What period was Carnegie describing

Answers

Answer 1

Answer:The time before the Industrial Revolution.

Explanation :

Answer 2

Answer:

A.) The time before the Industrial Revolution

Explanation:


Related Questions

Which were advantages the South had over the North at the start of the Civil War?
Select all that apply.

1)The South had more miles of railroad track.
2)The South had more knowledge of the land.
3)The South had a stronger government.
4)The South had a larger army and navy.
5)The South had more experienced military officers.

Answers

Answer:

Correct Answer: Some of the problems the South has over the North during the civil war include:

1)The South had more miles of railroad track.

5)The South had more experienced military officers.

2)The South had more knowledge of the land.

Explanation:

During the American Civil War, most of the problems encountered by the Union States who were trying to prevent the Southern States from leaving was what lingered the war.

Firstly, most of the railroad tracks falls within the Southern States. This made it difficult for the soldiers of the North to persecute the war successfully. Also, the experienced military officers as well as the knowledge of the lands aided the Southern States during the civil war.

John Locke and other Enlightenment thinkers emphasized
over religion.

Answers

Answer:

This Question represents a fundamental misunderstanding of Locke's beliefs

Explanation: There are no answer choices provided, and I will thus assume that it is intended as an open ended question. While Locke did refute Robert Filmer's religious justification of a monarchy (Filmer argued modern rulers to be direct decendants of Adam), Locke's own philosophy did not stray very far from religious beliefs, and was instead rooted almost entirely in a different interpretation of scripture. Similar "Enlightenment" philosophers like Rousseau and Voltaire were also strong deists (Voltaire was also a monarchist), and based much of their philosophy

upon scripture. Indeed, some of the only Enlightenment philosophers who did not base their works almost entirely upon the scripture were Kant and Hume, although Hume's personal beliefs are unknown. The Enlightenment philosophers were not, as is often portrayed, an entirely homogenous group.

Answer:

the answer is c. reason

Explanation:

The gay rights movement in the 1970s was characterized by -the AIDS crisis. -a newfound openness. -the advancement of the intellectual study of gay and lesbian issues.

Answers

Answer:

B) a newfound openness

Explanation:

edg 2021

Answer:

B - A newfound openness

Explanation:

Trust It is

According to Humanist thinkers, political decisions should be based on____

Answers

Answer:

rational thought.

Explanation:

According to Humanist thinkers, political decisions should be based on rational thought.  It is because rational thought is based on the facts and with the help of these facts conclusion should be drawn. In politics, political decision should be taken by taking opinions of the members of the party. All the opinions should be considered by reviewing the facts and that opinion is selected for application on which maximum members of the party is agreed.

According to humanist thinkers, decisions of a political nature should be made based on rational thought.

According to humanism:

decisions should be based on practical human experiences

decisions should be based on rational thought and logic

knowledge does not come from a supernatural source but rather from trial and error

When it comes to politics, this applies as well. They believed that decisions of governance should be made based on what will apply best to society and not what religion believes. It was this thinking that led to the Renaissance.

In conclusion, Humanists believe that decisions should follow a rational process.

What were Spanish landowners expected to do for indigenous peoples under the encomienda system?
protect them, educate them, and convert them to Christianity
O give them shelter and enslaved persons, and pay them money
provide them with their own land
show them a path to freedom​

Answers

Answer:

The Spanish landowners were expected to convert the Natives to Christianity and make them work till they died or until disease took them out. The Encomienda system was horribly cruel.

Explanation:

The Spanish landowners were expected to convert the Natives to Christianity and make them work till they died or until disease took them out. The Encomienda system was horribly cruel.

What was the Encomienda system?

The encomienda was a Spanish labor system in which conquerors were rewarded with the labor of conquered non-Christian peoples. In theory, the conquerors for whom the laborers worked provided them with benefits such as military protection and education.

The encomienda system was implemented in several countries, most notably Peru. The encomienda system entrusted prominent Spaniards with Native Peruvian communities. The Spanish lord would provide protection and education in exchange for stolen Indigenous labour and tribute.

Therefore, the Spanish landowners would protect the indigenous people, educate them, and convert them to Christianity.

To learn more about Encomienda system, click here:

https://brainly.com/question/20257814

#SPJ6



On Friday, the Johnson family built 23 sandcastles. If they built a total of 39 sandcastles on Friday and
Saturday combined, how many sandcastles did they build on Saturday?​

Answers

Answer: 16 sandcastles.

Explanation: 39 - 23 = 16.

Describe the strategy of the South to win the war? please

Answers

Explanation:

Their strategy was to take advantage of their compact geography, with internal lines of communication, their military heritage (Southerners had been disproportionately the officers of the United States Army), and their greater enthusiasm for their cause to wear down the Union will to wage war.

Which of the following equations have no solutions?
Choose all answers that apply:
А
4x + 5 = -4x + 5
B
5x + 5 = -4x – 5
с
-4x + 5 = -43 - 5
D
-4x+5= - 4x - 4

Answers

Answer:

Answer is C and/or D

Explanation:

I am not sure if you misspelled something, but the last two answer choices are parallel to each other

The final type of equation is a contradiction, also known as a No Solution Equation  is a mathematical statement .

What is No Equation ?

that is made up of two expressions connected by an equal sign. 3x - 5 = 16 is an example of an equation. Solving this equation, we get the value of the variable x as x = 7.

An equation is a mathematical expression that includes the equals sign. Algebra is frequently used in equations. When you don't know the exact number in a calculation, you use algebra.

The final type of equation is a contradiction, also known as a No Solution Equation. This type of equation is never true, no matter what variable is substituted. Consider the following example: 3x + 5 = 3x - 5. This equation has no solution.

When there is no solution to a problem, you will End up with a false statement. For instance, 0=1 This is incorrect because we all know that zero cannot equal one. Therefore we can conclude that the problem has no solution.

Learn more about Equation here

https://brainly.com/question/29143079

# SPJ 5

Who fought in the Holy War? A: Napoleon’s forces and a coalition of other European countries B: Napoleon’s forces and Britain C: American forces and a coalition of British and French forces D: Napoleon’s forces and Alexander I’s forces

Answers

Answer:

srry

Explanation:

yes very srry

Next, you will do some research to further analyze the impact of the Industrial Revolution. Look for information that describes both the positive and negative effects of this era. You can use the websites listed below to conduct your research. The first three websites provide descriptions of working conditions during the Industrial Revolution. The last website describes technological advances of the era. If you like, look for other sites that provide information on the topic. Based on your research, make a list of positive and negative effects of industrialization.

Answers

The correct answer to this open question is the following.

The question is incomplete because you did not attach the list of websites. Although there is no list, we can say the following.

The positive thing about the Industrial Revolution was that the development of new technology allowed the creation of machines that improved the production systems, surging what was known as mass production. Many fabrics were built during the Industrial Revolution and owners offered many jobs to operate the new machines. Mass production accelerated and increased the production of goods. Many people left the rural areas of the country to establish in the large cities where the factories were located.

Among the negative side of the Industrial Revolution was the fact that yes, many jobs were offered, but they were low paid jobs. And in the fabrics, workers labored under harsh and unhealthy conditions. There were many accidents operating machines. Many immigrants arrived at these large cities and lived in crowed spaces because they were poor people just trying to survive. So many people lived in small places, were hygiene was a serious problem as well as the spread of diseases.  

Answer:

The image provides the answer

Explanation:

Plato answer

Which statement best summarizes Russia's experience on World War 1's Eastern Front? A.Russian troops lost most battles, but morale remained high out of loyalty to the czar. B.Russian troops were extremely well equipped but still lost nearly every battle. C.Russian troops won several battles but suffered extremely heavy casualties D.Russian troops served mainly as support for British troops, who treated them poorly

Answers

Answer:

The answer is -C

Explanation:

Which statement best summarizes Russia's experience on World War 1's Eastern Front? A.Russian troops lost most battles, but morale remained high out of loyalty to the czar. B.Russian troops were extremely well equipped but still lost nearly every battle. C.Russian troops won several battles but suffered extremely heavy casualties D.Russian troops served mainly as support for British troops, who treated them poorly

Answers

Answer:

A.Russian troops lost most battles, but morale remained high out of loyalty to the czar.

Explanation:

Russia's experience on World War 1's Eastern Front was mixed as they won some of the battles but however lost a higher percentage of war in which they went into. A lot of casualties were recorded during this war period.

Their morale however remained high despite the defeats due to a great degree of loyalty to the czar.

Answer:

C.Russian troops won several battles but suffered extremely heavy casualties

Explanation:

Describe how America tried to deal with the 2nd Red Scare and describe the rise and fall of Joseph McCarthy.

Answers

Answer:

American society faced many hardships when political opponents were turned anti-nationalist using the communist tag during the Cold war era.

Explanation:

The second Red Scare refers to the period in the history of the United States when fear of communism had penetrated the society during the early periods of the Cold War. House Un-American Activities Committee, the Senate Internal Security Subcommittee, and McCarthy's Permanent Subcommittee on Investigations were key congressional investigative committees. Those committee leaders and their employees collaborated with the FBI to recognize and prosecute suspected communists.

McCarthy was a young Wisconsin senator who stunned the nation in 1950 when he alleged to have information that large numbers of communists managed to hold prominent positions in the State Department.   He and other Republicans would use these arguments for the next two years to pressure out the Truman administration, and the anti-communist agenda played a key factor for their landslide win in the 1952 election. However, no evident proof soon made him a liability for his party, and his influence started to fade away.

In this lesson, you’ll learn about the growth of civilizations in Mesopotamia. You’ll also learn about the world’s first empires. What is an empire? What do you think it takes to lead an empire? What challenges might an empire’s leader face?

Answers

Answer: Empire is a state or a country under a single authority or ruled by a king or queen.

Explanation:

Answer:

An empire is a group of countries or regions that a single leader controls. Leaders of empires probably need to be very strong and intelligent. They make many big decisions about issues such as wars, money, and laws. They decide how to spend huge amounts of money collected as taxes. But they also have many worries because of wars, rebellions, and rivals for power. If things turn out badly in a war or a rebellion, they can lose their empires or even their lives.

Explanation:

An empire is a group of countries or regions that a single leader controls. Leaders of empires probably need to be very strong and intelligent. They make many big decisions about issues such as wars, money, and laws. They decide how to spend huge amounts of money collected as taxes. But they also have many worries because of wars, rebellions, and rivals for power. If things turn out badly in a war or a rebellion, they can lose their empires or even their lives.An empire is a group of countries or regions that a single leader controls. Leaders of empires probably need to be very strong and intelligent. They make many big decisions about issues such as wars, money, and laws. They decide how to spend huge amounts of money collected as taxes. But they also have many worries because of wars, rebellions, and rivals for power. If things turn out badly in a war or a rebellion, they can lose their empires or even their lives.An empire is a group of countries or regions that a single leader controls. Leaders of empires probably need to be very strong and intelligent. They make many big decisions about issues such as wars, money, and laws. They decide how to spend huge amounts of money collected as taxes. But they also have many worries because of wars, rebellions, and rivals for power. If things turn out badly in a war or a rebellion, they can lose their empires or even their lives.An empire is a group of countries or regions that a single leader controls. Leaders of empires probably need to be very strong and intelligent. They make many big decisions about issues such as wars, money, and laws. They decide how to spend huge amounts of money collected as taxes. But they also have many worries because of wars, rebellions, and rivals for power. If things turn out badly in a war or a rebellion, they can lose their empires or even their lives.An empire is a group of countries or regions that a single leader controls. Leaders of empires probably need to be very strong and intelligent. They make many big decisions about issues such as wars, money, and laws. They decide how to spend huge amounts of money collected as taxes. But they also have many worries because of wars, rebellions, and rivals for power. If things turn out badly in a war or a rebellion, they can lose their empires or even their lives.An empire is a group of countries or regions that a single leader controls. Leaders of empires probably need to be very strong and intelligent. They make many big decisions about issues such as wars, money, and laws. They decide how to spend huge amounts of money collected as taxes. But they also have many worries because of wars, rebellions, and rivals for power. If things turn out badly in a war or a rebellion, they can lose their empires or even their lives.An empire is a group of countries or regions that a single leader controls. Leaders of empires probably need to be very strong and intelligent. They make many big decisions about issues such as wars, money, and laws. They decide how to spend huge amounts of money collected as taxes. But they also have many worries because of wars, rebellions, and rivals for power. If things turn out badly in a war or a rebellion, they can lose their empires or even their lives.An empire is a group of countries or regions that a single leader controls. Leaders of empires probably need to be very strong and intelligent. They make many big decisions about issues such as wars, money, and laws. They decide how to spend huge amounts of money collected as taxes. But they also have many worries because of wars, rebellions, and rivals for power. If things turn out badly in a war or a rebellion, they can lose their empires or even their lives.An empire is a group of countries or regions that a single leader controls. Leaders of empires probably need to be very strong and intelligent. They make many big decisions about issues such as wars, money, and laws. They decide how to spend huge amounts of money collected as taxes. But they also have many worries because of wars, rebellions, and rivals for power. If things turn out badly in a war or a rebellion, they can lose their empires or even their lives.


Which statement describes a primary role of political parties in helping
citizens engage with the U.S. government?

Answers

Answer:

Making voting less difficult by showing what positions competitors related to the gathering are probably going to take is the one that portrays an essential part of political gatherings in helping subjects draw in with the U.S. government.

Explanation:

Name the region whose inhabitants were broadly know as slaves ?​

Answers

Answer:

The African were broadly know as slaves.

Which of the following was one of the causes of the Cold War? A The U.S.S.R. needed to control territory. B The U.S.S.R. attempted to spread communism. C The Marshall Plan caused the perception of American expansionism. D All of the above

Answers

Answer:

D, The USSR used many Eastern European countries acquired from the end of WWII as sattelite countries, The USSR spread communism in places such as North Korea and China and the Marshall Plan saw to give aid to many of the countries affected by WWII in a Capitalist way which caused tensions with the USSR

Use the graph and your knowledge of social studies to answer the question. Which of the following best summarizes the information shown in the graph? A. Lynching increased with the start of the Jim Crow era and then declined slowly. B. Lynching increased in frequency with each passing year. C. Lynching was a serious problem in the late 1800s but disappeared shortly thereafter. D. Lynching stayed at approximately the same level in the late 1800s and early 1900s.

Answers

Answer:
A. Lynching increased with the start of the Jim Crow era and then declined slowly.

Explanation:
you can see in the graph the slow decline as each bar gets smaller and smaller.

based on the graph, other choices seem to be incorrect.

- lynching did NOT increase in frequency with each passing year
- lynching was definitely a serious problem in the late 1800s but did NOT disappear completely afterward
- lynching was NOT the same level in the late 1800s and early 1900s

also the jim crow era lasted from 1877-1950s (or 1965 depending on how one sees it) lynching increased then because the jim crow laws enforced racial segregation severely.

How did Chi Minh attempted to work with the United States to solve the problems of Vietnam?

Answers

Answer:

I hope this helped. I am sorry if you get this wrong. Brainly Please?

Explanation:

Hồ Chí Minh led the Việt Minh independence movement from 1941 onward, establishing the Communist-ruled Democratic Republic of Vietnam (North Vietnam) in 1945 and defeating the French Union in 1954 at the Battle of Điện Biên Phủ, ending the First Indochina War.

Answer: H o Chi Minh was not always anti-American. He tried to get aid and support from the United States for his cause in the 1940s. It was only when the United States denied this aid and supported French colonialism in the region that he became an opponent of the United States.

(EDMENTUM ANSWER!!!)

"King Philip" or Metacom Group of answer choices fought alongside of George Washington at the Battle of Fort Necessity was Powhatan's main river for control of the Chesapeake led a revolt against Puritans in New England in the late 1600s was an early convert to Christianity and a firm friend of the Puritans

Answers

Answer:

led a revolt against Puritans in New England in the late 1600s

Explanation:

Metacom or King Phillip (his adopted English name) lived between 1638 -1672, and became the sachem in 1662, following his brother's death. He would later be remembered for his heroic role after his eventual death through assassination.

However, due to increasing encroachment which continued until full blown ostilities started in 1675. Metacom led the LED A REVOLT against Puritans in New England with the goal of stopping Puritan expansion.

What are the names of each president from 40th to 44th?

Answers

Answer:

His name is Ronald Reagan

Explanation:

Answer:

Ronald Reagan, George Herbert Bush, William (bill) Clinton, George Walker Bush, Barack Obama, Donald Trump

Explanation:

these are the names of the president's from 40th to 44th

Chinese Nationalists established the Republic of China in
Mongolia
South Korea
Tibet
Taiwan

Answers

prtty sure its Taiwan. there is probably a Wikipedia page for this

Answer:

I think it’s Taiwan

Explanation:

Which source of information about candidates for state senator would likely be free of bias? A) a blog written by a political campaign worker B) a newspaper editorial giving the editorial board's position C) a full-text transcript of the most recent candidate debate

Answers

Answer:

B) A newspaper editorial giving the editorial board's position

Explanation:

I hope this helped. I am truly sorry if you get this wrong. Have a good day?

Free of bias liberated from all bias and partiality. The source of information that needs to be free is the information in the newspaper editorial.

What does free of bias mean?

Free of bias means being liberated from all bias and partiality, famously fair a fair-minded assessment.

Source of information about Candidates for state senator that should be free of bias means a newspaper editorial giving the editorial board's position.

Therefore option B aptly describes the free of bias stand.

Learn more about free of bias here:

https://brainly.com/question/1022640

key figures in art, architecture, and literature during the Middle Age

Answers

Answer

Western roman middle empire in 476 to approximately 1500.

Explanation:Agriculture in middle ages describe the farming society,technology,crops and agriculture society and economy.The middle ages are also divided into the early, high,and late middle ages.  The middle ages in western Europe became more focused on self- sufficiency. Barley and wheat the most important crops in the most European regions.

what is the most populated birthday month in the world?

Answers

Answer:

August or September

Explanation:

Your welcome bestie

Answer:

september

Explanation:


The rise in fascism is during the 1930s was due in large part to:
A.religious conflict
B.economic problems.
C.resistance to authoritarian monarchies.
D. excitement in the countries that won World War I.

Answers

Answer:

B.economic problems.

Explanation:

Fascism is a political ideology that propagates for a strong authoritative power that controls the people and national interests completely by a totalitarian government. In the 20th century, fascism was introduced by Benito Mussolini of Italy which later became prominent in countries like Germany and Japan. One of the major reason why fascism emerged in the 1930's was due to economic problems brought about by the Great Depression.

What events were part of the "Saturday Night Massacre”? Select three options. Archibald Cox resigned. President Nixon resigned. The attorney general resigned. President Nixon fired Archibald Cox. The attorney general refused to fire Archibald Cox.

Answers

Answer:

1. The attorney general resigned.

2. The attorney general refused to fire Archibald Cox.

3.  President Nixon fired Archibald Cox

Explanation:

The Saturday Night Massacre had to do with the different events that occurred on the evening of Saturday, October 20th, 1973 during the Watergate scandal involving President Richard Nixon who accepted the resignation of the Attorney General when he refused to fire Special Prosecutor Archibald Cox. The same thing happened when he ordered the Deputy Attorney General to fire Archibald Cox but he refused and resigned.

Finally, President Nixon got his wish and fired Cox when he got the third-most-senior official at the Justice Department, Solicitor General Robert Bork, to fire Cox. Impeachment proceedings began against President Nixon ten days after as his actions were unpopular and damaging.

Answer:

A,D,E

Explanation:

Was government aid enough to help Americans during the Great Depression?

Answers

Answer:

Yes And No

Explanation:

Well as you might know FDR set up many programs that helped the American people But you also had unions and Etc and also WW2

Which of the following resulted from the technological advances in newspaper publications in the 1830s? Newspaper advertising generated a lot of revenue. The field of journalism collapsed. Newspapers became more partisan. More than one-third of all newspaper employees were women.

Answers

Answer:

Newspaper advertising generated a lot of revenue.

Hope this helps.....

HELP!!! President Theodore Roosevelt's environmental agenda included which of the
following?
O A. Government management of public lands and waters
B. Protection for endangered species such as the buffalo
O C. Voluntary efforts to reduce energy and resource usage
D. An end to strip-mining and the pollution of rivers

Answers

Answer:C.

Explanation:

Roosevelt was big on conserving energy and natural resources

C, voluntary efforts to reduce energy and resource usage
Other Questions
Can someone help me with this one too John's lyrics are somewhat autobiographical and introspective on this '65 song that features brilliant harmonies throughout and lyrics that offer help to the forlorn listener. It is... Which two statements best describes the purpose of the passage ? please Evaluate ( 8/3) to the 2 power A). 8/9 B). 64/9 C). 64/3 D). 55 Line CD passes through points (0, 2) and (4, 6). Which equation represents line CD? Which of the following was true when Truman met Stalin in Potsdam in 1945? A.Their two nations were already enemies The war in the Pacific was still being fought. Britain had decided not to join them. World War II had ended. Please Help asap!!! Please give explanation If the price of biscuit per packet increased from N250 to N500 and the quantity bought per week decreased from 300 to 200 packets, determine the elasticity of demand for biscuit. Please answer this correctly without making mistakes What is the slope of the line passing through the points (6,7) and (1,5) An education researcher claims that 58% of college students work year-round. In a random sample of 400 college students, 232 say they work year-round. At alphaequals0.01, is there enough evidence to reject the researcher's claim? Complete parts (a) through (e) below. It is a well-known fact that Dr. Barnes rides a skateboard, sometimes even on campus. Suppose that Dr. Barnes selects a skateboard by first picking one of two skateboard shops at random and selecting a skateboard from that shop at random. The first shop contains two "rad" skateboards and three "gnarly" skateboards, and the second shop contains four "rad" skateboards and one "gnarly" skateboard. What is the probability that Dr. Barnes picked a skateboard from the first shop if he has selected a "gnarly" skateboard? What the answer to the question If a circle has a diameter with endpoints of (-3, 0) and (5, 4) then the equation of the circle is? Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code. B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein. C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein. D) Both B and C are possible outcomes. g A spontaneous process is one in which: A. releases a large amount of heat B. may happen (is possible) C. will rapidly approach equilibrium D. will happen quickly Based on the function F(x) = x^4 - 3x^3+ x^2 +2 and the graph of G(X) below,which of the following statements is true? The goal of a statement of purpose is: 62(1+2) isn't that should be 1 , cause in the calculator it said 9 but the order is the parenthisis/brakets first ?? so it should be like 2 times 3 then 66 which gives 1 . Which of the following pitches is a non-chord tone for the I chord in G major? - G - B - A - D