Answer:
True
Explanation:
we don't need only natural resources to produce energy but artificial resources too.
Hope it helps.
Natural resources are required for all energy producing technology. So, the given statement is False.
What is Energy production?The area of endeavours centred on obtaining energy supplies from natural resources is known as energy development. These activities include the creation of energy from fossil, nuclear, and renewable sources as well as the recovery and redistribution of energy that might have been lost.
The creation of energy requires a source. We cannot produce something without using natural resources, whether they are renewable or not. This is true whether the sources are renewable or not. For instance, radioactive minerals are required to operate nuclear energy.
Similar to how water, air, renewable power, coal, fossil fuels, natural gas, or any other source we choose are all already existing in nature, natural resources are needed for every energy-producing technology regardless of the industry we choose.
So, the given statement is False.
Learn more about Energy, here:
https://brainly.com/question/30672627
#SPJ7
A person who has Diabetes has difficulty controlling the glucose levels in their blood and must take Insulin to regulate it. Which characteristic of life do they need assistance with?
Based on the given information I believe this will help:
Insulin is a hormone made by the pancreas that allows your body to use sugar (glucose) from carbohydrates in the food that you eat for energy or to store glucose for future use. Insulin helps keeps your blood sugar level from getting too high (hyperglycemia) or too low (hypoglycemia).
If you have more sugar in your body than it needs, insulin helps store the sugar in your liver and releases it when your blood sugar level is low or if you need more sugar, such as in between meals or during physical activity.
If your body does not produce enough insulin or your cells are resistant to the effects of insulin, you may develop hyperglycemia (high blood sugar), which can cause long-term complications if the blood sugar levels stay elevated for long periods of time.
Treatment:
People with type diabetes cannot make insulin because the beta cells in their pancreas are damaged or destroyed. Therefore, these people will need insulin injections to allow their body to process glucose and avoid complications from hyperglycemia.
Which joint performs adduction, abduction, horizontal adduction and abduction, medial and lateral rotation, and circumduction?
Answer:
The ball and socket joint is the one that can perform all those movements.
Explanation:
Ball and socket joint, also know as spheroid joint are types of joints where the part of the bone that articulates with the other bone has a spheroidal shape or ball shape that fits in the depression of the other bone, which means that they are a synovial enarthrosis joint. It has a wide range of movements because it can move in the transverse, vertical, and sagittal axes. An example of this joint is the shoulder, between the scapula and the humerus.
Answer: Sholder and hip
Explanation:
Yellow dung flies (Scathophaga stercoraria) are diploid organisms with 12 chromosomes in their diploid cells. Without taking into account recombination, how many different genetic gametes can this fly generate based on the arrangement of its chromosomes in the metaphase plate during meiosis
In the given case, the sum of the number of gametes possible in the fruit fly is 2¹² or 4096.
Determination of the number of genetic gametes:
At metaphase I, the arrangement of chromosomes takes place at the equatorial plate and at the equator, the orientation of homologous pairs takes place randomly. This orientation helps in finding the genes found within a gamete as each of the gametes will get only one chromatid of a chromosome.
Now by independent assortment, the variation occurs within the gametes, which suggests that the alleles of distinct genes separate independently from one another at the time of cell differentiation. Due to independent assortment, the number of different kinds of gametes possible within the chromosomes can be determined by using the formula, 2ⁿ, where n is the number of chromosomes present within a set.
Thus, based on the given information, the number of chromosomes present in a fruit fly is 12. Thus, the sum of the number of gametes possible in the mentioned fruit fly is 2¹² or 4096.
Find out more information about determination of gametes here:
https://brainly.com/question/6760841
Environmental engineers minimize the impact of land development on the environment.
Please select the best answer from the choices provided
t or f
The correct answer is True
Explanation:
The focus of environmental engineering is to create technologies and solutions to prevent environmental pollution and destruction, and in this way protect human societies, as well as, natural ecosystems. This includes solutions to reduce the impact of land development that involves altering natural ecosystems to build houses and other human constructions. In this area, environmental engineers make the use of land for humans efficient and create models that are more friendly to the environment. Thus, the statement is true.
Answer:
T R U EExplanation:
just took the test on and got it right
How long does it take you on average to take a dump?
Answer:
15 min
Explanation:
Answer:
5-20 minutes
Explanation:
On a good day with not much poop and it's easy to come out it will take around 5 minutes. On a bad day though with lots of poop and where it's very hard to come out to the point where you have to constipate yourself, it will take around 20 minutes.
A certain strain of E. coli is constitutive for the enzymes for lactose metabolism. On an F' plasmid you have the choice of adding one (but only one) element of the lac system to make the bacteria a merodiploid for that element. Assume the original E. coli has wild-type structural loci. If your goal is to determine whether the lac operon is constitutive because of a mutant regulator OR because of a mutant operator, which one wild-type element of the lac operon would you add using sexduction?
a. operator region
b. regulator (repressor)
c. gene promoter region
d. structural genes
Answer:
The correct option is B: regulator (repressor)
Explanation:
A regulator gene would be required to control the expression by either increasing or decreasing the transcription of that particular gene. In doing so, the amount of protein product made by the gene can be regulated. In the wild-type case, the gene lacl is responsible for generating the mRNA which translates to a Lac repressor protein that binds at the operator region.
For 2 minutes write down every sound you hear. Write in dot points.
What was the quietest noise? What was the loudest noise? Did you have any distractions?
an example could be:
quietest noise - a clock
loudest noise - family members talking
distractions - a TV show
Match the following respiratory conditions to the
1. Emphysema
a. A condition in which an attack can trigger constri
2. Pneumonia
b. The inflammation of bronchioles in the lungs
3. Bronchitis
c. The buildup of fluid in the alveoli of the lungs
4. Asthma
d. A condition often caused by smoking, featuring d
Answer:
D
C
B
A
Alveoli
larynx
mucus
nitrogen
diaphragm
Air enters the body through the mouth or nose and passes through the pharynx and larynx. Then it travels down the trachea and branches through the bronchi into the two lungs. In the lungs, small alveoli are the site of gas exchange where carbon dioxide diffuses into the lungs for exhalation, while oxygen from the air diffuses into the capillaries surrounding the alveoli to be pumped throughout the body.
Explanation:
Emphysema is caused by smoking. Pneumonia is buildup of fluid in the alveoli of the lungs, bronchitis is inflammation of bronchioles in the lungs, and asthma is condition in which an attack can trigger constrict air passage. The correct match is 1-d, 2-c, 3-b, and 4-a.
What is respiration?The process by which cells shatter down sugar and obtain energy by using oxygen.
There are several conditions that can affect the respiratory conditions. Some can be listed as:
Smoking causes emphysema. Pneumonia is the accumulation of fluid in the alveoli of the lungs.Bronchitis is the inflammation of the bronchioles in the lungs.Asthma is a condition in which an attack can cause constrictions in the airways.Thus, the correct match is 1-d, 2-c, 3-b, and 4-a.
For more details regarding respiration, visit:
https://brainly.com/question/12605249
#SPJ5
In chickens, a condition referred to as "creeper" exists whereby the bird has very short legs and wings, and appears to be creeping when it walks. If creepers are bred to normal chickens, one-half of the offspring are normal and one-half are creepers. Creepers never breed true. If bred together, they yield two-thirds creepers and one-third normal. Propose an explanation for the inheritance of this condition.
Answer Explanation:
Due to technical difficulties, the answer and explanation for this problem are available in the attached file.
You ran an experiment in lab that produced the following gel-electrophoresis results. The smallest band recorded was 2.03 kb and the largest band recorded was 17.15 kb.Which well contained a 17.15kb fragment but not a 2.03kb fragment?
A. 1
B. 2
C. 3
D. 4
Answer: C
Explanation:
Gel-electrophoresis separate macromolecules according to their size and charge. In the exposed example, the well that contains a 17.15kb fragment but not a 2.03kb fragment is number 2 (Option B) (based on the attached image).
---------------------------------
Gel-electrophoresis is a technique widely used in labs to separate macromolecules, like DNA, RNA, and proteins.
This technique is based on the size and charge of the molecules. It expresses a pattern of differentiation according to the length of the fragments.
Once placed in the gel, molecules start their migration. Smaller molecules will travel faster and farther than the bigger ones.
So whenever we see a gel-electrophoresis result, we know that the largest fragments are placed in the first position, while the smallest ones are in the last position.
In the exposed example, we know that the smallest fragment is 2.03kb, while the largest one is 17.15kb.
We assume that largest fragment will be placed in the first position, and the smallest one will be placed in the last position.
First position⇒ Biggest fragment ⇒17.15kb⇒ They hardly migrateLast position⇒Smallest fragment ⇒2.03kb⇒Migrate faster and fartherWe need to find a well that has fragments of 17.15 kb but not fragments of 2.03 kb.
So let us find the well in which there are molecules in the first position but not in the last one.
Note: In the attached files, you will find a gel-electrophoresis result image on which I base my answer. If this image is different from yours, choose the correct well in your gel-electrophoresis following the same reasoning.
The correct well is Two (Option B). Molecules have migrated to the first position but not to the last one.
-------------------------------------
Related link: https://brainly.com/question/2960312?referrer=searchResults
Drag each tile to the correct box. Lucia is walking barefoot in her yard. She accidentally steps on a nail. How will her nervous system work to generate a reaction? Arrange the events chronologically.
Answer:
First the proprioceptors found in the tissues will capture tissue damage and the presence of a continuity solution in the skin, then these receptors will activate the afferent pathway, which is the pathway of pain, which is sensory.
This stimulus that ascends to the central nervous system activates the "flight" mechanism in the face of pain (it is also known as the withdrawal mechanism).
It is in this way that a stimulation is sent to the alpha motor neuron in the form of an action potential as an efferent pathway to the skeletal muscles of the foot and the damaged leg, so that an automatic and involuntary muscle contraction is generated in a matter of millisemas of second after the damage, so the foot is removed from the damage area.
Explanation:
The withdrawal mechanism is a reflex that the human acquires before pain, that is why it is the muscular contraction is automatic and fast once the pain occurs.
So as a summary: 1 - the proprioceptors of the damaged tissue are activated 2- the signal of tissue damage rises as afferent to the CNS 3- the CNS responds by activating a signal that will be sent by interneuronal connections to the alpha motor neuron 4- the signal arrives as potential of action to the alpha motor neuron that innervates the muscles of the surrounding area to which it is damaged 5 - the muscles contract, generating the withdrawal of the limb.
Is your prediction supported by the membrane potential chart?
Answer:
The membrane potential of a resting neuron is primarily determined by the movement of K+start text, K, end text, start superscript, plus, end superscript ions across the membrane. ... Zero voltage across the membrane, as measured by a voltmeter with one electrode inside and one electrode outside the cell.
Answer:
Yes, it is. The chart shows that the initial charge of the neuron is negative. When the neuron is stimulated, sodium ions enter the cell. So, the voltage inside the cell changes to positive. When potassium ions move outward, the voltage decreases until it reaches its previous state.
Explanation:
explain test for reducing sugar
Answer:
A food sample is dissolved in boiling water.
Explanation:
A small amount of Benedict's reagent is added and the solution begins to cool. In the next 10 minutes, the solution changes colour. if it turns blue, there is no glucose present in it.
As it is heated, it turns yellow. The hotter the colour of the reagent, the higher the concentration of reducing sugar. E.T.C.
There is more,e.t.c.
Hope this few helps.
Research suggests that mitochondria and chloroplasts are modern-day descendants of ancient prokaryotes that were engulfed by ancestral eukaryotes. DNA is present in both of these organelles, which represents the only location for DNA in a eukaryotic cell outside of the nucleus. Briefly explain how this DNA evidence strongly supports this theory of endosymbiosis.
Answer:
Explanation:
Mitochondria and Chloroplast contain some Ribosomes which are different from the cytoplasmic ribosomes,These were measured to be 80s,while the Mitochondria and Chloroplasts are 70s.
Furthermore smaller circular DNA were found in theses two organelles,(which are the first DNA outside nucleus).These DNA types are the exact forms found in bacteria.
Thus, it was concluded that if these organelles could contained these genetic materials,they must be bacterial.Therefore chloroplast and mitochondria were ancient bacterial which now live in a mutual exclusive relationships in the larger cells of Eukaryotas(plant and animals).This is the basis of Endosymbiont theory.
That is these organelles live inside(Endo) new host in symbiosis or beneficial association with one another (symbiont).
In jimsonweed, purple flower (P) is dominant to white (p), and spiny pods (S) are dominant to smooth (s).
A true-breeding plant with white flowers and spiny pods is crossed to a true-breeding plant with purple flowers and smooth pods. Determine the phenotype of:__________.
a) the F1 generation;
b) the F2 generation;
c) the progeny of a cross of the F1 plants back to the white, spiny parent; and
d) the progeny of a cross of the F1 back to the purple, smooth parent.
Answer:
See attached image for detailed punnet squares and diagrams
a) F1 generation: Purple flower and spiny pods (PpSs) offsprings
b) F2 generation: Puple flower, spiny pods (9), Purple flower, smooth pods (3), White flower, spiny pods (3), white flower, smooth pods (1).
c) The progenies are: PpSS (4), PpSs (4), ppSS (4), and ppSs (4)
d) The progenies are: PPSs (4), PPss (4), PpSs (4), Ppss (4)
Explanation:
This question involves two distinct genes in jimsonweed; one coding for flower colour and the other for pod texture. The alleles for purple colour (P) and spiny pods (S) are dominant over the alleles of white flower (p) and smooth pods (s) in the two genes respectively.
A true-breeding plant with white flowers and spiny pods will have genotype: ppSS while a true-breeding plant with purple flowers and smooth pods will have genotype: PPss. In a cross between these two parents, the following combinations of gametes will be produced:
ppSS- pS, pS, pS and pS
PPss- Ps, Ps, Ps, PS
a) Hence, the F1 offsprings from this cross will possess a heterozygous genotype: PpSs, which is phenotypically purple-flowered and spiny-pod.
b) if the F1 offsprings are self-crossed i.e. PpSs × PpSs, gametes PS, Ps, pS, ps will be produced by each parent. These gametes will be used in a punnet square (see attached image) to produce the following F2 offsprings in proportion:
Purple flower, spinny pods (9)
Purple flower, smooth pods (3)
White flower, spiny pods (3)
White flower, smooth pods (1)
c) if the F1 offsprings are crossed back with the white, spiny parent i.e. PpSs × ppSS. The following progeny of offsprings will be produced: (see attached image)
PpSS (4),
PpSs (4),
ppSS (4), and
ppSs (4)
d) if the F1 offsprings are crossed back with the purple, smooth parent i.e. PpSs × PPss, the following progeny will be produced:
PPSs (4),
PPss (4),
PpSs (4), and
Ppss (4)
The true breeding plant.
As per the question, the jimson weed is a purple flower with capital P and is dominant to white (p) and a spiny pods of (S) which are dominant to smooth (s). The Punnett square method is used for the method. The true breeding have seperate types of genetic make ups.
Answer is F1 generation (PpSs), F2 generation has 9 purple flowers.
True-breeder plant with the white flowers and spiny pods s crossed to a true-breeding plant with the F1 gene will be a flower and spiny pods (Pp Ss) offspring. For the F2 gene Purple flower, spiny pods (9), Purple flower, smooth pods (3), White flower, and spiny pods (3), the white flower, and a smooth pods (1).The progenies are of PpSS (4), PpSs (4), pp SS (4), and ppSs. The progenies follow PPSs (4), the PP ss (4), PpSs (4), Ppss.Learn more about the purple flower.
brainly.com/question/14774402.
The following models show one large cell (A) and four small cells (B).
O
O
olo
O
00
ОО,
O
A
B.
Which of the following states why one of the models is better for moving
more nutrients in and out of the cell?
O A. A is better because it has more surface area.
The question is incomplete and the diagram is also not given. So the diagram is attached below and the complete question is as follows:
The following models show one large cell (A) and four small cells (B).
Which of the following states why one of the models is better for moving more nutrients in and out of the cell?
A. B is better because it has more surface area.
B. A is better because it has less surface area.
C. A is better because it has more volume.
D. B is better because it has more volume
Answer:
A. B is better because it has more surface area.
Explanation:
The movement of nutrients in a cell depends on the surface to volume ratio. More is the surface to volume ratio, better will be the movement of nutrients in and out of the cell.
In the given model, small cells (B) has more surface to volume ratio as surface area of B is larger, so, the model B is better for moving more nutrients in and out of the cell.
Hence, the correct option is "A".
Answer:
B has smaller cells but more surface area than A
Explanation:
B
g The pH of the space between the inner and outer mitochondrial membrane is ______________ the pH of the mitochondrial matrix.
Answer:
lower than
Explanation:
The protons obtained from the spit of hydrogen atoms, to protons and electrons, (which was transported to the Matrix of the mitochondria by NADH and FADH2 ) are pumped by PMF into the intramembrane space.
The constant pumps by the PMF,due to the electron transport chains set up high concentration of Hydrogen ions in the intramembrane space.If pH is -log[H+] then the high the number of H+/protons,the stronger the acidity,and lower the pH of the medium.
This set up higher electrochemical gradient compare to the matrix.Thus H+ diffuses down the gradients into the matrix.
This generate energy needed for the synthesis of ATPs by ATPase synthase in the matrix
Transcribe and translate the following strand.
CGTACGGGCAGGATCGGCGAACTGGA
Transcription: 1
(The answer for transcription must be in all caps; example: AAAAAAA)
Translation:
(The answer for translation must be in the following format: first letter capitalized and each amino
acid separated by a hyphen; example: Met-Met-Met-Met)
Second Base of mRNA Codon
С
A
G
UUU Phe
UUC Phe
UUA Leu
UUG Leu
UCU Ser
UCC Ser
UCA Ser
UCG Ser
UAU Tyr UGU Cys
UAC Тут UGC Cys
С
UAA STOPUGA STOPA
UAG STOP UGG Trp
CUU LCI
CUC Leu
CỦA LcU
CƯ Leu
CCU Pro
CCC Pro
CCA Pro
CCG Pro
CAU His
CAC His
CAA Gln
CAG Gln
CGU Ang
CGC Arg
CGA Arg
CGG Arg
First Base of mRNA Codon
Third Base of mRNA Codon
AUU Te
AUC le
AUA Ile
AUG Met
ACU Thr
ACC Thr
ACA Thr
ACG Thr
AAU Asn
AAC Asn
AAA Lys
AAG Lys
AGU Ser
AGC Ser
AGA Arg
AGG Arg
G
GUU Val
GUC Val
GUA Val
GUG Val
GCU Ala
GCC Ala
GCA Ala
GCG Ala
GAU Asp
GAC Asp
GAA Glu
GAG Glu
GGU Gly
GGC Gly
GGA Gly
GGG Gly
Pon-90A
Answer:
AAC Asn
AAA Lys
AAG Lys
AGU Ser
AGC Ser
AGA Arg
AGG Arg
G
GUU Val
GUC Val
GUA Val
GUG Val
GCU Ala
G
Describe the flow of energy from a glucose molecule to ATP during respiration, and compare this to the flow of energy from glucose to acids and alcohols during fermentation. Specifically, what carries the energy from glucose to ATP - what energy conversions must occur during the process. Compare the ATP production during respiration with ATP production during fermentation.
Answer:
Glycolysis is the first step of the cellular respiration in an organism which is metabolic pathway that is completed in the cytosol of the cell that leads to the converting glucose to the pyruvate in order to produce energy in form of ATP:
1. Glucose-6-phosphate is ---> fructose-6-phosphate
2. fructose-6-phosphate ---> fructose-1,6-biphosphate
3. fructose-1,6-biphosphate ---> glyceraldehyde-3-phosphate(GAP) and dihydroxyacetone phosphate (DHAP).
4. GAP is oxidised ----> 3-bisphosphoglycerate + NADH
5. 3-bisphosphoglycerate ----> 1,3-bisphophoglycerat
6. 1,3-bisphophoglycerate ----> 3-phosphoglycerate
7. 3-phosphoglycerate ----> 2-phosphoglycerate
8. 2-phosphoglycerate ----> phosphoenolpyruvate (PEP)
9. phosphoenolpyruvate to ADP ----> pyruvic acid + ATP
Formation of ATP occurs in both pathways or process that are respiration and fermentation. Fermentation is a catabolic pathway leads to the degradation of sugars (partial) that result in the gain of energy and this energy are absorbed in ATP. There are difference of the amount of energy or ATP produce in these process in respiration 38 ATP are produced whereas during fermentation only 2 ATP are produced.
How can protists exhibit both animal-like and plant-like characteristics?
A heterotrophic and chlorophyll protist
Food is ingested by protists in three forms. We produce, eat and digest their own organic molecules. Meat ingestion or english bacteria ingests protists. The cell wall and cell membrane are stretched to create an alimentary vacuolum around the foodstuff. Enzymes extract the food inside the food vacuole. At the other side, absorbent protists consume food molecules through their cell membrane by diffusion. In decomposition, absorbent protists play a crucial role. They are assumed to be essential decomponents. Light energy is used to make your own food by big farmers including photosynthetic protists.
----------------------
Hope this helps!
Brainliest would be great!
----------------------
With all care,
07x12!
Which could best be used to explain why bacteria can infect a person very quickly? outer capsule binary fission protective covering genetic recombination
Answer:
The answer is binary fission.
Explanation:
Binary fission is the process of reproduction by bacteria in which they divide into two cells.
They do this about every 20-30 minutes, this fast rate of reproduction could be best be used to explain why bacteria can infect a person very quickly.
Answer:
B. Binary Fission
Explanation:
Um. BeCaUsE
Which of the following techniques involves hybridizing a cDNA sample to a chip containing thousands of single-stranded DNA sequences, allowing one to study the expression of thousands of genes simultaneously?
A) PCR
B) Southern blot
C) FISH
D) Agarose gel electrophoresis
E) DNA microarray
Answer: Option E.
DNA micro array.
Explanation:
DNA microarray is a technique that involves hybridizing cDNA into a chip that contains thousands of single stranded DNA sequences. This technique enables one to study expression of thousands of genes at the same time.looks for extra (duplicated) or missing (deleted) chromosomal segments, sometimes called copy number variants (CNVs).
DNA microarrays are microscope slides which are printed with thousands of tiny spots in specific different positions, and each of the spots contain a known DNA sequence or gene.
primary use of DNA microarrays is transcriptional profiling.
The basic principle behind the DNA microarray is “ nucleic acid hybridization.
Complete the following vocabulary exercise related to DNA replication.Match the words in the left-hand column with the appropriate blank in the sentences in the right-hand column.
1. During DNA replication, an open section of DNA, in which a DNA polymerase can replicate DNA, is called a_______ .
2. After replication is complete, the new DNAs, called_______ , are identical to each other.
3. The enzyme that can replicate DNA is called_______ .
4. _________are the short sections of DNA that are synthesized on the lagging strand of the replicating DNA.
5. The new DNA strand that grows continuously in the 5' to 3' direction is called the________.
leading strand
okazaki fragments
replication fork
DNA polymerase
daughter DNA
Answer:
1. During DNA replication, an open section of DNA, in which a DNA polymerase can replicate DNA, is called a replication fork.
2. After replication is complete, the new DNAs, called daughter DNA , are identical to each other.
3. The enzyme that can replicate DNA is called DNA polymerase.
4. Okazaki fragments are the short sections of DNA that are synthesized on the lagging strand of the replicating DNA.
5. The new DNA strand that grows continuously in the 5' to 3' direction is called the leading strand.
Explanation:
Hope it helps.
DNA replication is the process by which a cell makes an exact copy of its DNA.
It is a fundamental process in all living organisms that allows for the accurate transmission of genetic information from one generation to the next. During DNA replication, the double-stranded DNA molecule unwinds and separates into two individual strands.
Each of the original strands serves as a template for the synthesis of new DNA occurs. This replication process follows a semi-conservative mechanism.
The correct options are:
Replication forkDaughter DNADNA polymeraseOkazaki fragmentsLeading strandLearn more about DNA replication, here:
https://brainly.com/question/30111562
#SPJ6
is lactase exergonic
Answer:
The correct answer is - yes lactase action is exergonic.
Explanation:
Lactase is an enzyme located in the small intestine of mammals including humans, however it is produced by many organisms in their body. Lactase is an essential enzyme as it helps in the digestion of the whole milk by breaking down the lactose, sugar present in milk.
Exergonic reactions are the reaction that releases energy by the breaking of molecules in any reaction. Generally, catabolic reactions are exergonic lie lactase catabolizes the lactose present in milk and release energy.
Thus, the correct answer is - yes lactase action is exergonic.
Which sphere does the frog belong to? atmosphere biosphere geosphere hydrosphere
Answer:
biosphere
Explanation:
The frog belongs to the biosphere -the vicinity of the planet wherein organisms live, inclusive of the floor and the air. An example of the biosphere is in which existence happens on, above, and beneath the floor of Earth.
Define the term biosphere in short?The biosphere is made of the components of Earth wherein life exists—all ecosystems. The biosphere extends from the private root structures of bushes to the darkish environments of ocean trenches, to lush rain forests, high mountaintops, and transition zones like this one, in which ocean and terrestrial ecosystems meet.
What is the role of the biosphere?The biosphere presents important environmental situations for survival. living organisms are required to adapt to the environment of the biosphere. The biosphere is home to biodiversity within ecosystems while imparting a reliable source of meals on the earth.
Learn more about the biosphere here: https://brainly.com/question/25750450
#SPJ2
In the process of cellular respiration, glucose is broken down into simpler compounds. Respiration is carried on in the presence (aerobic) or absence (anaerobic) of free oxygen.
a. True
b. False
Answer:
a. True
Explanation:
Cellular Respiration is the process by which cells of all living organisms obtain the required energy for their metabolic activities. Respiration is a catabolic process whereby glucose is broken down to release Its high energy and used to synthesize a usable form of energy by the cell (ATP).
Cellular respiration occurs in living cells with oxygen (aerobic) or without oxygen (anaerobic). In aerobic respiration, three processes viz: Glycolysis, Kreb's cycle and Oxidative phosphorylation are involved. Oxygen is the final electron acceptor in the Electron transport chain of the Oxidative phosphorylation.
On the other hand, anaerobic respiration is employed by certain bacteria in the absence of oxygen. In anaerobic respiration, another final electron acceptor is used other than oxygen.
Both processes yield Adenosine triphosphate (ATP).
The Coriolis effect contributes to ________.
a. an increase in eutrophication
b. increased acidic deposition
c. a reduction in eutrophication
d. global warming
e. global wind patterns
The cardiac tissue has fewer T tubules and store less calcium than skeletal muscle. What is the outcome of these two traits
Answer:
The slow arrival of contraction or the slow onset of contraction.
Explanation:
The T tubules function in the transformation of the action potential from the sarcolemma to the sarcopasm reticulum.
In the skeletal muscles, it is located at the junction of the A and I bands but in the cardiac muscles, it is located only at the z discs thus giving rise to to T tubules.
The cardiac muscles also do not possess as much calcium as the skeletal muscles thus, its calcium ion must come from outside producing the slow arrival of contraction or the slow onset of contraction.
The cardiac tissue has fewer T tubules and stores less calcium than skeletal muscle, thereby the onset for muscle contraction is SLOWER in the heart than in skeletal muscle.
The sarcolemma is the plasma (excitable) membrane of muscle cells, which are surrounded by endomysial connective tissue.The T-tubules are invaginations of the sarcolemma that enter into the muscle cell in order to form interconnected networks.These tubules (T tubules) store intracellular calcium ions under the supervision of membrane depolarization through a voltage sensor channel (i.e., DHPR).In conclusion, the cardiac tissue has fewer T tubules and stores less calcium than skeletal muscle, thereby the onset for muscle contraction is SLOWER in the heart than in skeletal muscle.
Learn more in:
https://brainly.com/question/6763078
The process of DNA replication is described. Identify the enzyme that participates in each part of the replication process. DNA partially unwinds as the hydrogen bonds between complementary bases are broken. This process is catalyzed by the enzyme
Answer:
Helicase
Explanation:
DNA replication is the process in which DNA makes copies of itself.
The process of DNA replication is supported by several enzymes.
The initial step of DNA replication is unwinding of double stranded DNA which is catalyzed by helicase enzyme. Helicase enzymes breaks the hydrogen bond between the DNA strands and prepare them for replication process.
Hence, the correct asnwer is "Helicase".
A sequence of DNA ( 3' CCTCCGATGA 5' ) is used as a TEMPLATE strand for dideoxy sequencing. The products are made and the products are run in 4 different lanes (labelled "A", "G", "C", and "T") of an electrophoretic gel. Which lane will contain the product that ran furthest down the gel
Answer:
The reaction with adenine dideoxynucleotides will run furthest in the gel
Explanation:
In dideoxy sequencing (also known as Sanger sequencing), the DNA template is used to run four different reactions in which only one class of dideoxynucleotide (ddNTP) is added. These four different ddNTPs (i.e., ddATP, ddCTP, ddTTP or ddGTP) act as terminators during DNA synthesis. Moreover, the additional factors required for DNA synthesis including standard deoxynucleotides (dNTPs), DNA polymerase and site-specific primers are added in equal volumes to prepare these four different reactions. Thus, during electrophoresis, the sizes of the DNA bands will depend on the specific ddNTP used in each reaction. In this case, the reaction containing ddATP (capable of terminating DNA synthesis at the 5' end) will run furthest in the gel.