For a certain chemical reaction, the bond energy of the reactants is 43 kJ, and
35 kJ of energy is released. For energy to be conserved, what is the bond
energy of the products?
A. 18 kJ
B. 78 kJ
C. 8 kJ
D. 88 kJ

Answers

Answer 1

Answer:

the answer is C. 8KJ

Explanation:


Related Questions

The totality of a cell's DNA is referred to as its

Answers

Answer:

genome

Explanation:

The totality of a cells DNA is genome

The energy from the sun is produced in the core through the process of nuclear fusion. The photons travel through the sun and are released as radiation which travels to the earth. How long does it take to reach the earth?

Answers

Answer:

8 min 20 seconds

Explanation:

Radiation from the sun travels as light through the vacuum of space. Therefore, it is travelling at the speed of light which is roughly 300,000 km/s. If we divide this speed by the average distance between the Sun and the Earth (150,000,000 km) we would get a total of 500 seconds. We can now turn this total time into minutes which would be roughly 8 min and 20 seconds. Therefore, it would take a total of 8 min 20 seconds for radiation from the Sun to reach Earth.

what scale would you use to measure an earthquake's damage

Answers

Answer:

he Richter scale measures the largest wiggle (amplitude) on the recording, but other magnitude scales measure different parts of the earthquake. The USGS currently reports earthquake magnitudes using the Moment Magnitude scale, though many other magnitudes are calculated for research and comparison purposes.

Explanation:

Answer:

This is a picture of how they are mesured

Explanation:

Help me with thissssss

Answers

Answer:

cevap sirayla

Explanation:

a prodüct

b substraite

c enzyme

d enzyme s c

e producte

Energy that is transferred in waves or particles. Energy from the source.
A. Radiation
B. conduction
C. convection

Answers

Answer:

A.Radiation is the answer

Aerobic respiration creates more of what molecule than fermentation?

Question 4 options:

Ethanol

Lactic Acid

Glucose

ATP

Answers

Answer:

Atp

Explanation:

This is the correct answer

Answer:

goal in 1 year from now

Explanation:

graduate from now collage

Wind travels from areas of HIGH pressure to LOW pressure.

A. True

B. False

Answers

Answer:

The answer is A) True

Hope this helps

Brainliest is always appreciated

Explanation:

What is a single stranded molecule used
to move genetic information from the
nucleus to the cytoplasm?
A. mRNA
B. DNA
C. NNA

Answers

Answer: A)

Explanation: it's job is transportation of genetic info.

hope it helps :)

A pelican is hunting for fish as it flies above the surface of the water. Why must the pelican alm for the fish in a slightly different place in the water than where the fish appears to be
located?

Answers

Answer:

I'm not sure but maybe because if the pelican goes exactly where the fish is the fish will naturally move forward to escape so instead of catching the fish the pelican would get a mouth full of water. If the pelican aims for a spot a little different then where the fish actually is the pelican can might catch it because the fish went to its direction. (sorry if that's not correct)

Select the correct answer.
What is true about the current extinction rate?
A.
It’s slower than the earlier mass extinction rate.
B.
It’s primarily attributed to human intervention.
C.
It’s attributed to natural environmental changes.
D.
It’s necessary for evolution.
E.
It’s affecting few species.

Answers

Answer:

its b

Explanation:

Extinction is primarily attributed to human intervention. So, the correct option is B.

What is Extinction?

The extinction is defined as the end of a particular type of organism or a set of types, typically a species. Although the ability to reproduce and bounce back may have been lost earlier, the death of the last member of the species is usually considered as the moment of extinction.

Extinction is the term used to describe the extinction of an entire species. In that it has allowed for the emergence of new species and the ascent of others, extinction has both advantages and disadvantages. Since most species have been driven to extinction by human activity, humans have had a significant impact on the pace of extinction. The main cause is thought to be human activity.

Therefore, the correct option is B.

Learn more about Extinction, here:

brainly.com/question/1048615

#SPJ7

Marta is running. Sam is sitting in a chair.
Suggest two things that Marta will need more of than Sam.
nicotine
oxygen
glucose
energy
carbon dioxide

Answers

Answer:

oxygen

glucose

Explanation:

When ice freezes, the water around it becomes saltier and colder. _______, it's density increases.

A Therefore
B On the other hand
С In contrast
D Especially

Answers

Answer A seems like the best choice for this question. Just think about some of the synonyms for therefore—”hence,” “consequently,” and “thus.” Because the adverb therefore often plays the role of a conjunction, it's sometimes called a conjunctive adverb.

B isn’t the correct answer to this question because you use “On the other hand” to introduce two contrasting points, facts, or ways of looking at something.

C isn’t the correct answer because we are not comparing or contrasting anything in this sentence.

D isn’t the correct answer because “Especially” is used in a formal sentence example: She can't be sure she will win, especially at this early stage of the campaign.

When ice freezes, the water around it becomes more saline and colder. Therefore, its density increases. Hence, the correct option is (A).

What is Density?

Density is defined as the mass per unit volume of a substance and is denoted by ρ, although the Latin letter D may also be used.

Density is defined as mass divided by volume: [tex]{\displaystyle \rho ={\frac {m}{V}}}[/tex]

where ρ is density, m is mass, and V is volume. It has the units of mass divided by volume such as grams per centimeters cube [tex](g/cm^3)[/tex] or kilograms per liter (kg/l).

When water changes from a liquid to a solid state that is liquid in the form of ice, its density will increase as it becomes saltier and colder.

Thus, when ice freezes, the water around it becomes more saline and colder. Therefore, its density increases. Hence, the correct option is (A).

Learn more about Density, here:

https://brainly.com/question/29775886

#SPJ2

What is homeostasis?

Answers

Answer:

Homeostasis is the state of steady internal, physical, and chemical conditions maintained by living systems

Explanation:

(A property of cells, tissues, and organisms that allows the maintenance and regulation of the stability and constancy needed to function properly)

Hereditary information is found in a cell's
A.
chloroplasts
B.
chromosomes
C.
cytoplasm
D.
membranes

Answers

they are found in the chromosomes

I need to know about hypothesis

Answers

It is the longest side of a right triangle :)

Answer:

A hypothesis a prediction or a educational guess (or in other words, a theory) that might happen in a experiment weather it's right or wrong. It's important to make hypothesis to learn from your mistakes and analyze why you got it wrong and why it make you think that (wrong hypo). A hypothesis can also help you learn more about the subject.

Hopefully, it helps!

At the end of meiosis stage 2, you had 4 ______ gametes. Fill in the blank.​

Answers

Answer: it’s Haploid

What are three main functions of stems?

Answers

1. Support for and the elevation of leaves, flowers and fruits. 2. Transport of fluids between the roots and the shoots in the xylem and phloem. 3. Storage of nutrients. Hope this helps!!

plzzzzzzz help.........

Answers

Answer:

The top right is Protist

The top left is Eubacteria

Explanation:

Researched off reliable websites gimme a brainliest?

(brainliest to the right answer)

What is the function of the DNA template?

It is the noncoding strand used to synthesize a complementary mRNA molecule.

It is the noncoding strand used to synthesize a parallel sequence of nucleotides.

It is the coding strand used to synthesize an identical mRNA molecule.

It is the coding strand used to synthesize the transcription unit.

Answers

I think the third answer is correct
Sorry if wrong

Answer: A. It is the noncoding strand used to synthesize a complementary mRNA molecule.

Explanation:

Just took the test.

HELP Help please

How can one system be considered a compound of another system?

Answers

Answer:

A

Algebra For what values of the variables must ABCD be a parallelogram?

B

23. A 2y + 2 B 24. B

(3x + 10)

(8x + 5)º

3x + 6

54°

D

С

D

A

Зу - 9 с

ly+4

You cross a true breeding snapdragon with red flowers to a true breeding
snapdragon with white flowers. All of the resulting offspring are pink.
What are the expected phenotypes of the F2 generation?

Answers

i get an Ender dragon

Using a path of your choice, list steps required for nitrogen to perform one complete cycle beginning and ending in the atmosphere:

Answers

The nitrogen cycle involves three major steps nitrogen fixation and nitrification and denitrification it is a cycle within the biosphere which involves the atmosphere hydrosphere and lithosphere

Place the following events in chronological order:

1. Event 1
Internal combustion engine invented in 1876
2. Event 2
Electric light bulb invented in 1879
3. Event 3
Dynamite invented in 1869
4. Event 4
First gasoline powered tractor invented in 1892
5. Event 5
First transcontinental railroad completed in 1869

Answers

Event 5, Event 3, Event 1, Event 2, Event 4 I think!

Answer:

event 1 = dynamite

event 2 = tranckntinal railroad

event 3 = combustion engine

event 4 = light bulb

event 5 = gas powered tracto

Explanation:

Which of the following best defines the cell level of organization?

Answers

Cells —-> Tissues
Tissues ——> Organs
Organs ——> organ systems
Organ systems ——> organism
Organisms ——> populations
Populations ——> community
Communities——-> ecosystem
Ecosystems ——-> biomes
Biomes ——-> biosphere (aka Earth!)

which one is correct?

Answers

Answer: B

Explanation: I'm 95% sure that this is the answer its been awhile since i seen that question

Photosynthesis is the conversion of __________ into _________

Question 9 options:

energy, chlorophyll


visible light, carbohydrate


ATP, energy


carbohydrate, energy

Answers

C because they produce to make energy

How long does it take a bone to become a fossil?

Answers

Answer:

Fossils are defined as the remains or traces of organisms that died more than 10,000 years ago, therefore, by definition the minimum time it takes to make a fossil is 10,000 years.

Explanation:

Why is the idea of common descent only a conclusion?
It's based on directly observable data.
It's not observable, but is determined based on a large amount of
related evidence.
It's a recent idea without much evidence supporting it.

Answers

Answer: It's not observable, but is determined based on a large amount of

related evidence.

Explanation:

"Crossing Over" occurs in Prophase 1 of Meiosis.

True
False

Answers

Answer:

true

Explanation:

Answer:

Crossing over occurs during prophase I of meiosis before tetrads are aligned along the equator in metaphase I. By meiosis II, only sister chromatids remain and homologous chromosomes have been moved to separate cells. Recall that the point of crossing over is to increase genetic diversity.

Explanation:

Choose the correct description on the realtionship between allels and genes.

Answers

Answer:

B

Explanation:

Sorry if it's wrong in the end, but it should be right

Other Questions
Find the value of x. Plsssssss Help!!!!Look at the map. How might the Gupta empire have been able to flourish through trade? Identify geographic features to support your answer. transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC Hey can somebody get this for me been stuck for five min Select the correct answer from the drop-down menu.What is implied by the underlined section in the passage?Caesar's statement to Brutus implies that imagine being in spanish course on edmentum its pretty hard not gonna kap features of liberalism theory A square has side lengths as shown in the picture and a perimeter of 54.8 centimeters. Write an equation to find the measure of each side length. On January 1, Year 1, a contractor began work on a $3.2 million construction contract that is expected to be completed in 3 years. The contractor concludes that it is appropriate to recognize revenue over time using the input method based on costs incurred (cost-to-cost method). At the inception date, the estimated cost of construction was $2.4 million. The following data relate to the actual and expected construction costs: Year 1 Year 2 Year 3 Costs incurred $720,000 $1,170,000 $1,110,000 Expected future costs $1,680,000 $810,000 $0 For this long-term construction contract, the contractor needs to calculate the estimated dollar values of the revenue and gross profit (loss) to be recognized each year. Complete the contractor's long-term construction contract using the information above. Write the appropriate amounts in the associated cells. Indicate losses by using a leading minus (-) sign. Round all amounts to the nearest dollar. If no entry is necessary, enter a zero (0). Revenue Gross profit (loss) Year 1Year 2 Need help with english class Your teacher has given you two mineral samples. He has told you thatthey have the same crystal structure and hardness.Which other observation would suggest that they are MOST LIKELY thesame mineral?They have the same color.They have the same shape.They have the same size.They have the same mass. 6. To what modern day American event might the medieval tournaments be compared? Une correctamente la pregunta con la respuesta.1. Con quin hablabas? 2. Qu haca tu hermano? 3. Que hacan tus padres? 4. Con quin hablabais? Hablaba con mi hermano. Hablbamos con el estudiante nuevo.Jugaba el ftbol.Caminaban por la playa. A factory uses a special kind of lubricant to maintain its two milling machines. Weekly lubricant usage for each machine is an independent random variable (zero correlation). The first machine has a mean usage of 50.6 gallons and standard deviation of 12 gallons. The second machine has a mean usage of 64.4 gallons and standard deviation of 16 gallons.Suppose that at the beginning of the week, the factory has a total of 135 gallons of lubricant in stock. The factory will not receive any replenishment of lubricant from its supplier until the end of the week. Assume that the total lubricant usage (of the two machines combined) follows a normal distribution. What is the probability that the factory will run out of lubricant before the next replenishment arrives? What is the highest common factor of 72 and 90 The following stem-and-lead plot shows the One record attendance for original Charity Drive meetings what is the mode of these values?A.)48B.) 84C.) 70D.) 66 If you going to answer one question say it in the comments it's gonna be the waste of time bc the answer is going to be deleted 76% of 250 is what number? An illustration of a cell interacting with its environment is provided.Call membraneThe illustration best represents which of the following?Water moving into a cell by the process of osmosis2 .Passive transport of solute into the cell by diffusionActive transport of solute into the cell using energyWater leaving the cell by the process of osmosis A container of water and an equal-sized container of oil are heated at the same rate. After several minutes, the temperature of the oil has risen 20 degrees C, but the temperature of the water has only increases by 8 degrees C. What explains this?Question 6 options:Heat moves from the water to the oil.It takes more energy to increase the temperature of water than to increase the temperature of oilThe water contains more atoms, so it has more thermal energyMore heat was added to the oil than to the water.