Your digital camera has a 512 megabyte memory card. You take pictures at two resolutions, a low resolution requiring 4 megabytes of memory per photo and a high resolution requiring 8 megabytes of memory per photo. Write an equation to model the amount of each kind of photo you can take.

Answers

Answer 1

One possible answer is 8H + 4L = 512

=======================================================

Explanation:

H = number of high resolution photosL = number of low resolution photos

H and L are placeholders for positive whole numbers, or 0 could replace either variable.

1 high resolution photo takes up 8 mb of space, so H of them take up 8H megabytes of space.

1 low resolution photo takes up 4 mb of space, so L of them take up 4L megabytes.

Overall, the two types of photos take up 8H+4L megabytes, which is equal to 512 since that's the max capacity. That leads to the equation 8H+4L = 512

----------------------------------

Extra info:

There are other ways to express the equation 8H+4L = 512. We could divide each part by 4 to get 2H+L = 128, but I think this equation loses its descriptive quality in a way. We no longer can see that each high resolution photo takes up 8 megabytes (instead we might mistakenly think only 2 megabytes are used per high resolution photo). A similar mistake may happen with the low resolution photos also.

The equation 2H+L = 128 can be rearranged into L = -2H+128 when solving for L.


Related Questions

between x=2 and x=3, which function has a greater average rate of change than f(x)=2^x has?

Answers

Answer: f(3)

Step-by-step explanation:

First find the formula for the rate of change by taking the derivative of 2^x. Let f(x) equal some hypothetical y-value, then take the natural log of both sides.

[tex]y=2^x\\\ln(y)=x \ln(2)[/tex]

Implicitly differentiate the left side and take the derivative of the right side

[tex]\frac{y'}{y} =\ln(2)[/tex]

Multiply both sides by 'y' which was defined as 2^x

[tex]y'=\ln(2)*2^x[/tex]

Plug in x = 2 and x = 3 to see which slope is larger

[tex]y'=\ln(2)*2^2=4\ln(2)\\y'=\ln(2)*2^3=8\ln(2)[/tex]

50 points! I only want mhanifa to help me so no one else answer unless you actually know how to do it

Answers

Answer:

Bbc

Step-by-step explanation:

40 + [(5x 3) + (5 - 2)]​

Answers

Answer:

58

Step-by-step explanation:

PEMDAS

Pls help me I’ll make brainliest

Answers

Answer:

60 cents for 1 pound

Step-by-step explanation:

2 pounds = $1.20

1 pound =  60 cents

Suppose you buy 2 marbles for $0.16 each. You pay for it with 4 quarters. How much change should you get back? Enter your answer.

Answers

Answer: You should get 0.68 back

Step-by-step explanation: I just did a test and got 100%

Answer:

3 $0.16 = $0.48

or

4 $0.25 = $1.00 hope this helps

Step-by-step explanation:

The average cost for vacation is $1050 if a family borrows money for the vacation at an interest rate of 11.9% for six months what is the total cost of the vacation including the interest on the loan

Answers

The answer to this question is 1764

Please help ASAP really need this

Answers

Answer:

[tex]21.79 + c \leq 25[/tex]

Joshua can spend up to 3.21 on a card.

Step-by-step explanation:

[tex]21.79 + c \leq 25[/tex] is the correct equation because Joshua is spending 21.79 on flowers, a certain amount on the card, and the maximum he can spend is 25. That is why you use the less than or equal to sign.

To solve, first subtract 21.79 from both sides to get: [tex]c \leq 3.21[/tex]. This means that Joshua can spend up to 3.21 on a card.

Hope it helps!

Evaluate x to the second power divided by y when x =4 and y=8.
???

Answers

Answer:

x^2 / y = 4^2 /8 = 16/8 = 2. the answer is 2.

please help on this one.

Answers

Answer:

it's A

Step-by-step explanation:

look at the bolded line, it's after 4.4 which would mean z> 4.4

Answer:

A

Step-by-step explanation:

so we have a less than sign, which immediately tells us this going to be going left as 4.4 is greater. and obviously since the number is 4.4, the graph will have targeted that number. Hope this helps!

Solve.
5(a – 1) – 15 = 3(a + 2) + 4
Enter your answer in the box.
X
a = 15

Answers

Solve :

5 (a - 1) - 15 = 3 (a + 2) + 4

Solution :

[tex] \sf \dashrightarrow \: 5 (a - 1) - 15 = 3 (a + 2) + 4 [/tex]

[tex]\sf \dashrightarrow \: 5 \times a - 5 \times 1 - 15 = 3 \times a + 3 \times 2 + 4 [/tex]

[tex]\sf \dashrightarrow \: 5 a - 5 - 15 = 3 a + 6 + 4 [/tex]

[tex]\sf\dashrightarrow \: 5 a - 20 = 3 a + 10 [/tex]

[tex]\sf\dashrightarrow \: 5 a - 20 - 3a - 10 = 0 [/tex]

[tex]\sf\dashrightarrow \: 2 a - 30 = 0 [/tex]

[tex]\sf\dashrightarrow \: 2 a = 30[/tex]

[tex]\sf\dashrightarrow \: a = \cancel\dfrac{30}{2} [/tex]

[tex]\sf\dashrightarrow \: a = 15[/tex]

[tex] \Large \underline{\boxed{\tt{a = 15 }}}[/tex]

Hence, value of a = 15.

A group of students were surveyed to find out if they like playing video games on a console/PC or on a phone/tablet. The results of the survey are shown below:

80 students like playing video games on a console/PC
20 students like playing video games on a console/PC but do not like playing on a phone/tablet
90 students like playing video games on a phone/tablet
40 students do not like playing video games on a console/PC

Make a two-way table to represent the data and use the table to answer the following questions.

Part A: What percentage of the total students surveyed like both playing video games on a console/PC and on a phone/tablet? Show your work and/or explain your thinking. (5 points)

Part B: What is the probability that a student who does not like playing video games on a console/PC also does not like playing on a phone/tablet? Explain your answer. (5 points)

Answers

Hey! Here is my answer for part A! I dont know part B, but i have Part A!

------------------------------------------------------------------------------------------------------∪ω∪

74% (Rounded)

I made a total of all the students, i added all of them and got 230 students in total. Then I took students who liked playing PC and Phone/Tablet, and added them which got me 170 (90 + 80). I used a calculator to find out what is the percentage for 170/230. Therefore, I rounded my conclusion to 74%.

can yoy please help solve yhis problem.2/5b+1=11​

Answers

Answer:

(2/5)*b+1 = -11 // + 11

(2/5)*b+1+11 = 0

2/5*b+12 = 0 // - 12

2/5*b = -12 // : 2/5

b = -12/2/5

b = -30

b = -30

Step-by-step explanation:

hope this helped :)

Step-by-step explanation: First: Multiply 2/5 by 2. 5x2=10. 10 then turns into o a whole number +1=11.

10+1=11

Suppose that a homeowner notices a 20 percent increase in the water bill for July. The homeowner traces this increase to four sources: a running toilet, a dripping faucet, a guest who visited for two days, and a broken sprinkler head. Further study shows that the broken toilet accounts for 8 percent of the increase, the faucet 2 percent, and the visiting guest 4 percent. The homeowner concludes that the remaining 8 percent is attributable to the broken sprinkler head. What method did the homeowner use in drawing this conclusion

Answers

Answer:46

Step-by-step explanation:

Homeowner should use in drawing the conclusion is method of residues.

What is method of residues?

A complex series of occurrences is removed from all known causes. The reason is supposed to be what is left over.

If a set of factors is thought to create a set of phenomena, and all but one of them matches all the phenomena, the remaining phenomenon can be attributed to the remaining factor.

A method of agreement is a way of comparing different examples of the same phenomenon under different conditions.

The method of concurrent variation states that if a specific effect occurs in a variety of settings,

Thus, homeowner should use in drawing the conclusion is method of residues.

Learn more about the method of residues here:

https://brainly.com/question/19131352

#SPJ2

Simplify the expression. -9(-7x-6)-(-6x-10)
*

Answers

i think the answer might be 69x + 64.

my work:

-9 (-7x - 6)-(-6x-10)

63x + 54 - (-6x-10)

63x + 54 + 6x + 10

= 69x + 64.

but i'm not 100% confident with this answer. maybe that's just because i hate math.

In a student council election, Kyle receives 54 votes for president. If Kyle receives 60% of the votes, how many students vote in the election?

Answers

Answer:

90

Step-by-step explanation:

60%-> 54

100%-> 90

There are 90 students vote in the election.

What is mean by Percentage?

A number or ratio that can be expressed as a fraction of 100 or a relative value indicating hundredth part of any quantity is called percentage.

To Calculate the percent of a number , divide the number by whole number and multiply by 100

Given that

In a student council election, Kyle receives 54 votes for president.

Now,

Let total student votes in election = x

Hence we can formulate

60% of x = 54  

60/100 × x = 54

60x = 5400

x = 90

Therefore,  There are 90 student votes in the election.

Learn more about the percent visit:

https://brainly.com/question/24877689

#SPJ2

pls help me on this........​

Answers

Answer: M is the coefficient

Step-by-step explanation:

Mmmmmmmmmm it’s m I’m pretty sure

PLEASE ANSWER FAST I HAVE 30MINS!!!!!! Which graph shows the result of dilating this figure by a factor of 4 about the origin? On a coordinate plane, rectangle A B C D has points (negative 1, 1), (3, 1), (3, negative 1), (negative 1, negative 1). On a coordinate plane, rectangle A prime B prime C prime D prime has points (negative 4, 4), (12, 4), (12, negative 4), (negative 4, negative 4). On a coordinate plane, rectangle A prime B prime C prime D prime has points (negative 2, 2), (6, 2), (6, negative 2), (negative 2, negative 2). On a coordinate plane, rectangle A prime B prime C prime D prime has points (negative 0.25, 0.25), (0.75, 0.25), (0.75, negative 0.25). (negative 0.25, negative 0.25). On a coordinate plane, rectangle A prime B prime C prime D prime has points (negative 0.5, 0.5), (1.5, 0.5), (1.5, negative 0.5), (negative 0.5, negative 0.5).

Answers

Answer:

2

Step-by-step explanation:

abshxhdbxbjsbxbsbxnd

please help ASAP:solve 1 2/10 x 5=

Answers

Answer: 6

Step-by-step explanation:

1 2/10 x 5=6 hope this helps

Answer:

6

Step-by-step explanation:

1 2/10 * 5

6

Two brothers have ages that are consecutive odd integers. The product of their ages is 38 less than the older brother's age squared. What are the ages of the two brothers?

Answers

answer = the elder bother is 17 and the younger one is 15

constructive odd integers= 15 and 17

17×15= 255

255+38 = 293

Square root of 293 = 17

Which of the following statements is true? A square is ALWAYS a rectangle. A rectangle is ALWAYS a square. A rectangle is NEVER a square. A square is NEVER a rectangle.

Answers

A square is always a rectangle

Answer:

A square is always a rectangle

Step-by-step explanation:

Which one goes in the box ? Pls help I’ll mark you brainly

Answers

Answer:

5 is co efficient

8x is term

9 is constant

Step-by-step explanation:

When paying for a restaurant order, a customer's total for food was $30.00. What is a 18% tip for that total?

Answers

Answer:When paying for a restaurant order, a customer's total for food was $30.00. What is a 18% tip for that total? I WILL GIVE BRAINLEIST PLEASE

Step-by-step explanation:

The answer is 5.40 and also like they said you can round if you need too

. A football team outscored its opponents 5:3. If the opponents scored 12 points, how many points did
the football team score?

Answers

The football team scored 20 points.

I divided the total points made by the opponents (12) by 3 because of the ratio and got 4. Then, I multiplied 5 by 4 to get the football teams total amount of points.

-Ɽ3₮Ɽ0 Ⱬ3Ɽ0

6/q= k/27

what is q?
what is k?​

Answers

6=q
27=k
That’s the answer right ??

Brandi is the star of her school's volleyball team. In the first game of the season she had 9 "kills". Then she had the
same number of kills in each of the next 4 games. She had 49 kills in the five games. How many did she get per game
in the the last 4 games?
write and solve an equation

Answers

Answer: 36

Step-by-step explanation:

I'm not sure if this is 100% right this question was kinda messing with my brain , but if it's like asking how much she had in the 4 games all you had to do was add 9+9+9+9 or to make it easier you can just multiply 9 times 4 but I hope this is right.  

Sophie has 5 pieces of string that are each 5 feet long. Cooper has 4 pieces of string that are each
3 feet long. Estimate how much more string Sophie has than Cooper has. Enter your answer in the bo

Answers

Answer:

Sophie has 12 feet more

Step-by-step explanation:

Help ASAP!!!! Will mark you brainliest

Answers

Answer:

OK so... I know the answer to x(4)+4x(3)+5x(2)-4x-4 =     -4

The part i don't understand is the f(x)=k=1 part.

Step-by-step explanation:

So overall the only answer I know is -4 Sry i couldn't help more.

Brainliest?

Suppose that a loan of $8000 is given at an interest rate of 13% compounded each year.
Assume that no payments are made on the loan.
Follow the instructions below. Do not do any rounding.
(a) Find the amount owed at the end of 1 year.
si
(b) Find the amount owed at the end of 2 years.

Answers

Answer:

9040

10215.20

Step-by-step explanation:

compound interest that compounds yearly works as follows

PV(1+i)^n

just plug in the numbers

8000(1.13)^1= 9040

8000(1.13)^2=10215.20

Please help! Find x if 2(x+1)=x+5

Answers

Answer:

x=3

Step-by-step explanation:

2(x+1)=x+5

Use the distributive property to multiply 2 by x+1.

2x+2=x+5

Subtract x from both sides.

2x+2−x=5

Combine 2x and −x to get x.

x+2=5

Subtract 2 from both sides.

x=5−2

Subtract 2 from 5 to get 3.

x=3

Answer:

3

Step-by-step explanation:

2(x+1)=x+5

2x+2=x+5

2x-x+2=5

x+2=5

x=5-2

x=3

Select the prime number.
30(A)
31(B)
32(C)
33(D)


Answers

Answer:

31 as it has only 2 factors which is 1 and 31

Answer:

B

Step-by-step explanation:

Other Questions
Write the equation of the line that passes through the points (-1,3) and (-6, -7).Put your answer in fully reduced point-slope form, unless it is a vertical or horizontalline. Photosynthesis uses all of the following exceptto make food.carbon dioxideO light energyO chemical energywateris its A? Sally says her stomach and liver have nothing to do with her heart and blood, and that they are completely separate. What did she say that is wrong?What would be the correct statement?What are the facts youd use to correct her? In 1985, the Gramm-Rudman-Hollings Balanced Budget and Emergency Control Act was passed in order to ensure that the federal government submitted goals to meet the deficit. If the goals are not met, then the president must order spending cuts across the entire budget based on the recommendation of the comptroller general, a position appointed by the president.The scenario above describes which of the following powers attributed to Congress?a. Congressional oversight by reviewing appropriations requests that need to meet certain spending criteriab. Congressional response to presidential budget cuts based on the comptroller general's recommendationsc. Congressional subcommittees that can review improper relationships between the comptroller and the presidentd. Congressional action to block proposed spending cuts to all federal agencies by amending the executive budget to target items from the president's agenda Which is the dominantmouth shape for emojis inthe picture below?How do you know?Smiley = MFrowny = mSchilly ScienceSMILEYFROWNY Gary wants to buy a bike that is 30% off. The original price is $109.56. What is the amount of the discount? Loss of voluntary control over urination is calledO dialysisO incontinenceO neurogenic bladderO urgencyPrevious what is one sixth of the product of four and nine table saws you can use with __ or __ but not both at the same time HELP PLS What is the value of the x variable in the solution to the following system of equations? (1 point)4x + 2y = 6x - y = 3O-15-22 Do violence and alcohol have anything to do with each other? If so, what do they have in common? If they don't have anything in common, tell me why? (SAT Prep) Find the value of x. He math team does practice drills that each last hour. In February the team did practice drills for a total of 24 hours. How many practice drills did the math team do in feburary PLEASE ANSWER FAST!!!!Explain why the U.S. decided to change its goal from protecting western settlements to attacking Native Americans and forcing them onto reservations. i just asked my best friend if she talk ab me behind my back bc i kinda have trust issues and i dont get what she means by this.... do yall have any idea? Write and solve an equation to determine the value of x in the figure. a. 3x 84; 252 b. 3x 84; 28 c. 3x 84; 84 d. 3x 84; 81 Find the value of x. Plsssssss Help!!!!Look at the map. How might the Gupta empire have been able to flourish through trade? Identify geographic features to support your answer. transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC Hey can somebody get this for me been stuck for five min