Why is the proclamation of 1763 important?

Answers

Answer 1

Answer:

The Proclamation of 1763 was issued by the British at the end of the French and Indian War to appease Native Americans by checking the encroachment of European settlers on their lands.

Explanation:


Related Questions

Think about the different forms of government that you learned about in this lesson. Identify at least one way that they are all alike and at least two ways that they are different. Write a paragraph that compares the forms of government and explains their similarities and differences.

Answers

Answer:

Historically prevalent forms of government include monarchy, aristocracy, timocracy, oligarchy, democracy, theocracy and tyranny. The main aspect of any philosophy of government is how political power is obtained, with the two main forms being electoral contest and hereditary succession.

Explanation:

Hope it helps :)

There are several forms of government and one similarity amongst all of them is that they are established to lead the people of a nation. They are however different when it comes to:

How they obtain powerInfluence of citizens

Types of governmentsDictatorships Monarchies Democracies Theocracies

Similarities in government

All governments are similar in that they were established to lead the people of their nation to allow for an effective distribution of resources.

Differences in government

The first way they differ is how they obtain power with dictatorships often obtaining power through military means and monarchies inheriting it. Democracies involve people selecting their leaders and so is different as well.

There is also a difference in the influence citizens have with democracies having the highest amount of citizen influence and dictatorships having the lowest.

In conclusion, governmental types are less similar than they are different.

Find out more about theocracies at https://brainly.com/question/3710022.

crush questions. what does it mean when I say a funny joke and everyone starts laughing but then he is like biting his lips to help him not laugh (he ended up laughing tho

Answers

Answer:

he lowkey has a crush on you bc if he bites his lip then yea

Explanation:


1 point

Item 12 is unpinned. Click to pin.

What are some techniques that farmers can use to improve soil health? Select ALL that apply


A)monoculture

B)biological pest control

C)contour plowing

D)crop rotation

Answers

Answer:

I think D is the one you can pick.

hope this works!


What is the cause of the economic problem facing all countries?

Answers

answer:

corona virus

psa:

*please do not just copy my answer it was meant to help you not just give you anything to put down!  

*if you think my answer is good or will get an A please give me brainliest or high stars.  

*please treat people with kindness, wear a mask, and have a lovely day.

what country is most influenced by Spanish culture

Answers

Answer:

Countries with a strong Spanish influence. The nature of Hispanidad (Hispanicness) is that it absorbs other influences and mixes with them, leading to “mestizaje” of the different cultures. All of these countries have other influences from various distinct cultures, foreign and indigenous alike.

Explanation:

>
Question 6
10 pts
6. Under the Articles of Confederation, the United States became a union of
A.states with a strong central government
B.states with a strong alliance
C. states with a weak central government
D.a colony of Britain
HELP PLEASEEE

Answers

Answer:

c. states with a weak central government

Explanation:

The Articles of Confederation was a failure.

pls help ill give brainlist

Answers

Answer:

C

Explanation:

i just read an article about this

The signing of the Declaration of Independence would be next

The signing was on August 2, 1776

What type of government do most Latin American countries have?

Answers

Answer:

I believe it's federal republic

Explanation:

Answer: C

Explanation: i took the test on edg

Dr. Moore and his team have learned from GPS data that two continents with an ocean between them have been moving toward each other. Some students living on the coast of one of these continents don't understand what is happening and they are worried that the continents will run into each other. How could Dr. Moore explain to them what is happening?

Answers

Answer:

Dr. Moore can explain that this is a continental drift process and that it is an extremely slow process and therefore no one should be concerned.

Explanation:

Continental drift is a geographic phenomenon that allows continents to move and "walk" towards each other. It is true that this can make the continents shock and cause a great catastrophe that would make human life rich, but there is no need to worry. This is because this movement is extremely slow and would take thousands of years for the continents to collide.

How does the declaration of sentiments mirror the declaration of independence? What is the effect?

Answers

Answer:

The Declaration of Sentiments mirrors the Declaration of Independence because it uses the same phrasing and lay out. It includes that men AND women are created equally which is one of the things that differs. The effect is that people reading the Declaration of Sentiments will see the truth that it tells when being rephrased.

Explanation:

What are four names given to Louisiana most important river?

Answers

Answer:

These are four major rivers in louisiana

Explanation:

Mississippi River, Red River,Atchafalaya River, Sabine River.

how does human resources affect the development process​

Answers

Answer:

Human resource development makes sure that manpower planning in an organization is not static but an ongoing process source Human resource Article (2009). It focuses on raising productivity through improved quality, efficiency, cost reduction and enabling customers concentrate on their core business activities.

Explanation:

Assessment
a. Summarize what you have learnt in five bullet points.​

Answers

there is no context to this question.

Answer:

ok

Explanation:

Khadim counts 10 seconds between a flash of lighting n a clap of thunder . how far away is the thunderstorm

Answers

Answer:

2 miles

Explanation:

Apparently each 5 seconds is one mile away according to weather.gov, so 10/5 is 2.

when a group of people share values, practice, and beliefs, this is known as

Answers

Answer:

When a group of people share values,Practices, and beliefs, this is known as -(Culture)

Explanation:

Which phrase defines Jim Crow?

Answers

Answif

a Jim crow law is any law that discriminates against a race

Explanation:

say 2 people of 2 different colors or gender or race do the same job one gets paid 12 and hour one gets paid 9 an hour that is discrimination because you are paying 2 different pays for the same job

Answer:

Law inforcmationt

Explanation:

fuj

Explain how stress may impact food consumption.

Answers

Answer:

Stress also seems to affect food preferences. Numerous studies — granted, many of them in animals — have shown that physical or emotional distress increases the intake of food high in fat, sugar, or both. High cortisol levels, in combination with high insulin levels, may be responsible.

Explanation: I got a 100

A human are the feel more stress and the anxiety to the effect of the consumption into the food.

What is food?

The term “food” refers to an edible and consumable material that provides the body with nutrition and vitamins to maintain itself. Plants, humans, animals, and birds all typically eat food. fruits, vegetables, legumes, dairy, and other nutrient-dense foods. The body need the food in order to function, thus it was consumed.

According to the feeling of the stress and the anxiety are the effect of the  consumption of the food process. The physical or emotional distress the consumed the food high cortisol levels. It was the combination of the high insulin levels are the more into the responsible.

As a result, the human is the feel more stress and the anxiety to the effect of the consumption into the food.

Learn more about on food, here:

https://brainly.com/question/10155625

#SPJ6

ANSWER QUICK PLEASE !!

Christianity sprang forth from ____ .

A . paganism .

B . islam .

C . judaism .

Answers

Answer:

judasim

Explanation:

Answer:

islam

Explanation:

i had googled it because i knew his answer was wrong

hope this helps

What conclusion does this passage best support?
Read the passage carefully.
The geography of ancient China shaped the way the
civilization and culture developed. The large land was
isolated from much of the rest of the world by dry deserts
to the north and west, the Pacific Ocean to the east, and
impassable mountains to the south. This enabled the
Chinese to develop independently from other world
civilizations
"Ancient China: Geography,"
Ken Nelson
Farming made trade across oceans, deserts, and
mountains unnecessary
The ocean, deserts, and mountains served as
natural barriers for ancient China.
Ancient Chinese peoples crossed mountains and
deserts to escape others.
The geography of ancient China aided interaction
with other civilizations.

Answers

Answer:

the answer is b

Explanation:

The conclusion that this passage best supports is that the ocean, deserts and mountains served as natural barriers for ancient China. The correct option is b.

What do you understand by the term natural barrier?

A natural barrier refers to a physical feature that protects or hinders travel through or over. Mountains, swamps, deserts and ice fields are among the clearest examples of natural barriers.

Rivers are a more ambiguous example, as they may obstruct large-scale movement across them but may facilitate smaller-scale movement along them in boats, once some of the people in the region have developed the relevant technologies. Seas have likewise been an obstacle at first, then a convenient medium for transport along coastlines, and finally a medium for intercontinental transport. Natural barriers have been important factors in human history, by obstructing migration and invasion.

Natural barriers are similarly important to biogeography, some examples of natural barriers are the Himalayas, Getcd Canyon etc.

Learn more about natural, here:

https://brainly.com/question/25917497

#SPJ5

If there is low demand for a product, then production would be

decreased
increased
the same
none of the above

Answers

decreased :) hope this helps

Answer:a

Explanation:



The Germans were finally halted in their advance into the Soviet Union at
 

 
A. 

the Battle of the Bulge.

B. 

the Kasserine Pass.

C. 

the Battle of Stalingrad.

D. 

Normandy

Answers

Answer:

The battle of Stalingrad

Explanation:

What is a social science?

Answers

Answer:

Social science is the branch of science devoted to the study of societies and the relationships among individuals within those societies. The term was formerly used to refer to the field of sociology, the original "science of society", established in the 19th century

social science is the study of human society and social relationships.

Which statements best describe the mounds of the Mesolithic era? Check all that apply.

1. The mounds were made for special ceremonies.
2. Louisiana’s oldest mounds date back to 7500 BCE.
3. Several mounds remain in Poverty Point, Louisiana.
4. The prairies include open areas covered with tall grass.
5. All of the mounds in Louisiana were destroyed long ago.
6. Mounds have a semi-circular shape and were made by humans.

Answers

Answer:

1 3 4 6

Explanation:

I just did the question on Edgenuity! :)

Answer:

The correct answer is 1,3,4, and 6

Explanation:

Describe the relationship that existed between the French and the American Indians living in North America that they encountered. Give an example of a group they interacted with and what occurred. Include these terms in your answer: Samuel de Champlain, Quebec, Heron, Iroquois, Trading for Animal Fur

Answers

Answer:

The answer is below

Explanation:

Around 1500s, the French has started TRADING FOR ANIMAL FUR with Native American Indians. By the early 1600, SAMUEL DE CHAMPLAIN, a French man known for his several voyages, had about 30 trips all around the North America, particularly the Atlantic Ocean. In some of his expedition, he discovered areas which are known today as QUEBEC and New France.

By 1609, various wars started between the IROQUOIS tribe, and Algonquin allies including HURON tribe, in which the French sided with the latter groups. The wars which was known as Beaver wars lasted till 1701.

NAFTA is a 1994 __________ between the United States, Mexico, and Canada.
A.
free trade agreement
B.
quota
C.
tariff
D.
exchange rate

Answers

Answer:

A. Free Trade Agreement

Explanation:

The North American Free Trade Agreement (NAFTA) is a treaty entered into by the United States, Canada, and Mexico; it went into effect on January 1, 1994. (Free trade had existed between the U.S. and Canada since 1989; NAFTA broadened that arrangement.)

Answer:

A

Explanation:

because i just took the test and got it right so A is the correct answer.

which statement is a hypothesis A.if an earthworm is given a choice,it will move toward darkness rather light.B most of earthworms moved to the shaded area during the experiment. C the earthworms must all be the same spices. D do earthworms prefer bright light or darkness

Answers

The answer is A: If an earthworm is given a choice, it will move toward darkness rather than light.
The other ones are either questions or have to do with the variables.

Answer:

A

Explanation:

George Washington wrote the following words in a letter to a friend.

"The Parliament of Great Britain hath no more right to put their hands into my pocket without my consent than I have to put my hands into yours for money."

Based on this excerpt, which grievance in the Declaration of Independence would Washington agree with?

King's refusal to approve laws
Limitations on trade
Abolishing charters
Taxation without consent
WHATS THE ANSWER

Answers

Answer:

Taxation without consent

Explanation: george washington is stating that you can't take my money without my approval or i will take yours

Answer:

Taxation without consent

is defending the usa a responsibility ??

Answers

Answer:

yes because we have to protect our nation that's why we have military and why we stick up for our self's

Explanation:

Answer: Yes

Explanation:

According to the social exchange theory, what factors determine how we feel about a relationship with another person?

Answers

Answer:

Explanation:

Social exchange theory says relationships and our feelings in them are based on the few factors:

Cost and reward this is one of the main concepts in the social exchange theory. It takes into consideration what we give in the relationship (time, support, compassion, money, etc.) and what we can gain from it (rewards, acceptance, advice, support, etc.). In order to have a full relationship, a balance between these two has to be found. We need to gain some benefit from the relationship and to get as much as we give. Otherwise, this can be considered to be a parasocial relationship. Expectations of relationship – This part considers what we think we deserve from the relationship and what we want from it. If we don’t think our partner or friend is not worth us, we won’t have the positive feelings towards them. Evaluation and alternativesevaluation of what other possibilities we have means we are thinking can we have a better relationship somewhere else with somebody else. If we believe that we can find someone who is better suited for us, we will likely lower our feelings towards the person and leave the relationship. Lenght The time we have known and spend with the person is also a valuable factor. Sometimes, the more time we invest in the relationship, the more attached we feel. However, there is a certain period called the “honeymoon period” in every relationship during which we think all is great. Only after this period is over, and as we begin to see the person and our relationship in a true light, can we truly decide on our feelings.

Do you think social media has negative effects on teens? Explain why or why not.

Answers

Yes, because a lot of people are always on it and some people think there not good enough because of other people who show their bodies off.
Other Questions
Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression? Read the poem. Then, select the correct answerexcerpt adapted fromI Wandered Lonely as a Cloudby William WordsworthI wandered lonely as a cloudThat floats on high o'er vales and hills,When all at once I saw a crowd,A host, of golden daffodils;Beside the lake, beneath the trees,Fluttering and dancing in the breeze,Continuous as the stars that shineAnd twinkle on the milky way.They stretched in never-ending lineAlong the margin of a bayTen thousand sawl at a glance,Tossing their heads in sprightly dance.For oft, when on my couch I lieIn vacant or in pensive moodThey upon that inward eyeWhich is the bliss of solitude:And then my heart with pleasure fills,And dances with the daffodils.Which word best describes the author's tone?Aadmiring.desperateOC somberOD playful \How does the allusion to Ham affect the meaning of the text?It emphasizes Douglass's desire to be free.It allows Douglass to discredit using the Bible to justify slavery.It highlights the similarities between enslaved people and those who enslave them.It compares slavery in the modern world to slavery in Biblical times. Write the definition of a function named count that reads all the strings remaining to be read in standard input and returns their count (that is, how many there are) So if the input was: hooligan sausage economy ruin palatialthe function would return 5 because there are 5 strings there. PLSS HELPP What is the value of x in this equation?4x 2(2x 2) = 2(2x 4) The company's profit will be exactly $0 if it makes and sells jackets. The company will make a profit if it makes and sells jackets, but will not make a profit if it makes and sells jackets why are Hispanics not a race in the u.s but only defined as ethnicity? Leann is learning about chemical reactions. She wants to create a model of a chemical reaction, so she is examining the information that she should include. What are the different components that she should include in her model? Choose the three that apply.A.the kinds of atoms that form during a reactionB.the kinds of molecules involved in the reactionC.the kinds of elements that make up a moleculeD.whether the molecules are products or reactantsE.whether the products have more mass than the reactants