Which revision correctly combines these two sentences?
Jennifer went grocery shopping. She purchased supplies to make sandwiches.
O Jennifer went grocery shopping; And, she purchased supplies to make sandwiches.
• Jennifer went grocery shopping; and she purchased supplies to make sandwiches.
O Jennifer went grocery shopping; she purchased supplies to make sandwiches.
• Jennifer went grocery shopping; She purchased supplies to make sandwiches.

Answers

Answer 1

Answer:

Jennifer went grocery shopping; She purchased supplies to make sandwiches.

Step-by-step explanation:

Out of all the other sentences, "Jennifer went grocery shopping; She purchased supplies to make sandwiches." is the only grammatically correct answer.


Related Questions

For problems 7-12, consider the sets below, and indicate if each statement is true or false.

A = {1, 2, 3, 4, 5} B = {1, 3, 5} C = {4, 6} U = {numbers from 0 to 10}

7. 3 ∊ B 8. 5 ∊ C 9. B ⊂ A 10. C ⊂ A 11. C ⊂ B 12. C ⊂ U


Using the sets from above, and treating U as the Universal set, find each of the following:

13. A ⋃ B 14. A ⋃ C 15. A ⋂ C 16. B ⋂ C 17. A c 18. B c

Answers

The correct statements are 7. 3 ∈ B, 9. B ⊂ A, 12. C ⊂ U

13. A ⋃ B  = {1, 2, 3, 4, 5, }   14. A ⋃ C  = { 1, 2, 3, 4, 5, 6}

15. A ⋂ C  = { 4 }                   16. B ⋂ C = { }

17. [tex]A^{c}[/tex]  =  {6, 7, 8, 9, 10}         18. [tex]B^{c}[/tex] = {0, 2, 4, 6, 7, 8, 9, 10}  

What are sets:

In mathematics, a set is a collection of distinct objects, which are called its elements or members. These objects can be anything - numbers, letters, people, animals, or other sets.

Sets are typically denoted using curly braces, and the elements of the set are listed inside the braces, separated by commas.

Here we have

A = {1, 2, 3, 4, 5} B = {1, 3, 5} C = {4, 6}  and U = {numbers from 0 to 10}

=> U = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 }

i. Indicate if each statement is true or false.

7. 3 ∈ B which means 3 belongs to set B

Since, set B = {1, 3, 5}

=> ∴ 3 ∈ B is true

8. 5 ∈ C which means 5 belongs to set C

The set C = {4, 6}

=> 5 ∈ C is false

9. B ⊂ A which means B is a subset of A and elements of B are belongs to set A.  

Since elements of B are lies in set A

=> B ⊂ A is true

10. C ⊂ A which means C is a subset of A

Since all the elements of C are not lie in set A

=> C ⊂ A is false

11. C ⊂ B which means C is a subset of B

Since all the elements of C are not lie in set B

=> C ⊂ B is false

12. C ⊂ U which means C is a subset of U

Since all the elements of C are lies in U

=> C ⊂ U is true  

13. A ⋃ B = {1, 2, 3, 4, 5} ∪ {1, 3, 5} = {1, 2, 3, 4, 5, }  

14. A ⋃ C = {1, 2, 3, 4, 5} ∪ {4, 6} = { 1, 2, 3, 4, 5, 6}

15. A ⋂ C  = {1, 2, 3, 4, 5} ⋂ {4, 6} = { 4 }

16. B ⋂ C =  {1, 3, 5} ⋂ {4, 6} = { }

17. [tex]A^{c}[/tex]  = The elements in the universal set but not in A = {6, 7, 8, 9, 10}

18. [tex]B^{c}[/tex] = The elements in universal set but not in B = {0, 2, 4, 6, 7, 8, 9, 10}  

Therefore,

The correct statements are 7. 3 ∈ B, 9. B ⊂ A, 12. C ⊂ U

13. A ⋃ B  = {1, 2, 3, 4, 5, }   14. A ⋃ C  = { 1, 2, 3, 4, 5, 6}

15. A ⋂ C  = { 4 }                   16. B ⋂ C = { }

17. [tex]A^{c}[/tex]  =  {6, 7, 8, 9, 10}         18. [tex]B^{c}[/tex] = {0, 2, 4, 6, 7, 8, 9, 10}  

Learn more about Subsets at

brainly.com/question/28666324  

#SPJ1

5x ^ 2 y^ prime prime +23xy^ prime +16.2y=0

Answers

Answer:

Step-by-step explanation:

5

the quotient of 7 and the sum of 8 and m

Answers

Answer: :)

n

_

8

I used n as the unknown number

Step-by-step explanation:

The quotient is the result of division between two numbers.

The quotient of a number (I used n) and 8 would be n 8

A collectible action figure is worth $1100. The value of the action figure increases by 6% each year.
Which explicit and recursive formulas can be used to model the situation.
Drag and drop each formula to the corresponding box.

Answers

In response to the query, we can state that r: the annual rate of increase equation (6% in this case)

What is equation?

In a math equation, two assertions are connected by the equals sign (=), which denotes equivalence. A mathematical assertion used in algebraic equations establishes the equivalence of two mathematical statements. For instance, in the equation 3x + 5 = 14, the equal sign creates a space between the values 3x + 5 and 14. To comprehend the relationship between the two sentences written on opposing sides of a letter, utilise a mathematical formula. The logo and the specific programme typically correspond. An illustration would be 2x - 4 = 2.  

Explicit Formula:

[tex]a_n = a_0 \times (1 + r)^n[/tex]

Recursive Formula:

[tex]a_n = a_{n-1} \times (1 + r)[/tex]

where:

[tex]a_n[/tex]: the value of the action figure after n years

[tex]a_0[/tex]: the initial value of the action figure ($1100 in this case)

r: the annual rate of increase (6% in this case)

To know more about equation visit:

brainly.com/question/649785

#SPJ1

V(0) is the initial value of the action figure, and the recursive formula calculates the value of the action figure after n years by adding 6% of the previous year's value to the previous year's value.

What is equation?

In a math equation, two assertions are connected by the equals sign (=), which denotes equivalence. A mathematical assertion used in algebraic equations establishes the equivalence of two mathematical statements.

Let V(n) be the value of the action figure after n years.

Explicit formula:

V(n) = 1100(1 + 0.06)^n

Recursive formula:

V(0) = 1100

V(n) = V(n-1) + 0.06V(n-1)

Therefore, V(0) is the initial value of the action figure, and the recursive formula calculates the value of the action figure after n years by adding 6% of the previous year's value to the previous year's value.

To know more about equation visit:

brainly.com/question/649785

#SPJ1

Select which option is most appropriate for describing the number line below.

Answers

Answer:

Answer D is correct

Step-by-step explanation:

ALGEBRA 1 HW!! I WILL GIVE BRAINLYEST FOR ANSWER​

Answers

I think it is C. but i am a little rusty

Pls Help! Will give brainliest!
Write the following linear equation in function notation. y = 2x + 5


(A.) f = 2x + 5

(B.) f(x) = 2x + 5

(C.) It is already written in function notation.

(D.) f(y) = 2x+ 5

Answers

The given expression is already written in function notation.

Solving linear equation

Function notation is a way of representing a mathematical relationship between two variables, where one variable (usually denoted as x) is the input and the other variable (usually denoted as y) is the output. In this case, y is a function of x, which means that the value of y depends on the value of x.

To write the linear equation y = 2x + 5 in function notation, we replace y with f(x) to get:

f(x) = 2x + 5

This means that f(x) is a function of x, where the output f(x) is equal to 2 times the input x plus 5. The variable f(x) represents the value of y for a given value of x.

Learn more on linear equation here: https://brainly.com/question/2030026

#SPJ1

You write 6 3/10 pages of a report in 2 1/3 hours. What is the average number of pages you write per hour?

Answers

the answer is 2 5/14

Answer:

Step-by-step explanation:

To find the average number of pages written per hour, we need to divide the total number of pages written by the total time taken:

Total pages written = 6 3/10 = 63/10

Total time taken = 2 1/3 = 7/3

Average pages written per hour = Total pages written / Total time taken

= (63/10) / (7/3)

= (63/10) x (3/7)

= 9/2

Therefore, the average number of pages written per hour is 9/2, which is equal to 4.5 pages per hour.

Create 5 examples of gains and losses using positive and negative numbers.

Answers

Answer:

Step-by-step explanation:

gain

loss

gain loss

gain

Answer:

Gains : +1,+10,+3

loss: -3,-5,-9,-100

Step-by-step explanation: I think this question is basically just asking about givings examples of positive and negative numbers

The principal P is borrowed at a simple interest rate r for a period of time t. Find the simple interest owed for the use of the money. Assume 360 days in a year.
P​ = ​$370​, r​ = 2​%, t​ = 2 years

Answers

Step-by-step explanation:

Using the formula for simple interest:

Simple Interest = P * r * t

where P is the principal, r is the rate of interest, and t is the time in years.

Substituting the given values:

Simple Interest = $370 * 0.02 * 2 = $14.80

Therefore, the simple interest owed for the use of the money is $14.80.

Jack has 7 yards of rope. He wants to cut it into pieces of different sizes. Jacks needs 84 inches of rope to tie some packages and 4 feet of rope for another project. Does Jack have enough rope? Explain.

Answers

Jack does have enough length of rope to tie his packages.

Explain about the unit conversions?

The same attribute is presented using a unit conversion, but in a differing unit of measurement. For examples, time can be indicated in minutes rather than hours, and distance can be depicted in kilometers, feet, or other types of measurement unit instead of miles.

7 yards of rope belong to Jack. He desires to separate this into pieces of various sizes. Jacks requires 4 feet of rope for one project and 84 inches of rope to bind some items.

So, concert all units in inches:

7 yards = 7*36 = 252 inches

4 feet = 4*12 = 48 inches.

Total length of rope = 252 inches.

Required rope = 84 inches + 48 inches

Required rope = 132 inches.

Thus,  Jack does have enough rope to tie his packages.

Know more about unit conversions

https://brainly.com/question/13016491

#SPJ1

Which expression represents the prime factorization of 192?
A. 2 x 2 x 2 x 2 x 12
B. 2 x 2 x 2 x 2 x 2 x 3
C. 3 x 2 x 2 x 2 x 2 x 2 x 2
D. 2 x 2 x 2 x 2 x 2 x 3 x 3

Answers

The expression represents the prime factorization of 192 is 2×2×2×2×2×2×3. Therefore, option C is the correct answer.

What is factorization?

The factorization method uses basic factorization formula to reduce any algebraic or quadratic equation into its simpler form, where the equations are represented as the product of factors instead of expanding the brackets. The factors of any equation can be an integer, a variable, or an algebraic expression itself.

The given number is 192.

The prime factorization is process of writing the given number into product of prime numbers.

Here, 192= 2×2×2×2×2×2×3

Therefore, option C is the correct answer.

To learn more about the factorization visit:

https://brainly.com/question/26923098.

#SPJ1

PLEASE HELP !!!! IM SO CONFUSED

Answers

For your question just change domain x=-4,-2,0,2,4 to the function y=-1/2x to find y and graph.

find x, show proofs

Answers

The side x of the similar triangle is 12.7 units.

How to find the side of a triangle?

The triangles are similar triangle.

Two triangles are said to be similar when they have two corresponding angles congruent and the sides proportional.

Therefore, using the proportion

37- 5 / x = x / 5

Evaluate the difference of 37 and 5

32 / x = x / 5

Cross multiply the equation

x × x = 32 × 5

So, we have

x² = 160

Take the square root of both sides

x = √160

Evaluate the square roots

x = 12.6491106407

Hence, the value of x is x = 12.7 units (when approximated)

learn more on triangle here:

https://brainly.com/question/2773823

#SPJ1

A shop employs one man and one woman as shop assistants. The man works for 10 hours per day and the woman for 8 hours per day, and their wages per hour are in the ratio 7:5 If the woman receives $24 per day, find the man's daily wage.​

Answers

The man's daily wage is given as follows:

$42.

How to obtain the man's daily wage?

The man's daily wage is obtained applying the proportions in the context of the problem.

Their wages per hour are in the ratio 7:5, hence the man's hourly wage is 7/5 of the woman's hourly wage, hence:

7/5 x 24/8 = 7/5 x 3 = 21/5 = $4.2 per hour.

The man works 10 hours a day, hence the daily wage is given as follows:

10 x 4.2 = $42.

More can be learned about proportions at https://brainly.com/question/24372153

#SPJ1

Quantitative data can be ___
O discrete
O continuous
O discrete or continuous
O none of the above

Answers

Answers:

Quantitative data can be discrete or continuous

Step-by-step explanation:

The Qualitative data are also called categorical or attribute data deals with characteristics and descriptors that can't be easily measured but can be observed subjectively.

We can say that smells tastes textures attractiveness and color are all examples of qualitative data. We can see that qualitative data are not numerical.

for example, dimensions such as height, width, and length, temperature and humidity, prices, area and volume.

The Discrete data is a count that cannot be made more precise. Continuous data could be divided and reduced to finer and finer levels.

A trapezium is shown below.
Work out the sizes of angles x and y.
Give your answers in degrees (°).
145°
X
Y
62°

PLEASE DO IT FOR 20 points

Answers

Answer:

x=118

y= 35

Step-by-step explanation:

180-62= 118

180-145=35

The value of x from the trapezium is 118° and the value of y from the trapezium is 35°.

What is a trapezium?

A trapezium is a quadrilateral with two parallel sides. It has two non-parallel sides that are called the legs of the trapezium, and the other two sides are called the bases.

From the given trapezium 4 angles are x, y, 62° and 145°.

Here, x+62°=180° (Sum of allied angles is 180°)

x=180°-62°

x=118°

Now, y+145°=180°

y=180°-145°

y=35°

Therefore, the value of x from the trapezium is 118° and the value of y from the trapezium is 35°.

Learn more about the trapezium here:

brainly.com/question/28697373.

#SPJ2

1. You work at a department store that needs at least 4200 labor hours covered per week. It employs full-time staff 40 hours per week and part-time staff 25 hours per week. The cost to employ a full-time staff member is more because the company pays benefits such as health care and life insurance

Full-time
Part-time
Hours per Week Cost per Hour
40 hr
$25
25 hr
$18

The store manager also knows that to make the store run efficiently, the number of full-time employees must be at least 1.25 times the number of part-time employees. You have been asked to help the store manager determine the number of full-time employees and the number of part-time employees that should be used to minimize the weekly labor cost.

a. Clearly define the variables in this problem.

b. Clearly state the constraints (all inequalities) related to the feasible region.

c. State the objective function.

d. Use the graphical method to
solve: Graph the solution region, showing the intercepts used. Label axes, units, points, and lines. Find and label all corner points. The grid for the graph is on the next page.
Show all necessary work.

e. In a complete sentence, state the number of full-time employees and the number of part-time employees that should be used to minimize the weekly labor cost.

Answers

Using linear programming, the minimum weekly labor cost of $2,616 occurs when there are 84 full-time employees and 67.2 part-time employees (which can be rounded up to 68 part-time employees)

What are the variables in this problem

a. Let x be the number of full-time employees and y be the number of part-time employees.

b. The constraints are:

Full-time employees work 40 hours per week, so the total number of full-time labor hours used must be at least 40x.Part-time employees work 25 hours per week, so the total number of part-time labor hours used must be at least 25y.The total number of labor hours used must be at least 4200: 40x + 25y ≥ 4200The number of full-time employees must be at least 1.25 times the number of part-time employees: x ≥ 1.25yThe number of full-time and part-time employees must be non-negative: x ≥ 0 and y ≥ 0

c. The objective function is to minimize the weekly labor cost, which is given by:

Cost = 25x + 18y

d. To graph the solution region, we can first graph the inequality 40x + 25y ≥ 4200 as a line:

Convert the inequality to an equation: 40x + 25y = 4200Solve for y: y = (4200 - 40x)/25 = (168 - 1.6x)Plot the y-intercept: (0, 168)Plot the x-intercept: (105, 0) (found by setting y = 0 and solving for x)Draw the line passing through the two intercepts.

Next, we can graph the inequality x ≥ 1.25y as a line:

Convert the inequality to an equation: x = 1.25yPlot two points on the line: (0, 0) and (0, 0) (found by setting y = 0 and x = 0 respectively)Draw the line passing through the two points.

The feasible region is the shaded region that satisfies all the constraints and is bounded by the two lines and the x and y axes:

To find the corner points, we can solve the system of equations for the lines that form the boundaries of the feasible region:

40x + 25y = 4200 and x = 0 (y-axis intercept) --> (0, 168)40x + 25y = 4200 and y = 0 (x-axis intercept) --> (105, 0)x = 1.25y and y = 0 (x-axis intercept) --> (0, 0)x = 1.25y and 40x + 25y = 4200 --> (84, 67.2)

Now we can evaluate the objective function at each of the corner points:

(0, 0): Cost = 0(0, 168): Cost = 25(0) + 18(168) = 3024(105, 0): Cost = 25(105) + 18(0) = 2625(84, 67.2): Cost = 25(84) + 18(67.2) = 2616

Therefore, the minimum weekly labor cost of $2,616 occurs when there are 84 full-time employees and 67.2 part-time employees (which can be rounded up to 68 part-time employees).

Learn more on linear programming here;

https://brainly.com/question/13154906

#SPJ1

Kira works mowing lawns and babysitting. She earns $9.20 an hour for mowing and $7.50 an hour for babysitting. How much will she earn for 6 hours of mowing and 1 hour of babysitting?

Answers

Answer:

$62.70

Step-by-step explanation:

of means "x"

and means "+"

6 hours of mowing and 1 hour of babysitting

(6 hours of mowing) + ( 1 hour of babysitting)

6 hours of mowing

6 hours x mowing

6x9.20 = answer 1

1 hour of babysitting

1 hour x babysitting

1 x 7.50 = answer 2

add both answers together to get final answer

g(x)=-4x^2+36/x+3 What key features does f(x), shown in the graph, share with g(x), shown in the equation? Select three options.

Answers

The graph's function g(x) has a single x-intercept, a y intercept, a vertical asymptote, an oblique asymptote, and both.

Describe Asymptotes?

Asymptotes are points along a line that a curve approaches but never touches. The term "asymptote" refers to the point at which a function's graph converges. Asymptotes are often not necessary when graphing functions.

There are three distinct asymptotes.

Asymptote horizontal (HA) - Given that it is horizontal, its equation has the form y = k. The horizontal asymptote is the point at which the function f(x) tends to zero.

As it is a vertical line, the vertical asymptote's equation has the form x = k. When the denominator of a rational function approaches towards 0, vertical asymptotes are defined.

The equation for the slanting asymptote (also known as the oblique asymptote) is y = mx + b since the line is inclined.

given the information,

Let's write the function as g. (x)

The value of g (x) is right now.

g (x) = ( -4x² + 36) / (x + 3)

We gain by simple.

g (x) = -4x² - 4×9) / (x + 3)

We gain more after additional simplification.

g (x) = -4 (x + 3) (x - 3) / (x + 3)

g (x) = -4x + 12

There is now a vertical asymptote for the function at (0, 12)

There is a horizontal asymptote for the function at (3, 0)

The function is so resolved.

To know more about asymptotes, visit:

https://brainly.com/question/27871406

#SPJ1

The complete question is:

G(x)=-4x^2+36/x+3

What key features does f(x), shown in the graph, share

with g(x), shown in the equation? Select three options.

at least one x-intercept

at least one y-intercept

Dan oblique asymptote

O a vertical asymptote

the domain of x

Answer:

Step-by-step explanation:

-3 + ___= -1.9
What is in the missing blank

Answers

Answer:

1.1

Step-by-step explanation:

-3+1.9 =-1.1

-3+1.1=-1.9

Answer:

-3 + 1.1 = -1.9

Step-by-step explanation:

Let us assume that,

→ Missing number = m

Now we have to,

→ Find the required value of m.

Forming the equation,

→ -3 + m = -1.9

Then the value of m will be,

→ -3 + m = -1.9

→ m - 3 = -1.9

→ m = -1.9 + 3

→ [ m = 1.1 ]

Hence, the value of m is 1.1.

Evaluate the given expression:

Answers

In answering the question above, the solution is The answer is s 4 = 632 expressions as a result.

what is expression ?

In mathematics, you can multiply, divide, add, or take away. The following is how an expression is put together: Numeric value, expression, and math operator The elements of a mathematical expression include numbers, parameters, and functions. It is feasible to use contrasting words and expressions. Any mathematical statement containing variables, numbers, and a mathematical action between them is known as an expression, often known as an algebraic expression. As an example, the expression 4m + 5 is composed of the expressions 4m and 5, as well as the variable m from the above equation, which are all separated by the mathematical symbol +.

Let's start by condensing the expression included within the summation:

[tex]2(3^n - 1) = 2*3^n - 2[/tex]

We may now enter the following expression in the original equation:

[tex]s_4[/tex] = 4 * ∑[tex](k=1[/tex]to [tex]4) 2(3^k - 1)[/tex]

[tex]s_4 = 4 * [2(3^1 - 1) + 2(3^2 - 1) + 2(3^3 - 1) + 2(3^4 - 1)]\\s_4 = 4 * [2(3^1 + 3^2 + 3^3 + 3^4) - 8]\\s_4 = 4 * [2(3^1 + 3^2 + 3^3 + 3^4) - 2^3]\\s_4 = 4 * [2(80) - 8]\\s_4 = 632[/tex]

The answer is s 4 = 632 as a result.

To know more about expressions visit :-

https://brainly.com/question/14083225

#SPJ1

On jeopardy during the month of September the champions Won a total of $694563 assuming that there were 22 jeopardy shows in September what was the average amount won each day by the champions

Answers

Answer:

To find the average amount won each day by the champions, we need to divide the total amount won by the number of days:

Average amount won each day = Total amount won / Number of days

Total amount won = $694,563

Number of days = 22

Average amount won each day = $694,563 / 22 = $31,611.95 (rounded to the nearest cent)

Therefore, the average amount won each day by the champions on Jeopardy in September was approximately $31,611.95.

Step-by-step explanation:

Take $694593 and divide it by the number of jeopardy shows (22) to find the average amount won each day by the champions. After doing so you’ll get ~$31,571.

which of the following is a set of complementary angles ?

(PLEASE HELP THIS IS DUE TODAY!!!!)

Answers

None of the given angles are complementary angles.

What is angle ?

An angle is a geometric figure formed by two rays with a common endpoint called the vertex. The rays are also known as the sides or legs of the angle. Angles are usually measured in degrees or radians and are used to measure the amount of rotation between two lines or planes.

According to given information :

The sum of two angles is 90 degrees if and only if they are complementary angles.

Using this concept, we can add up the angles in pairs to see which ones are complementary:

Angle AFB + Angle BFC = 40 + 60 = 100 degrees (not complementary)

Angle BFC + Angle CFD = 60 + 50 = 110 degrees (not complementary)

Angle CFD + Angle DFE = 50 + 30 = 80 degrees (not complementary)

Angle AFB + Angle DFE = 40 + 30 = 70 degrees (not complementary)

Therefore, none of the given angles are complementary angles.


To know more about angle visit :

https://brainly.com/question/25716982

#SPJ1

Answer:

Below

Step-by-step explanation:

BFC = 60 degrees and  DFE = 30 degrees <===so they are complementery

 because they sum to 90°

Kevin put a deposit of 10% on his new car. The deposit was $4000, so how much does he still owe?

Answers

Answer:

3600

Step-by-step explanation:

Based on the given conditions, formulate: 4000 x ( 1 - 10\% )

Calculate the sum or difference:4000 x 0.9

Calculate the product or quotient:3600

get the result: 3600

Answer: 3600

Which expression represents the distance between Q and R

Answers

Answer:

Translation

Step-by-step explanation:

Translation

Mica is going to buy a computer for $2,000. He
can finance it at the store for 14% interest for
2 years, or he can use his credit card at 21%
interest for 1 year.

1. Find the monthly payment for each option.
Answer in the box.

2. Find the total repayment for each option.
Answer in the box.

Answers

Answer: To find the monthly payment for each option, we can use the following formula:

Monthly Payment = Total Cost * (Monthly Interest Rate) / (1 - (1 + Monthly Interest Rate)^(-Number of Months))

For the option to finance at the store for 2 years at 14% interest:

Total Cost = $2,000

Monthly Interest Rate = 14% / 12 = 0.011667

Number of Months = 2 years x 12 months/year = 24 months

Substituting these values into the formula, we get:

Monthly Payment = $2,000 * 0.011667 / (1 - (1 + 0.011667)^(-24)) = $95.13

Therefore, the monthly payment for financing at the store for 2 years at 14% interest is $95.13.

For the option to use his credit card at 21% interest for 1 year:

Total Cost = $2,000

Monthly Interest Rate = 21% / 12 = 0.0175

Number of Months = 1 year x 12 months/year = 12 months

Substituting these values into the formula, we get:

Monthly Payment = $2,000 * 0.0175 / (1 - (1 + 0.0175)^(-12)) = $185.44

Therefore, the monthly payment for using his credit card at 21% interest for 1 year is $185.44.

To find the total repayment for each option, we can multiply the monthly payment by the number of months:

For the option to finance at the store for 2 years at 14% interest:

Total Repayment = $95.13/month x 24 months = $2,283.12

Therefore, the total repayment for financing at the store for 2 years at 14% interest is $2,283.12.

For the option to use his credit card at 21% interest for 1 year:

Total Repayment = $185.44/month x 12 months = $2,225.28

Therefore, the total repayment for using his credit card at 21% interest for 1 year is $2,225.28.

Step-by-step explanation:

The question is present in the image

Answers

The value of variables are,

a = 0

c = 7

d = 2

What is an expression?

Mathematical expression is defined as the collection of the numbers variables and functions by using operations like addition, subtraction, multiplication, and division.

Given that;

The expression is,

⇒ [tex]\frac{32x^{4} y^{3} z^{- 6} }{(4x^{2} y^{-2} z^{-2})^2 } = \frac{Ax^ay^c}{z^d}[/tex]

Now, We can simplify as;

⇒ [tex]\frac{32x^{4} y^{3} z^{- 6} }{(4x^{2} y^{-2} z^{-2})^2 } = \frac{Ax^ay^c}{z^d}[/tex]

⇒ [tex]\frac{32x^{4} y^{3} z^{- 6} }{(16x^{4} y^{-4} z^{-4}) } = \frac{Ax^ay^c}{z^d}[/tex]

⇒ [tex]\frac{2x^0y^7}{z^2} = \frac{Ax^ay^c}{z^d}[/tex]

By comparing, we get;

a = 0

c = 7

d = 2

Learn more about the mathematical expression visit:

brainly.com/question/1859113

#SPJ1

Select all of the expressions that are equivalent to (9x+6)-¹(8x-4).
M. 2(x + 1)
R. 2x+6
R. 2x + 2
S. 2(x + 3)
T. 8x

Answers

The expression that is equivalent to 2(9x+6)/3-(8x-4)/2 is 8x, the correct option is T.

What is an expression?

Expression in mathematics is defined as the collection of numbers variables and functions by using signs like addition, subtraction, multiplication, and division.

We are given that;

The function=2(9x+6)/3-(8x-4)/2.

Now,

First, let's simplify the expression given:

2(9x+6)/3 - (8x-4)/2 = (18x + 12)/3 - (4x - 2) = 6x + 4 - 2x + 1 = 4x + 5

Now let's check which of the given expressions are equivalent to 4x + 5:

M. 2(x + 1) = 2x + 2 (not equivalent)

R. 2x+6 (not equivalent)

R. 2x + 2 (not equivalent)

S. 2(x + 3) = 2x + 6 (not equivalent)

T. 8x = 8x - 40 + 45 = 4x + 5 (equivalent)

Therefore, the answer of the given expression will be 8x.

To know more about an expression follow;

brainly.com/question/19876186

#SPJ1

ANWSER QUICK

After a couple of years, you’ve decided to sell your house. You originally bought it for $250,000 and spent an additional $10,000 in renovations, Your realtor thinks you can sell it for $290,000.

Answers

The profit to be made by selling the house for $290000 is $30000

What is an equation?

An equation is an expression that shows how two or more numbers and variables are related using mathematical operations of addition, subtraction, multiplication, division, exponents and so on.

You originally bought it for $250,000 and spent an additional $10,000 in renovations, Hence:

Total money spent = $250000 + $10000 = $260000

The realtor thinks you can sell it for $290,000. Therefore:

Profit = $290000 - $260000 = $30000

The profit to be made by selling the house is $30000

Find more on equation at: https://brainly.com/question/2972832

#SPJ1

Other Questions
The RNA sequence GGAUCUCUUGUAGAUCUGUUCUCUAAACGAAC lies in a section of the COVID-19 viral genome that sets up translation, which is the process of reading the RNA to create the proteins the virus needs to survive.(a) Use the webserver to predict the lowest energy structure of the sequence. Print out a picture of it. (b)What do you think the effect will be of the RNA being longer than the stretch you just similated? (c) Design an RNA sequence that folds into a single stem-loop. Run it through the RNAfold server and print a picture of your folded design. consider a political discussion group consists of 6 democrates, 3 republicans, and 5 independents. suppose that two group members are randomly selected, in succession, to attend the political convention. find the probability of selecting a independent then a democrat According to the Kaplan-Meier plot, amplification of more than 10 copies of myc in neuroblastoma (see fig. 4-11b), decreases disease-free survival by more than 80% post-treatment. Explain two mechanisms that may contribute to gene amplification of myc? Even though both lens cells and liver cells have numerous transcription factors that are present in both colls, the lens cell makes the crystallin protein (not albumin), whereas the liver cell makes albumin (not crystallin) Which of the following explains this cell specificity?A. Different specific transcription factors made in each cell determine which genes are expressedB. At fertilization, specific colls are destined for certain functionsC. The activators needed for expression of the crystallin gene are present in all cells.D. The promoters are different for the different genes How does the author's discussion of different death rates help readers understand the spread of the Black Death? Use evidence from the text in your responsepls i need help!! a rock rolling down a slope from rest covers a distance of 4 m in the first second. What distance will it covers in 3 sec? 5 3/10 = 5 ?/50If anyone can please help me with the rest what happened to some native Americans during the Jackson presidency ? In order for following to be consistent,-3x +4y +7z =-4-11x +24y +kz = -452x -5y -8z =9solve for k ?please show full steps Air passes over the top of an airplanewing at 170 m/s, and over the bottomat 130 m/s. What is the difference inpressure between the top andbottom of the wing? Scarlett and Roger sipped their drinks on the porch, discussing all the things they still had to do before the Easter holiday. As Roger finished her last bit of burger, he sighed, "I'm stuffed." He complained of having a burning sensation in his lower chest. "You probably ate too much. How about taking some antacid?" asked Scarlett. "I use it every time I get indigestion." Roger left to search the medicine cabinet. He eventually felt better. Roger got his body test results the next day. He glanced at them briefly and put the paper in his bag. "Maybe later I will get a better sense of what all this means," he said.'Roger's test results(at rest and fasting levels)TEST Roger's Result Normal RangeHeart rate 90 beats/min 60-100 beats/minBlood pressure 138/95 mm/Hg 120/80 mm/HgTotal cholesterol 242 mg/dL create a journal from the perspective of a citizen living in paris during the french revolution CAN SOMEONE HELP ME PLEASE ASAP write three rations that are equivalent to 6/9 Is this a function? Why or why not? Explain your reasoning for each part. How did Claudette Colvin's social status contribute to why civil rights groups didn't use her actions to inspire the bus boycott? Has your social status ever influenced the way people treat you? If so, describe the experience. According to the graph, in the United States how much land is used by cities compared to other land uses?A- Cities use one third as much of the land as forests.B- Cities use very little land compared to any other category.C- Cities use half as much land as agriculture.D- Most land is used by cities. Suppose when Sweetland (a hypothetical country) opens to trade, it imports computer software, a capital-intensive good.a. According to the HeckscherOhlin theorem, is Sweetland capital-abundant or labor-abundant? Briefly explain. (1 mark)b. What is the impact of opening trade on the real wage in Sweetland? Briefly explain. (2 marks)c. What is the impact of opening trade on the real rental on capital? Briefly explain. (2 marks).d. Which group (capital owner o Earthquakes and volcanic eruptions fall into which category of time scales of natural disruptions?A. periodicB. episodicC. diurnalD. random According to the information presented in the passage, what is the general populaces opinion of genius? How do the average rates of change for the pair of functions compare over the given interval?f(x)xg(x)xxQuestion content area bottomPart 1The average rate of change of f(x) over x is enter your response here. The average rate of change of g(x) over x is enter your response here. The average rate of change of g(x) is enter your response here times that of f(x). (Simplify your answers. Type integers or decimals. )