A cyclist is riding a bicycle whose wheels have a diameter of 2.1 feet. Suppose the wheels turn at a rate of 260 revolutions per minute. (a) Find the angular speed of the wheels in radians per minute. (b) Find the speed of the cyclist in feet per minute. Do not round any intermediate computations, and round your answer to the nearest whole number.

Answers

Answer 1

Answer:

a.1633rad/min

b.1715feet/min

Step-by-step explanation:

We are given that

Diameter of wheel, d=2.1 feet

Radius of wheel, r=[tex]\frac{d}{2}=\frac{2.1}{2}[/tex]feet

Rate=260 rev/min

a. We have to find the angular speed of the wheel in rad/min

1 rev=[tex]2\pi[/tex]radian

Where [tex]\pi=3.14[/tex]

Using the value

Angular speed=[tex]260\times 2\times 3.14/min[/tex]

Angular speed,[tex]\omega=1633rad/min[/tex]

(b)

Speed=[tex]r\omega[/tex]

Using the formula

Speed of  the cyclist=[tex]\frac{2.1}{2}\times 1633[/tex]feet/min

Speed of  the cyclist=1714.65[tex]\approx 1715[/tex]feet/min


Related Questions

What is the maximum integer value that
satisfies the inequality 5x - 11 < 43?

Answers

Answer:

If you're asking for x it's 10

Step-by-step explanation:

5x - 11 < 43

5x < 54

The maximum value of x is 10 (because 5x10<54)

50 PTS! PLEASE HELP me OUT!

Answers

Answer:

my thing is being weird so i cant really help. lo siento

i am bord

Step-by-step explanation:

Glen swims to 2/3 mile on Monday, 3/4 mile on Wednesday, and 5/6 mile on Friday. What is the total distance Glenn swims on those three days? Show your work​

Answers

Answer:

In total, Glen ran 2 and 1/4 miles.

232. Сколько решений имеет уравнение | х + 3 | -один?

Answers

Answer: уравнение имеет 2 решения:

              x₁ = - 4;    x₂ = - 2.

Step-by-step explanation:

Ix + 3I = 1

1) x + 3 = 1

  x + 3 - 3 = 1 - 3

  x = -2

2) - (x + 3) = 1

   x + 3 = - 1

   x + 3 - 3 = - 1 - 3

   x = - 4

Question 7

Two sides of a triangle are given as 2 and 5. Which answer below could be the
third side?

3
10
7
5

Answers

You can use the Law Of Sins:

a / sin A

b / sin B

c / sin C

(hope this helps, really sorry if i doesnt :/ )

Answer: 10

Step-by-step explanation:

i need help with this .

Answers

Answer: electricity can be used to create magnetism

Step-by-step explanation:

Use your knowledge of Greek and Latin roots to find the word which best replaces the underlined word.

The new student seemed to be rather amiable.
a.
smart
c.
likeable
b.
mean
d.
dishonest


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer: C

Amiable means kind, friendly so that seems to fit the category

Answer:

ITS C

Step-by-step explanation:

\250 doctors from three countries in Europe meeting in a conference to decide whether to approve a new vaccine for the flu. Among these are 115 Germans, 65 French, and 70 Englishmen. We also know that, 75% of the Germans, 60% of the French and 65% of the Englishmen are in favor of using the new vaccine. (a) What is the probability that a randomly chosen doctor is in favor of the vaccine

Answers

Answer:

0.683 = 68.3% probability that a randomly chosen doctor is in favor of the vaccine

Step-by-step explanation:

(a) What is the probability that a randomly chosen doctor is in favor of the vaccine

75% of 115/250 = 0.46(German).

60% of 65/250 = 0.26(French).

65% of 70/250 = 0.28(Englishmen). So

[tex]p = 0.75*0.46 + 0.6*0.26 + 0.65*0.28 = 0.683[/tex]

0.683 = 68.3% probability that a randomly chosen doctor is in favor of the vaccine

To find the Volume of a Cylinder, we use the formula:
V=trah
To find the Volume of a Cone, we use the formula:
V = žar?h
To find the Volume of a Sphere, we use the formula:
V = ur

Answers

Answer:

the correct anser is B

Step-by-step explanation:

Calculate the area of the shape on all the corners

Can you help me solve this on plzz

Answers

Answer:

don't know what to help you with you are smart enough to know

3 < x/2 + 1=? I need help !



Answers

Djjdrjkrkrkkrkkrkrkrkkrkkrkkrkrkrkkkr

i need help finding the area of the shape.

Answers

Answer:

37.68 units²

Step-by-step explanation:

(3/4)(3.14)r²

(3/4)(3.14)(4²)

37.68

Add 3 to the product 10 and 4

Answers

Answer:

The product of" , means multiply , the product of 10 and 4 is 40 , plus 3, 43?

The solution of the expression is,

⇒ 43

What is an expression?

Mathematical expression is defined as the collection of the numbers variables and functions by using operations like addition, subtraction, multiplication, and division.

We have to given that;

The expression is,

⇒ Add 3 to the product 10 and 4

Now, We can simplify as;

⇒ 3 + (10 × 4)

⇒ 3 + 40

⇒ 43

Thus, The solution of the expression is,

⇒ 43

Learn more about the mathematical expression visit:

brainly.com/question/1859113

#SPJ2

Zoo admission costs $6 for children and $9 for adults. On Monday, 2200 people visit the zoo and the zoo collects $14,850 in admissions.

a. Write a system of linear equations that represents this situation. Let x represent the cost of a ticket for a child and let y represent the cost of a ticket for an adult.

System of equations:

Answers

Answer:

There are 1650 child visitors and 550 adult visitors

Step-by-step explanation:

Use this step by step that was already used before to answer this, it's a png file.

A system of linear equations that represents this situation is,

⇒ x + y = 2200

⇒ 6x + 9y = 14,850

Where, x represent the cost of a ticket for a child and let y represent the cost of a ticket for an adult.

What is linear expression?

A linear expression is an algebraic statement where each term is either a constant or a variable raised to the first power.

Given that;

Zoo admission costs $6 for children and $9 for adults.

And, On Monday, 2200 people visit the zoo and the zoo collects $14,850 in admissions.

Let x represent the cost of a ticket for a child and let y represent the cost of a ticket for an adult.

Hence, We can formulate;

A system of linear equations that represents this situation is,

On Monday, 2200 people visit the zoo.

So, we get;

⇒ x + y = 2200 .. (i)

And, Zoo admission costs $6 for children and $9 for adults and the zoo collects $14,850 in admissions.

So, We get;

⇒ 6x + 9y = 14,850 .. (ii)

Learn more about the linear expression visit:

https://brainly.com/question/4074386

#SPJ2

If 2 /10 = 1/5, how many fifths must be added together to make 6/10 ­?

Answers

Answer:

3, fifths should be added.

2/10 = 1/5

4/10 = 2/5

6/10 = 3/5

Divide the tenth fractions by two, to get the anwser on the right.

Answer:

3......

Step-by-step explanation:

6 divided by 2 is 3

EASY!!!

write the equation of the line

Answers

Answer:

y= -2/3x+7

Step-by-step explanation:

65 % of 60 is what number?

Answers

Answer:

39

Step-by-step explanation:

Answer:

39

Step-by-step explanation:

because i used a percentage calculator

Consider the equation 4x=8.
Which value could be substituted x to make the equation TRUE?

Answers

x=2 (4 x 2 = 8) so 2 is the answer

Answer:

2

Step-by-step explanation:

4 times 2 is 8

What is the multiplier for a decrease of 42%

Answers

Answer:

x0.58

Step-by-step explanation:

1-0.42=0.58

:)

Which inverse operations could you use to solve the equation m/5 - 8 = -6? Select two answers.
A Add 8 to each side and then divide each side by 5
B. Add 8 to each side and then multiply each side by 5
C. Multiply each side by 5 and then add 40 to each side
D. Subtract 8 from each side and then multiply each side by 5
E Multiply each side by 5 and then add 8 to each side

Answers

Answer:

B and C seem to be the correct answers!

Hope this helps!

Find the sales tax. Then find the total cost of the item. Sales Tax  Selling Price   Rate of Sales Tax   Sales Tax  ​$60.00 3​% ​?​

Answers

Answer:

$61.80

Step-by-step explanation:

60 increase 3% =

60 × (1 + 3%) = 60 × (1 + 0.03) = 61.8

Answer:

Sales tax:1.80 total cost:61.80

Step-by-step explanation:

Price x sales tax rate = sales tax

60 x .03=1.80

price + sales tax = total cost

60 + 1.80=61.80

Study the data set shown. Then answer the questions below.

Answers

a. Any number that is not the minimum or maximum could be removed without changing the range.

b. Removing the number 97 changes the range.

What is set ?

In mathematics, a set is a collection of distinct objects, called elements or members, that are treated as a single entity. Sets can contain any type of object, such as numbers, letters, or other mathematical objects.

To find a number that could be removed from the data set without changing the range, we need to determine the minimum and maximum values in the set. In this case, the minimum value is 53 and the maximum value is 97, so any number that is not the minimum or maximum could be removed without changing the range. For example, we could remove the number 85:

53 54 63 63

68 68 68 74

82 85 92 88

89 92 92 97

The range of the data set is still 97 - 53 = 44.

To find a number that could be removed from the data set that would change the range, we need to identify a number that is either the minimum or maximum value. For example, we could remove the number 97:

53 54 63 63

68 68 68 74

82 85 85 88

89 92 92

b. The range of the data set is now 92 - 53 = 39, which is smaller than the original range of 44.

Therefore, removing the number 97 changes the range.

To know more about set visit :

https://brainly.com/question/13458417

#SPJ1

First person to reply gets brainliest

Answers

Answer:

I'm not first, but thanks for the points! Have a nice day! :D

Step-by-step explanation:

9A. What equation represents the proportional relationship depicted in the graph
m=money earned and L=lawns mowed.
A. m = 25L
B. L=15m
C. m=25 + L

Answers

C. Is the answer



Djdbbdbdbdvbfbfb

Help again lol I’ll give you brainliest

Answers

Answer:

8

Step-by-step explanation

All you have to do is how many times it goes up. it goes up 8 times so 8 is your answer

Answer:

21

Step-by-step explanation:

you put all those numbers in in order from least to greatest then you get the smaller number and the biggest number -then you subtract them and you have your answer lollll

46 - 25 = 21

The dot plots below show the results.
Students




Teachers



Which compares the medians of the data?
The median for the students is 4 and the median for the teachers is 8.
The median for the students is 2 and the median for the teachers is 3.
The median for the students is 4 and the median for the teachers is 3.
The median for the students is 2 and the median for the teachers is 8.

Answers

Answer: The median for the students is 2 and the median for the teachers is 3.

Step-by-step explanation:

Ordering the data for the students from the dot points:

0, 0, 1, 1, 1, 1, 2, 2, 2, 2, 2, 2, 2, 3, 3, 3, 3, 3, 4, 4.

n = 20 which is positive so median position is average of:

= (n / 2)                                     and                                = (n + 1) / 2

= 20 / 2                                                                           = 21 / 2

= 10                                                                                 = 10.5

2 is in position 10                                                         2 is in position 10.5

Average = (2 + 2) / 2 = 2

Student median is 2.

Teachers

0, 1, 1, 1, 2, 2, 3, 3, 3, 3, 3, 4, 4, 4, 4, 5, 5, 5, 6, 8

3 is in position 10 as well as in position 10.5.

= (3 + 3) / 2

= 3

Teacher median is 3.

(In attachment, teacher plot is first and then the student follows)

Answer:

Students Median= 2

Teacher Median=3

Step-by-step explanation:

8y - 2(y + 4)
Simplify

Answers

Answer:

= 6y − 8

Step-by-step explanation:

At Marco's school, 5/8 of the students are in the band. What percent of the students are in the band?

Answers

62.5%

5/8 = 0.625 then multiply by 100% to get in terms of percent of 62.5%

I need help quick I can’t fail I need a good grade pls help

Answers

B I think I am unsure

Answer:

ok I will try and tell you


What does a discriminant value of -8
tell you about the solution of a
quadratic equation?

Answers

Answer:

Yayaya

Step-by-step explanation:

Answer:

[tex]\boxed {\boxed {\sf No \ real \ roots/ solutions }}[/tex]

Step-by-step explanation:

The value of the discriminant (b²-4ac) can tell us 3 things:

Positive value: 2 real roots Equal to 0: 1 real root Negative value: No real roots, but imaginary roots can exist.

The quadratic equation given has a discriminant of -8. This value is negative, so we know that the quadratic has no real solutions.

Other Questions
Write and solve an equation to determine the value of x in the figure. a. 3x 84; 252 b. 3x 84; 28 c. 3x 84; 84 d. 3x 84; 81 Find the value of x. Plsssssss Help!!!!Look at the map. How might the Gupta empire have been able to flourish through trade? Identify geographic features to support your answer. transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC Hey can somebody get this for me been stuck for five min Select the correct answer from the drop-down menu.What is implied by the underlined section in the passage?Caesar's statement to Brutus implies that imagine being in spanish course on edmentum its pretty hard not gonna kap features of liberalism theory A square has side lengths as shown in the picture and a perimeter of 54.8 centimeters. Write an equation to find the measure of each side length. On January 1, Year 1, a contractor began work on a $3.2 million construction contract that is expected to be completed in 3 years. The contractor concludes that it is appropriate to recognize revenue over time using the input method based on costs incurred (cost-to-cost method). At the inception date, the estimated cost of construction was $2.4 million. The following data relate to the actual and expected construction costs: Year 1 Year 2 Year 3 Costs incurred $720,000 $1,170,000 $1,110,000 Expected future costs $1,680,000 $810,000 $0 For this long-term construction contract, the contractor needs to calculate the estimated dollar values of the revenue and gross profit (loss) to be recognized each year. Complete the contractor's long-term construction contract using the information above. Write the appropriate amounts in the associated cells. Indicate losses by using a leading minus (-) sign. Round all amounts to the nearest dollar. If no entry is necessary, enter a zero (0). Revenue Gross profit (loss) Year 1Year 2 Need help with english class Your teacher has given you two mineral samples. He has told you thatthey have the same crystal structure and hardness.Which other observation would suggest that they are MOST LIKELY thesame mineral?They have the same color.They have the same shape.They have the same size.They have the same mass. 6. To what modern day American event might the medieval tournaments be compared? Une correctamente la pregunta con la respuesta.1. Con quin hablabas? 2. Qu haca tu hermano? 3. Que hacan tus padres? 4. Con quin hablabais? Hablaba con mi hermano. Hablbamos con el estudiante nuevo.Jugaba el ftbol.Caminaban por la playa. A factory uses a special kind of lubricant to maintain its two milling machines. Weekly lubricant usage for each machine is an independent random variable (zero correlation). The first machine has a mean usage of 50.6 gallons and standard deviation of 12 gallons. The second machine has a mean usage of 64.4 gallons and standard deviation of 16 gallons.Suppose that at the beginning of the week, the factory has a total of 135 gallons of lubricant in stock. The factory will not receive any replenishment of lubricant from its supplier until the end of the week. Assume that the total lubricant usage (of the two machines combined) follows a normal distribution. What is the probability that the factory will run out of lubricant before the next replenishment arrives? What is the highest common factor of 72 and 90 The following stem-and-lead plot shows the One record attendance for original Charity Drive meetings what is the mode of these values?A.)48B.) 84C.) 70D.) 66 If you going to answer one question say it in the comments it's gonna be the waste of time bc the answer is going to be deleted 76% of 250 is what number? An illustration of a cell interacting with its environment is provided.Call membraneThe illustration best represents which of the following?Water moving into a cell by the process of osmosis2 .Passive transport of solute into the cell by diffusionActive transport of solute into the cell using energyWater leaving the cell by the process of osmosis