the attached file.
Environmental engineers minimize the impact of land development on the environment.
Please select the best answer from the choices provided
t or f
The correct answer is True
Explanation:
The focus of environmental engineering is to create technologies and solutions to prevent environmental pollution and destruction, and in this way protect human societies, as well as, natural ecosystems. This includes solutions to reduce the impact of land development that involves altering natural ecosystems to build houses and other human constructions. In this area, environmental engineers make the use of land for humans efficient and create models that are more friendly to the environment. Thus, the statement is true.
Answer:
T R U EExplanation:
just took the test on and got it right
Is your prediction supported by the membrane potential chart?
Answer:
The membrane potential of a resting neuron is primarily determined by the movement of K+start text, K, end text, start superscript, plus, end superscript ions across the membrane. ... Zero voltage across the membrane, as measured by a voltmeter with one electrode inside and one electrode outside the cell.
Answer:
Yes, it is. The chart shows that the initial charge of the neuron is negative. When the neuron is stimulated, sodium ions enter the cell. So, the voltage inside the cell changes to positive. When potassium ions move outward, the voltage decreases until it reaches its previous state.
Explanation:
Drag each tile to the correct box. Lucia is walking barefoot in her yard. She accidentally steps on a nail. How will her nervous system work to generate a reaction? Arrange the events chronologically.
Answer:
First the proprioceptors found in the tissues will capture tissue damage and the presence of a continuity solution in the skin, then these receptors will activate the afferent pathway, which is the pathway of pain, which is sensory.
This stimulus that ascends to the central nervous system activates the "flight" mechanism in the face of pain (it is also known as the withdrawal mechanism).
It is in this way that a stimulation is sent to the alpha motor neuron in the form of an action potential as an efferent pathway to the skeletal muscles of the foot and the damaged leg, so that an automatic and involuntary muscle contraction is generated in a matter of millisemas of second after the damage, so the foot is removed from the damage area.
Explanation:
The withdrawal mechanism is a reflex that the human acquires before pain, that is why it is the muscular contraction is automatic and fast once the pain occurs.
So as a summary: 1 - the proprioceptors of the damaged tissue are activated 2- the signal of tissue damage rises as afferent to the CNS 3- the CNS responds by activating a signal that will be sent by interneuronal connections to the alpha motor neuron 4- the signal arrives as potential of action to the alpha motor neuron that innervates the muscles of the surrounding area to which it is damaged 5 - the muscles contract, generating the withdrawal of the limb.
Research suggests that mitochondria and chloroplasts are modern-day descendants of ancient prokaryotes that were engulfed by ancestral eukaryotes. DNA is present in both of these organelles, which represents the only location for DNA in a eukaryotic cell outside of the nucleus. Briefly explain how this DNA evidence strongly supports this theory of endosymbiosis.
Answer:
Explanation:
Mitochondria and Chloroplast contain some Ribosomes which are different from the cytoplasmic ribosomes,These were measured to be 80s,while the Mitochondria and Chloroplasts are 70s.
Furthermore smaller circular DNA were found in theses two organelles,(which are the first DNA outside nucleus).These DNA types are the exact forms found in bacteria.
Thus, it was concluded that if these organelles could contained these genetic materials,they must be bacterial.Therefore chloroplast and mitochondria were ancient bacterial which now live in a mutual exclusive relationships in the larger cells of Eukaryotas(plant and animals).This is the basis of Endosymbiont theory.
That is these organelles live inside(Endo) new host in symbiosis or beneficial association with one another (symbiont).
Which statement is best supported by the data in the graph? A graph entitled Number of people living with H I V, number of people newly infected with H I V and number of AIDS deaths worldwide from 1990 to 2008 in millions is shown. Year is on the horizontal axis and number of people is on the vertical axis. The number of people living with H I V steadily increases over the years. The number of people newly infected increased from 1990 to 1996 and then began to decrease. The number of deaths due to AIDS increased from 1990 to 2002, and then began to level off and decrease. Since 2000, there has been an increase in the number of people living with HIV, but a decrease in the number of people newly infected with HIV. Since 1990, both the number of new HIV infections and the number of deaths due to AIDS has consistently increased. The life span of a person living with HIV has become shorter. Twice as many people were living with HIV in 2008 than in 2000.
Answer: A. Since 2000, there has been an increase in the number of people living with HIV, but a decrease in the number of people newly infected with HIV.
Explanation:
The statement "Since 2000, there has been an increase in the number of people living with HIV, but a decrease in the number of people newly infected with HIV" best supported by the data in the graph. Hence, option A is correct.
What is HIV?The virus known as HIV (human immunodeficiency virus) targets the immune system of the body. HIV can cause AIDS (acquired immunodeficiency syndrome) if it is not treated. Right now, there is no efficient treatment.
Nevertheless, since 1996, there have been fewer new infections. For this reason, we can assume that if we look at the year 2000, we will observe that there was a rise in the number of HIV-positive persons but a decline in the number of HIV-positive people.
Therefore, since 2000, there has been an increase in the number of people living with HIV, but a decrease in the number of people newly infected with HIV.
Learn more about HIV, here:
https://brainly.com/question/29767704
#SPJ7
The given question is incomplete, so the most probable image of the question is attached below.
The Coriolis effect contributes to ________.
a. an increase in eutrophication
b. increased acidic deposition
c. a reduction in eutrophication
d. global warming
e. global wind patterns
Transcribe and translate the following strand.
CGTACGGGCAGGATCGGCGAACTGGA
Transcription: 1
(The answer for transcription must be in all caps; example: AAAAAAA)
Translation:
(The answer for translation must be in the following format: first letter capitalized and each amino
acid separated by a hyphen; example: Met-Met-Met-Met)
Second Base of mRNA Codon
С
A
G
UUU Phe
UUC Phe
UUA Leu
UUG Leu
UCU Ser
UCC Ser
UCA Ser
UCG Ser
UAU Tyr UGU Cys
UAC Тут UGC Cys
С
UAA STOPUGA STOPA
UAG STOP UGG Trp
CUU LCI
CUC Leu
CỦA LcU
CƯ Leu
CCU Pro
CCC Pro
CCA Pro
CCG Pro
CAU His
CAC His
CAA Gln
CAG Gln
CGU Ang
CGC Arg
CGA Arg
CGG Arg
First Base of mRNA Codon
Third Base of mRNA Codon
AUU Te
AUC le
AUA Ile
AUG Met
ACU Thr
ACC Thr
ACA Thr
ACG Thr
AAU Asn
AAC Asn
AAA Lys
AAG Lys
AGU Ser
AGC Ser
AGA Arg
AGG Arg
G
GUU Val
GUC Val
GUA Val
GUG Val
GCU Ala
GCC Ala
GCA Ala
GCG Ala
GAU Asp
GAC Asp
GAA Glu
GAG Glu
GGU Gly
GGC Gly
GGA Gly
GGG Gly
Pon-90A
Answer:
AAC Asn
AAA Lys
AAG Lys
AGU Ser
AGC Ser
AGA Arg
AGG Arg
G
GUU Val
GUC Val
GUA Val
GUG Val
GCU Ala
G