Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC
A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code.
B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein.
C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein.
D) Both B and C are possible outcomes.

Answers

Answer 1

Answer:

Option A

Explanation:

DNA sequence: GTCACCGGTCTATACATAAGC.

If the bases of codon 5 under a mutation of C to T, the outcome would be?

Bases of the sense codon 5 is TAC, since codons of the sense strand is the same as that of the mRNA except with the replacement of uracil in place of thymine. This codon TAC codes for tyrosine.

If a mutation occurs changing C to T, then the bases would be TAT coding also for tyrosine too due to the nature of redundancy of the genetic code. Thus, there would be no change to the protein sequence although a change would occur in the DNA sequence.

Redundancy of the genetic code indicate that more than one codon can code for an amino acid as there are 64 codons and 20 amino acids.


Related Questions

The___is the fluid component of blood.

Answers

Answer:

It is plasma

Explanation:

Plasma is the fluid component of blood

Plasma, a combination of water, sugar, fat, protein, and salts, is the term for the liquid portion of blood.

What is Blood?

Blood is a bodily fluid found in the circulatory systems of humans and other animals that carries metabolic byproducts away from the cells as well as vital nutrients and oxygen to the cells.

Plasma, blood cells, and platelets are the main components of blood, which is a fluid made up of connective tissue. It moves throughout our body, supplying different cells and tissues with nutrition and oxygen. 8% of our total weight is made up of it. A typical adult has between 5 and 6 litres of blood. Red blood cells, white blood cells, platelets, and plasma are all components of the fluid connective tissue known as blood.

Therefore, Plasma, a combination of water, sugar, fat, protein, and salts, is the term for the liquid portion of blood.

Learn more about Blood, here:

https://brainly.com/question/30780217

#SPJ5

How did the research presented in the article affect scientists’ understanding of the evolution of eukaryotes.

Answers

Answer:

Archaea and eukaryotes are very closely related than bacteria and eukaryotes. because both archaea and bacteria responsible for the formation of more complex cells

Explanation:

It has been believed for many years that archaea and eukaryotic cells are genetically related to a developmental process that involves the production of eukaryotic cells by archaea development. At the same time, scientists believe that archaea have more to do with eukaryotic cells than bacteria. This is because research shows that bacteria are also closely related to eukaryotic cells, meaning that along with archaea, bacteria are part of the evolutionary process that makes up these cells.

Loyeulis,
iv. All of these
b) What do seeds need to grow into new plants?
1. Air
ii. Water
iii. Right amount of warmth
c) Potatoes grow from
iv. leaves.​

Answers

Answer:  air , water , right amount of warmth

Explanation:

In most mammals, the embryo obtains food substances from the mother via the
O Yolk
O Amnion
O Placenta
Uterus​

Answers

Explanation:

it is through the placenta.

it also protects the embryo from harmful substances

its through the placenta

A 26-week-old baby was brought to the pediatric clinic because of increasing lethargy and cyanosis. The infant has been in good health at birth, and the mother had attempted breast-feeding. A blood sample was collected and a positive test for methemoglobinemia was obtained. The baby then was treated with intravenous ascorbate and methylene blue. Within 2 days the child was alert, and the cyanosis had disappeared. It is known that methemoglobin has absorption spectra maxima at 500 nm and 631 nm.

Answer the following questions:

a. What is the chemical difference between hemoglobin and methemoglobin, and how do their oxygen capacities compare?
b. How do you analyze the sample blood to detect methemoglobin?
c. What is the cause of the cyanosis associated with toxic methemoglobinemia?
d. What is the biochemical basis for treatment of toxic methemoglobinemia with ascorbate and methylene blue?

Answers

Answer:

a,

This is due to differences in the oxidation states of  Fe. atoms present in the two protein pigments.

Generally,the Fe2+ atom in the heme groups is responsible for the  oxygen carrying capacities of haemoglobin in RBC.However,in +2 state that Fe carry oxygen through cooperative binding in the blood.When methemoglobin is formed the Fe exits in +3,and therefore can not bind oxygen. Methemoglobin is a mettaloprotein of Fe3+ states. It results from the oxidation of  Fe atoms in Hb from Fe2+ to Fe3+ states,during exposure to certain medications,and some nitrate,certain  dyes and some compounds.

This can be conducted with CO-oximeter.This is a device used to measure the blood  percentage oxygen saturation levels.It conduct this by measuring the oxygen carrying capacity of haemoglobin in a blood sample. Since oxygen saturation levels of a blood sample depends on the amount of Hb,therefore by passing some wavelengths of light across the blood samples,The more the wavelength of lights absorbed by the blood samples, the more the percentage saturation of the blood sample with oxygen,and therefore the oxygen carrying capacity of the blood,thus more Hb.

Hence, if the blood sample absorbs  wavelength of light in the range of (500 nm and 631 nm.) it shows that little Hb is present in the blood samples,and the blood should contain Methemoglobin of Fe3+ and not Hb.

Methemoglobinemia is  a condition in which methmoglobin concentration of the blood rises,due to the higher percentage of Hb,with F3+( of poor oxygen carrying capacity or uncoupling ) compare to normal F2+ for carrying oxygen. Since these can not transport oxygen,Cyanosis results as the baby turns blue,with lack of oxygen.

Since the rise in the concentration of methmoglobin is the major cause of this condition,reduction of it concentration is the primary step.Therefore, the Methylene blue role is to reduce the amount  of  methmoglobin by enzyme NADPH-methemoglobin reductase.This occurs with 10-60mints after administration.Thus the concentration of these pigment is reduced,likewise its toxic levels.

Ascorbate can also be used,however a lot of doses is required for this to have a significant effects,and compare to Methylene blue it is less effective.,

Explanation

Fur color in mice is affected by a gene with two alleles. The B allele causes dark brown fur and is completely dominant over the b allele that causes light brown fur. What is the fur color of a mouse with the genotype, Bb

Answers

Answer:

Since this is heterozygote dominant state(Bb), and B allele is dominant over the b allele brown(b) ,hence the fur color must belong to the dominant allele which is dark brown.

Explanation:

Generally a dominant gene is the type that manifest itself from generations to generation irrespective of the presence of the recessive gene.

If there are two allele for fur colors (dark and light brown)

Therefore B(Dark brown) is a dominant allele,assuming with genotype BB.

while the recessive light brown (bb)

Therefore if the F1 generation is crossed the offspring are

Bb,Bb,Bb,Bb. These are hetero zygote dominants

Therefore the phenotype is dark brown.

In Complete dominance, the dominant allele masks the expression of the recessive allele. Heter0zyg0us individuals, carrying both alleles, only express the dominant phenotype. The fur color of a Bb mouse is dark brown.

-------------------------------------------

Available data:

A diallic gene codes for fur colorB allele is dominant and codes for dark brownb allele is recessive and codes for light brownB allele is completely dominant over the b allele

The hint to answer this question is that The B allele causes dark brown fur and is completely dominant over the b allele. This sentence suggest that complete dominance is going on.

Complete dominance

When the dominant allele completely masks the recessive allele, we talk about complete dominance.

This is the case of individuals that are heter0zyg0us for a particular gene and express the dominant phenotype.

The dominant allele is hiding the expression of the recessive allele.

Many genes show complete dominance.

The mouse with the heter0zyg0us genotype Bb is carrying both alleles. However, the dominant allele B hides the expression of the recessive allele b.

This mouse expresses the dominant phenotyope dark brown.

-----------------------------------------------------------

Related link: https://brainly.com/question/20399807?referrer=searchResults

                   

Produces proteins
What produces protein

Answers

Answer:

There are  two organelles that produce proteins

The endoplasmic reticulum The  ribosomes.

Explanation:

Answer:

ribosomes

Explanation:

D

2.
When there is more water outside a cell than inside a cell, water will
O move into the cell causing it to shrink
O move into the cell causing it to expand
move out of the cell causing it to shrink
move out of the cell causing it to expand

Answers

Answer:

I'm pretty sure it is: move into the cell causing it to expand

Explanation:


Yes it is move into the cell causing it to expand!!!

Help can you pls number 2 to 4​

Answers

Answer:

Hey there!

1. Load

2. Broom

3. Flagpole

Hope this helps :)

Based on your knowledge of the genetic tools for studying baker's yeast, how would you clone the genes that are mutated in your respective yeast strains?

Answers

Answer:

By using specific primers for PCR amplification and DNA sequencing

Explanation:

In molecular biology, different techniques are used to clone the full sequence of desired genes. In general, gene cloning is based on the assembly of genetically engineered recombinant DNA cloning vectors into host organisms. The cloning procedure generally consists of isolating target DNA sequences to be cloned, ligation into a corresponding vector, transfection and screening of clones. The recombinant DNA is first amplified by PCR. Subsequently, DNA is sequenced and finally assembled by bioinformatic methods in order to characterize the full sequence of the gene.

How do plants get the nitrogen they need?

A.
From bacteria living in their roots

B.
From the air

C.
Directly from the soil

D.
Through photosynthesis

Answers

the answer is C. because active transport happens at roots
The answer is Directly from the soil

ABO blood typing uses 3 alleles. From your course notes answer the following two questions: Which two are dominant? _________ Write the two dominant allele genotypes, using the capital letter I, and then a superscript for each of them. __

Answers

Answer and Explanation:

Given that the ABO blood typing uses 3 alleles

The blood type of ABO could find out by considering three different alleles i.e [tex]I^{A}, I^{B}\ and \ i[/tex]

where,

[tex]I^{A}\ and\ I^{B}[/tex] = co-dominant

i = recessive

The dominant allele genotypes are as follows

For type A =  [tex]I^{A} I^{A}/ I^{A}\ i[/tex]

For type B =  [tex]I^{B} I^{B}/ I^{B}\ i[/tex]

For type AB =  [tex]I^{A} I^{B}[/tex]

Therefore the above two are dominants and the same is to be considered

Anemia includes: a. A lack of WBCs b. A lack of Hgb c. Numerous amounts of RBCs d. Numerous amounts of WBCs

Answers

Anemia is a lack of hemoglobin(Hgb). The name is derived from latin (a- meaning lack of)  (emia-means red)


With the aid of a sketch. Describe foetal circulation

Answers

Answer:

In animals that give live birth, the fetal circulation is the circulatory system of a fetus. The term usually encompasses the entire fetoplacental circulation, which includes the umbilical cord and the blood vessels within the placenta that carry fetal blood.

Blood flow in the unborn baby follows this pathway: Oxygen and nutrients from the mother's blood are transferred across the placenta to the fetus through the umbilical cord. This enriched blood flows through the umbilical vein toward the baby's liver. There it moves through a shunt called the ductus venosus

PLEASE HELP ME ASAP BECAUSE IT IS DIFFICULT TO UNDERSTAND. Explain it for me.

Answers

Answer:

C.

Explanation:

For mRNA strands, there are four letters used in their code. A (adenine), U (Uracil), G (guanine), and C (cytosine.)

For RNA, it is the same, but the Uracil is replaced with Thymine (T).

A always pairs with U.

G always pairs with C.

YOUR QUESTION:

The scientist's strand code is has to convert the Thymine to Uracil since it is RNA instead of mRNA.

Hopefully this somewhat helped :)

Jayden is raised in a culture where girls are not expected to like math or do well at math. Jayden therefore rarely studies for tests and in middle school, her test scores begin to drop below the average. In high school, she ends up taking the lower-level math courses. Which theoretical concept does this example illustrate? A. cognitive dissonance B. the self-fulfilling prophecy C. the actor-observer discrepancy D. the fundamental attribution error

Answers

Answer:

THE SELF FULLFILLING PROPHECY

Explanation:

BRAINLIEST PLS

Why is it important to classify the millions of species on Earth? to have common names that everyone can remember to more easily sequence their genetic material to devise scientific names that only scientists can learn to organize them and speak about them accurately

Answers

Answer:

to organize them and speak about them accurately.

Explanation:

organisms are classified to understand the relationships between all living things.

Answer:

D

Explanation:

Via the mother's cardiovascular system and the ________ , the respiratory system supplies oxygen to and removes carbon dioxide from the blood of a developing fetus.

Answers

Answer:

The mother's cardiovascular system and the placenta.

Explanation:

Babies receive their oxygen and get rid of the carbon dioxide with the help of both the cardiovascular system of the mother and the placenta. The gases dissolve through the placenta and then gets exchanged in the cardiovascular system of the mother. So the answer is the mother's cardiovascular system and the placenta.

I hope this answer helps.

At low frequencies during DNA replication, an extra nucleotide maybe inserted into the DNA strand. If this occurs within a gene, what would be the effect on the protein product

Answers

Answer:

1. It could result in a loss of function of the protein product

2. It could result in a protein product with excessive activity

3. It could result in altered structure of the protein

Explanation:

Any changes that occur in the nucleotide sequence in the DNA of an organism is known as a mutation. Various forms of mutation can occur in the DNA sequence of an organism which could be as a result of insertion or deletion of a nucleotide in the DNA sequence.

Insertion of an extra nucleotide into a DNA strand within a gene could have any of the following effects on the protein protein;

1. It could result in a loss of function of the protein product of the gene whereby the protein can no longer carry out its normal functions

2. It could result in a protein product with excessive activity other the normal range at which it functions.

3. It could result in altered structure of the protein either in the primary, secondary, tertiary, or quaternary structure

You observed many sand hill cranes on your walk. Two sand hill cranes flapped their wings and hopped up and down when you walked on the path near where their bright orange baby stood. You observed a(n) _______________.

Answers

Answer:

This question lacks options, the options are:

A) symbiosis

B) ecosystem

C) community

D) population

E) biosphere

The answer is D) Population

Explanation:

Living organisms in an ecosystem are usually found in numbers living together in a given area. This is termed POPULATION in ecology. A population refers to the group of living organisms that belongs to the same species living together in the same habitat and have the ability to interbreed i.e. mate and reproduce with one another.

This is the case in this question where many sandhill cranes (large flying birds) were observed in a particular area, which represented their habitat. Asides the group of sandhill cranes living together, they were also observed to be interbreeding. This was evident in the observation of two sandhill cranes hopping up and down around their bright orange baby. This shows that members of the population are capable of mating and reproducing fertile offsprings.

This observation completes what a POPULATION is all about, hence, a population was observed.

g The Electron Transport Complex (ETC) consists of four proteins. How many of these proteins directly contribute to the proton gradient by moving protons across the membrane?

Answers

Answer:

Three proteins directly contribute to the proton gradient by moving protons across the membrane

Explanation:

The Electron transport chain is a group of proteins and molecules incrusted in the internal mitochondrial membrane and organized into four complexes, I, II, III, and IV. These complexes contain the electron transporters and the enzymes necessary to catalyze the electron transference from one complex to the other. Complex I contains the flavine mononucleotide -FMN- that receives electrons from the NADH. The coenzyme Q, located in the lipidic interior of the membrane, conducts electrons from complex I and II to complex III. The complex III contains cytochrome b, from where electrons go to cytochrome c, which is a peripheric membrane protein. Electrons travel from cytochrome c to cytochromes a and a3, located in the complex IV. Finally, they go back to the matrix, where they combine to H+ ions and oxygen, to form the water molecule. As electrons are transported through the chain, protons are bombed through three proteinic complexes from the matrix to the intermembrane space. These are complexes I, III and IV.  

Merlin’s paper discusses two types of data: artifactual and paleoethnobotanical. Give specific examples of each and describe the sources of data and the type of information you can gain.

Answers

Answer:

Merlin's paper discusses two types of data: artifactual and paleoethnobotanical. Give specific examples of each and describe the sources of data and the ...

Albumin is a protein found in blood that helps to regulate amount of fluids in the body. What is the main function of albumin?

to provide structure
to fight disease
to maintain homeostasis
to regulate cell reactions

Answers

Answer: c.) to maintain homeostasis

Explanation: you're welcome!! cx

Answer:

C

Explanation:

Edge2020 quiz

Many of the quantitative methods discussed are popular because they enable the microbiology researcher to selectively count live cells only. Why do you think this might be an important or desirable feature in a medical or environmental research situation? Provide a scenario in which it might not be important to differentiate between live and dead cells when counting cell numbers.

Answers

Answer:

to count cancer cells killed during chemotherapy

Explanation:

There are different methods for counting live cells and they include, among others, counting chambers (e.g., a hemocytometer), image analysis, flow cytometry, spectrophotometric techniques, impedance detection, etc. These laboratory techniques can be used to detect both live and dead cells. In flow cytometry, for instance, it is possible to detect death cells by analyzing the loss of membrane integrity, which is an indicator of death. However, in certain situations, is not required to differentiate between live and dead cells, and thus it is only required to know the number of cells that a sample contains (for example, for counting the number of immortalized cells cultured over several generations).

Answer:

b

Explanation:

edge 2021 :p

Mendel crossed two plants that were heterozygous for the trait of flower color. Which genotypes could he have used to represent the cross?
PP ´ PP
Pp ´ Pp
pp ´ pp
Pp ´ PP

Answers

heterozygous means it is not the same gene expression

so both are

Pp'Pp

the second one

The genotypes that he could have used to represent the cross between two heterozygous individuals is: Pp ´ Pp

WHAT IS HETEROZYGOUS CROSS:Heterozygous cross is a cross between two individuals in which the genotype of both contains different alleles of a gene.

According to this question, Mendel crossed two plants that were heterozygous for the trait of flower color. The alleles of flower color are P (purple) and p (white).

This means that a heterozygous genotype will be Pp.

Therefore, the genotypes that he could have used to represent the cross between two heterozygous individuals is: Pp ´ Pp

Learn more about heterozygous at: https://brainly.com/question/13050360

Match each of the following descriptions with the correct term:

a. Located on presynaptic membrane
b. Space between two neurons
c. Contains neurotransmitters
d. Located on postsynaptic membrane
e. Bulbous ending of axon
f. Chemical messenger

1. synaptic cleft
2. neurotransmitter
3. synaptic vesicle
4. receptor
5.axon terminal
6. calcium channel

Answers

Answer

a-6

b-1

c-3

d-4

e=5

f-2

Explanation:

The sequence shows synaptic transmission across  

The arrival of action potential at the presynaptic neuron,prompted the influx of calcium ions on the presynaptic membrane to the axoplasm.

This leads to the fusion of the  synaptic vessels with the post synaptic membrane,These empty their contents of neurotransmitters into the synaptic cleft.

The neurotransmitter e.g acetycholine  crosses the cleft to bind with the receptors on the postsynaptic membrane,

The leads to the opening of ligand gated sodium channels which leads to the transmission of the action potential as Post Synaptic Potentials.

This is transmitted along the axon of the postsynaptic neuron,as post synaptic potential which can either be excitatory or inhibitory

The uterine cycle describes the cyclic changes of thickening and degeneration that the endometrium goes through in a month. What is the order of events in one uterine cycle

Answers

Answer:

During the uterine month there are different phases through which the uterus passes, these phases are regulated by hormones and are responsible for producing the cycle necessary for fertilization.

Phase where menstruation occurs: This phase only happens if the woman was not fertilized and did not develop the diploid cell together with a sperm, since not being fertilized, all the uterine preparation that had been planned in the body for fertilization will be released as that we know "menstruation", in this phase estrogens and progesterone are low. The inner walls of the unfertilized uterus are released.

Follicular phase, in the follicular phase the ovaries prepare to release an egg and estrogen begins to rise. (From the first day of the period until ovulation)

Proliferative phase, in the proliferative phase, new vessels proliferate and the outermost layer of the uterus prepares itself for possible fertilization, is where spiral arterioles can begin to form again in the external cut of the myometrium.

Ovulation, here is where the mature ovum is called Graff's follicle, at this time estrogen reaches its peak and then descends.

Luteal phase, in the luteal phase the production of the luteal body is generated, at this stage progesterone takes center stage, and it is the range between ovulation and menstruation (if not fertilized)

Last phase, secret phase, in this phase there are two possible ends, if the woman is fertilized, the egg cell implants and begins the development of the embryo and if it is not fertilized, the entire external cut of the myometrium is prepared to be secreted.

Explanation:

A very important fact to clarify is that women are born with a quantity of ovules that at the end of this uterine cycle ceases to exist, this process is what we know as menopause.

That is to say that women have a quantity of ovules that will one day run out, and the body releases them from the menarche or the first menstruation, generating that in each released ovule a uterine cycle is completed, the day they end the woman will have reached menopause and would have no chance of being fertilized or completing the uterine cycle.

superficial layer of the endometrium is shed

basal layer of endometrium grows, forms gland and blood vessels

enriched endometrial blood supply

endometrial glands secrete nutrients into uterus

Explain three ways in which the human
sperm cell is adapted to its function.​

Answers

1) Sperm cell is adapted to its function by carrying genetic information to an egg.

2) It has a stream lined body that allows it to move quickly.

3) They also contain large number of mitochondria in the mid region, so it is able to produce a lot of energy in order to operate tail


What is produced when cells differentiate?

•proteins

•hormones

•uniform cells

•specialized cells

Answers

Answer:

specialized cells

Explanation:

i believe is the answer

Even though cannabis use is legal in some states, it may not be allowed on a college campus in those states because:

Answers

Answer: well you can consider half of the college campus population as underage. So the distribution to monitors would be easier. Making it illegal is just easier

Explanation:

Other Questions
A marine biologist discovers a new marine animal that has a coelom, but it does not develop from the mesodermal tissues. Under which category should she classify this animal? A. pseudocoelomate B. acoelomate C. coelomate first correct answer gets best marks The following data have been recorded for recently completed Job 450 on its job cost sheet. Direct materials cost was $2,108. A total of 36 direct labor-hours and 234 machine-hours were worked on the job. The direct labor wage rate is $18 per labor-hour. The Corporation applies manufacturing overhead on the basis of machine-hours. The predetermined overhead rate is $25 per machine-hour. The total cost for the job on its job cost sheet would be: Which of the following describes a difference between France just after the French Revolution and after Napolon's rise to power? A. Just after the Revolution, France had a representative form of government. After Napolon rose to power, he became emperor. B. Just after the Revolution, France practiced religious tolerance. After Napolon rose to power, he required that all French people become Catholics. C. Just after the Revolution, France was divided into three estates. After Napolon rose to power, he abolished all estates. Solve this inequality. -9x - 3 > 51 A. x -392 C. x -6 Sixty percent of adults have looked at their credit score in the past six months. If you select 31 customers, what is the probability that at least 20 of them have looked at their score in the past six months CHEGG If you invest $200 in a stock, borrowing 90 percent of the $200 at 10 percent interest, and the stock price rises by 20 percent, what is the return on your investment The graph below shows a line of best fit for data collected on the number of students who wear a jacket to school and the average daily temperature in degrees Fahrenheit. Based on the line of best fit, how many students wear a jacket to school when the temperature is 50F? A.) 240 B.) 210 C.) 300 D.) 180 Peter's wife Jenny was recently diagnosed with liver cancer. Peter is shocked by the diagnosis and insists that Jenny seek a third, and even fourth, opinion from other doctors. Which of the following Kbler-Ross stages of grief best describes Peter at this time? a) denial b) anger c) bargaining d) depression order the following values from least to greatest: 22.4, -28, 27, -17 the efficiency of a carnot cycle is 1/6.If on reducing the temperature of the sink 75 degrees celcius ,the efficiency becomes 1/3,determine he initial and final temperatures between which the cycle is working. how do I simplify this (sinx)/(secx+1) how to pull out faster In what situation is it important to use academic language? Can genocide be justified? Use Just War Theory to explain. As frases a seguir estao no modo imperativo negativo transcreva-as para o modo imperativo afirativo Select the correct answer. Read the excerpt from The Pobble Who Has No Toes by Edward Lear. What is the rhyme scheme? The Pobble who has no toes Swam across the Bristol Channel; But before he set out he wrapped his nose In a piece of scarlet flannel. For his Aunt Jobiska said "No harm Can come to his toes if his nose is warm; And it's perfectly known that a Pobble's toes Are safe,provided he minds his nose!" A. abcb efgf B. abbc dede C. abab ccdd D. abbc deed Let v1 = -4-1-2 v2 = -3 1-2v3= 1-5 2and H = Span{v1,v2,v3} . Note that v3 = 2v1 - 3v2. Which of the following sets form a basis for the subspace H, i.e., which sets form an efficient spanning set containing no unnecessary vectors? a. {V1, V2, V3}b. {V1, V2}c. {V1,V3}d. {V2,V3} Khalils friend stole money and is pressuring him not to report it. Khalil realizes that his choices are to turn his friend in or keep quiet.What is the next step in his decision-making process?Go to the guidance counselor and report the theft.Decide to report the theft to the guidance counselor.Think about how his decision to report affected his friend.Consider the consequences of reporting or remaining silent.\ In a fiftness class, there was a warm up of 14 press-ups. Anyone unable to do 14 or more recives a punishment. Jessica can do 10 press-ups without ever failing, however, the chances of her successfully doing each subsequent press-up halves. Whats the probality of her receiving a punishment? A. 1 in 8 B. 1 in 1024 C. 15 in 16 D. 1023 in 1024