❗WILL GIVE BRAINLIIEST❗Which statement describes a characteristic of a question that can be answered through scientific inquiry?
A. It must be related to something that benefits society.
B. It can be answered by collecting votes from scientists.
C. It is constructed in such a way that possible answers can be tested.
D. It can be answered using an ethical argument.​

WILL GIVE BRAINLIIESTWhich Statement Describes A Characteristic Of A Question That Can Be Answered Through

Answers

Answer 1

Answer:

The answer is C

Explanation:

The answer is C because it can be answered using scientific methods, the scientific method is a good way to test something, and so therefore C is the answer

Hope that helped! Can I also get brainliest? I need a few more to advance, if not thank you anyways and have a nice day!!!


Related Questions

Organize these rock layer from youngest to oldest
Breccia

Conglomerate

Dolostone

Shale

Answers

Conglomerate,Shale,Dolostone

From youngest to oldest are Breccia, Conglomerate, Dolostone, and Shale, and as per geology, the principle of superposition states that in a sequence of layered rocks, the youngest layer is on top and the oldest layer is at the bottom.

What are rock layers?

Breccia is the youngest layer in the sequence. Breccia is a coarse-grained sedimentary rock made up of angular fragments of other rocks that have been cemented together. It is formed through a process called brecciation. Conglomerate is also a coarse-grained sedimentary rock, but unlike breccia, its fragments are rounded and well-worn, indicating that they have been transported over a distance by water or wind before being deposited and cemented, and dolostone is older than both breccia and conglomerate. Shale is the oldest layer in the sequence.

Hence,    From youngest to oldest are Breccia, Conglomerate, Dolostone, and Shale.

Learn more about the rock layers here.

https://brainly.com/question/19598172

#SPJ2

_____ is the process by which energy is stored in inorganic molecules is used to produce carbohydrate food molecules

Answers

Answer:

Chemosynthesis

Chemosynthesis is used to produce food using the chemical energy stored in inorganic molecules.

that is the answer

Photosynthesis is the process by which energy stored in inorganic molecules is used to produce carbohydrate food molecules.

What is photosynthesis?

Photosynthesis is the primary process by which plants, algae, and some bacteria capture and store energy from the sun.

During photosynthesis, light energy is absorbed by pigment molecules in the chloroplasts of plant cells. This energy is then used to convert carbon dioxide (CO2) and water (H2O) into glucose (C6H12O6) and oxygen (O2). The glucose produced during photosynthesis is used by the plant as a source of energy and is also stored as a carbohydrate reserve. The oxygen produced during photosynthesis is released into the atmosphere as a byproduct.

Learn more about photosynthesis, here:

https://brainly.com/question/29764662

#SPJ5

to which part of a dna molecule are nucleotides added?

Answers

Answer:

Nucleotides are exclusively added to the 3' end of the developing strand when DNA is produced in the 5'-to-3' orientation. The 5'-phosphate group of the new nucleotide attaches to the 3'-OH group of the final nucleotide of the developing strand.

At the 3' end of the deoxyribose sugar, an upcoming nucleotide is added. The existing nucleotide's 3'-OH end and the new nucleotide's 5' phosphate make a phosphodiester bond. In this way, new nucleotides are added.

 

How does DNA polymerize?

The DNA is made up of nucleotides. Each nucleotide of DNA is made up of a deoxyribose sugar, a phosphate group, and a nitrogenous base. Nitrogenous bases include adenine, guanine, cytosine, and thymine. The sugar of the DNA has a lack of oxygen at the 2' end. A glycosidic bond connects the sugar's 1' end to the nitrogen base.

The 5' end of sugar is attached to the phosphate group. The 3' end of sugar is attached to the 5' phosphate of the new upcoming nucleotide. A phosphodiester bond is formed during the addition of new nucleotides. Two phosphate groups of the new nucleotides are removed. Example: If ATP comes, then it will make AMP and attach to the DNA chain.

Hence, at the 3' -OH end of sugar of the existing nucleotides, a new one is added.

To learn more about the DNA,  refer to the following link.

https://brainly.com/question/10134612

#SPJ5

How does thermal energy impact the lower layers of atmosphere?

Answers

Answer:

Explanation:

Land and water absorb most of the solar radiation from the sun. Some of this solar energy from land and water is then transferred to the lower atmosphere which is in contact with the continents and oceans. From Land, this occurs mostly as heat energy or infrared radiation. Water usually transfers this energy through the evaporation of water into the atmosphere

I need help with this the 3 blanks where it says answer

Answers

Answer:

C will pair with G

then C will pair with G

write G and C

Explanation:

because Adanine(A) always pairs with thymine(T) and cytosine(C) with guanine(G) an easy way to remember this is by Apple Tree and Car Garage.

hope this helps :)

1. When “cleaning” a cadaver, what is removed to better see defined muscles?

Answers

When cleaning a cadaver, a professional will remove the fascia in order to better see defined muscles.

The fascia is a thin layer of connective tissue that wraps muscles. It is membraneous and extends throughout the entire body. Among the many functions of the fascia are:

Protectionisolation Compartmentalization

Of its functions, the last it's perhaps the most relevant to this question. It divided the muscles into groups. This is one of the main reasons that in order to see and properly study the muscles of a cadaver, the professional must remove the fascia.

To learn more visit:

https://brainly.com/question/262544?referrer=searchResults

Answer:

deep fascia

Explanation:

what is the most durable part of the human body?

Answers

Answer:

the most durable and tough substance in your body is actually a tissue. Encasing your teeth and helping you chew, bite, and tear your food is your tooth enamel. That's the hardest substance in the human body.

Explanation:

The most durable part of the human body is Tooth Enamel.

What is Tooth Enamel?

Tooth enamel is defined as the thin outer covering of the tooth that covers the crown of the tooth. This is the part that we can see outside the gums. This is the outer layer, the enamel is transparent. Dentin is the hard tissue that lies beneath the enamel, and is what gives teeth their color.

Once tooth enamel is damaged, it cannot be restored. Enamel can be restored to some extent by improving its mineral content. Enamel is the durable part of the human body.

While toothpaste and mouthwash can never "rebuild" teeth, they can contribute to this remineralization process.

Thus, the most durable part of the human body is Tooth Enamel.

Learn more about Tooth Enamel, here:

https://brainly.com/question/14138833

#SPJ2

plz answer correctly. thank you.

Answers

Answer:

Mitosis and cytokinesis

Explanation:

Answer:

see below

Explanation:

1) A- Interphase and mitosis

2) Interphase

in the course of normal events leading to fertilization and eventually birth, the route of the egg, embryo, and finally fetus is from the ovary into the __________.

Answers

Answer:

uterus

Explanation:

which muscle is used when giving your grandmother a kiss on the cheek?

Answers

Sternocleidomastoid

Explanation:

what are some reasons implicit stereotypes might differ from explicit stereotypes?

Answers

Answer:

Implicit stereotypes are automatically activated and operate indirectly, and thus individuals may not be aware that they possess such beliefs. In contrast, explicit stereotypes are accessible to conscious awareness and are what individuals report when asked about group differences.

Explanation:

Please rate, thank me, have a good day

Implicit stereotypes operate automatically and indirectly, so people may not realize they have them. When asked about group differences, people report explicit stereotypes.

What are stereotypes?

A stereotype is a preconceived notion or combination of traits that many people hold to be indicative of a certain kind of person or object. Stereotypes are traits that society automatically ascribes to particular groups of people in order to categorize them according to factors like age, weight, occupation, skin tone, gender, etc.

Since implicit stereotypes function subtly and automatically, people may not even be aware that they hold such beliefs. Conversely, explicit stereotypes are cognizable and are what people report when questioned about group differences.

Learn more about stereotypes, here:

https://brainly.com/question/2070574

#SPJ2


Name given to the two new cells formed at the end of cell division.

Answers

Answer:

Diploid cells

Explanation:

The daughter cells from mitosis are called diploid cells. Diploid cells have two complete sets of chromosomes.

Diploid cells is the name given

easy question - giving brainly if correct !!​

Answers

Answer:

i think its  C

Explanation:

i would go with c

What does costal cartilage connect?

Answers

Answer:

a. Ribs to the sternum

Explanation:

Answer:

Ribs to the sternum

Explanation:

Which of the following elements is not a metalloid?

Answers

Answer:

gallium

Explanation:

help

Facilitated diffusion uses -----------------to help aid some substances across the cell membrane.

Answers

Facilitated diffusion of substances crossing the cell (plasma) membrane takes place with the help of proteins such as channel proteins and carrier proteins.

Facilitated diffusion uses transport proteins to help aid some substances across the cell membrane.

Facilitated diffusion is a passive transport process that enables the movement of specific molecules across the cell membrane with the assistance of transport proteins. While simple diffusion allows small, non-polar molecules to pass directly through the lipid bilayer of the cell membrane, facilitated diffusion comes into play when larger molecules or molecules with charges need to cross.

Transport proteins act as gateways or channels in the cell membrane. They are selective and only allow specific molecules to pass through. There are two main types of transport proteins involved in facilitated diffusion: channel proteins and carrier proteins.

Channel Proteins: These proteins form pores or channels in the cell membrane, allowing certain molecules, such as ions or water, to pass through. Channel proteins are highly specific and only allow certain substances to cross.

Carrier Proteins: These proteins undergo a change in shape to "carry" molecules across the membrane. When a specific molecule binds to the carrier protein, it triggers a change in the protein's shape that transports the molecule across the membrane. Once the molecule is released on the other side, the carrier protein returns to its original shape.

Facilitated diffusion is a crucial process for maintaining the balance of ions and molecules inside and outside the cell. It's important for the transport of nutrients, ions, and other essential molecules that may be too large or polar to diffuse directly through the lipid bilayer. The involvement of transport proteins ensures that only specific substances are transported, preventing unwanted molecules from entering or leaving the cell. Overall, facilitated diffusion is a highly regulated process that contributes to the homeostasis of the cell and the overall functioning of the organism.

To learn more about Facilitated diffusion, here

https://brainly.com/question/17132249

#SPJ3

which muscle group relates best with the term midline?

Answers

The oblique is the muscle group that best relates with the term midline.

The anterolateral abdominal wall contains a muscle group in which there are flat muscles whose fibers originate in the posterolateral part, pass forward and become an aponeurosis towards the midline:

The external oblique muscle is the thickest and most superficial of the three muscles on the lateral wall of the abdomen.

It follows an inferomedial direction and the muscle-tendon limit descends in such a way that, towards the midline and also below the height of the anterior superior iliac spine, it is completely transformed into an aponeurosis.

The aponeurosis of the external oblique joins that of the internal oblique and passes in front of the rectus abdominis; its fibers intersect in the midline with those on the opposite side and contribute to the linea alba.

Therefore, we can conclude that the oblique is the muscle group that best relates with the term midline.

Learn more here: https://brainly.com/question/19486604

why do multicellular organisms have emergent properties

Answers

Answer:

They have more genes than unicellular organisms.

Explanation:

They show properties that can only result from the interaction of many cells.

I need some help summarizing the following topics
•Biology Foundations
•Cells
•Energy and Transport
• Reproduction and Cell Division
• Classical Genetics
• Molecular Genetics
• Human Body Systems
• Ecology

Answers

Answer:

guess we were in the same boat I have

Explanation:

Chris to ryx Dr and decor is nuryslam is a day at a retirement party and I have to go to khow about the election results and I we are and decor and I have a lot earlier today

what is the transfer of energy in the form of electromagnetice waves

Answers

Answer: Electromagnetic radiation.

Explanation: The transfer of energy by electromagnetic waves is called electromagnetic radiation. Electromagnetic waves can transfer energy through matter or across empty space.

Marco has experienced extreme fatigue (tiredness) lately. He eats three balanced meals each day and exercises 2-3 times per week on his Peloton bike. He gets 7-8 hours of sleep each night, but just can’t seem to stay awake during the day. Which organelle is most likely causing Marco’s problems?

Answers

Given the symptoms shown by Marcos, we can infer that the organelle that may be causing his problems is the mitochondria.

The mitochondria are one of the most famous and important organelle within a cell. Found in most eukaryotic cells, they are the organelle responsible for most of the energy production of a cell, and throughout the cells of the body, they become responsible for the energy production of the organism. This is the origin of its famous "Powerhouse of the cell" title. Mitochondria produce energy in the form of ATP.

ATP is a molecular compound necessary for most of the reactions that take place in a cell. It is so common as a requirement for any cellular activity that ATP is known as the "molecular currency". Marcos is said to be experiencing chronic fatigue, which is a symptom of mitochondrial disease. When the mitochondria of an organism's cells are not functioning as they should be, the cells do not have the energy needed to perform basic functions.

In reaction to this, the body sends signals to the brain to go to sleep, which minimizes energy consumption by slowing down the metabolic processes which require ATP and thus gives the body time to produce more energy. For these reasons, we can conclude that the fatigue and problems Marcos is experiencing are due to mitochondrial disease.

To learn more visit:

https://brainly.com/question/1563697?referrer=searchResults

A change in pH has the greatest impact on which life proces

Answers

Answer:

Aquatic Organisms

If the pH of water is too high or too low, the aquatic organisms living within it will die. pH can also affect the solubility and toxicity of chemicals and heavy metals in the water ¹². The majority of aquatic creatures prefer a pH range of 6.5-9.0, though some can live in water with pH levels outside of this range.

Explanation:

Adding more OH- ions increases the pH, making the substance more basic. Increasing the pH will increase the number of OH- ions, so the equilibrium will shift to the left. Decreasing the pH will increase the number of H3 O+ ions; they'll ''use up'' the OH- ions, thus shifting the equilibrium to the right.

when two strains of bacteria with genotypes abcd and abcd are grown together in the lab, a small number of bacteria with the genotype abcd eventually arise. how does this likely occur?

Answers

Answer:

These enzymes work in two ways. Some are pre-replicative and search the DNA for nucleotides with unusual structures

Explanation:

This happened through a lateral transfer of genes.

We can arrive at this answer because:

Lateral gene transfer is a system for exchanging genetic material between unrelated bacteria.Bacteria are beings that reproduce without the exchange of genetic material, but in some cases, this can be done with the lateral transmission of genes.This transmission can be done through the process of conjugation, translation, or transformation.

The result is that new bacteria are created with a mixture of genes from two unrelated bacteria.

More information:

https://brainly.com/question/848637?referrer=searchResults

in an otherwise normal cell, what happens if one mistake is made during dna replication?

Answers

Answer:

Most mistakes are corrected, and if they are not, they may result in a mutation, defined as a permanent change in the DNA sequence. Mutations can be of many types, such as substitution, deletion, insertion, and trinucleotide repeat expansions. Mutations in repair genes may lead to serious consequences such as cancer.

Explanation:

what is the name of the tiny air sacs in your lungs?

Answers

Answer:

alveoli

Explanation:

what are the two major anatomical subdivisions of the nervous system?

Answers

Answer: The nervous system has two main parts:

The central nervous system is made up of the brain and spinal cord.

The peripheral nervous system is made up of nerves that branch off from the spinal cord and extend to all parts of the body.

Explanation:

what hormones are responsible for inducing and regulating labor

Answers

there is one hormone that is responsible for inducing and regulating labor which is Oxytocin

tumors can coerce the formation of blood vessels to serve the cancer cells within the tissue. what is this process called?

Answers

Answer:

Such tumors, unless they secrete hormones, cause few problems. However, most tumors induce the formation of new blood vessels that invade the tumor and nourish it, a process called angiogenesis.

Explanation:

where does pyruvate oxidation occur in eukaryotic cells

Answers

Answer:

mitochondrial matrix

Explanation:

Answer:

Pyruvate is produced during glycolysis in the cytoplasm, but pyruvate oxidation occurs in the mitochondrial matrix (in eukaryotes).

please give me crown thank you

Explanation:

Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:

Answers

Answer:

y is there so much letters?

Other Questions
7. The ratio of the base to height of a triangle is 3:5. If the area of this triangle is 30, find the lengths of the base and height. a myelin sheath is composed primarily of __________. help me with this question please!! HELP PLZ IT DUE TMR what is a language sensitive environment Which of the following is an example of how electrical energy can be generated? A local school is conducting a fundraiser. The relationship between the number of raffle tickets sold, X, and the total amount of money raised in dollars, Y, is shown in this table. X Y 5 $25 15 $75 25 $125 100 ?How much money is raised when 100 tickets are sold?$175$175$225$225$400$400$500 write the equation it is parallel to the graph of y=-2x-10 and passes through (-1,2) list out any three points depicting the political condition of Medieval Nepal plz give me the ans.. as soon as possible a copyright is an intangible property right, meaning that you can touch and feel it. true or false? (PLEASE HELP FAST!!) Which of these is NOT true about the outer core?* it is mostly made up of iron and nickel. * it is mostly liquid. * it has a higher temperature than the inner core.*atoms within it form a powerful magnetic Field. Of the following, what is the most important for ATP production?A) amount of sunlightB) carbon dioxide C) concentration water concentration D) glucose concentrationE) oxygen concentration Please help me with these questions!1)what does a P wave shadow zone tell scientists about what is inside Earth? 2)what does the lack of S waves from earthquakes tell scientists about what is inside earth? May I please receive help? how do you solve n - 8 > 5 -8(5n - 2) - (n + 3) = 54 The equation(p-1)x^2 + 4x + (p-5)=0, where p is a constant,has no real roots.(a) Show that p satisfies p^2 - 6p+1>0. please answer the question in the picture tnh ch s ampe k thay ampe k bng v k c in tr rt ln th v k ch bao nhiu A game spinner has 8 sections, 3 red, 1 blue, 2 yellow, and 2 green. What is the probability of not spinning a green?