What did congress pass in 1988 as a form of apology to the surviving victims of internment camp

Answers

Answer 1

Answer:

The Civil Liberties Act of 1988.

Explanation:

During the Second World War, the United States government incarcerated more than 100,000 Japanese-Americans in America. This was done after Japan was on the enemy side of the war which led to the administration taking precautions from having any Japanese spy in America.

The Civil Liberties Act of 1988 was a form of presidential apology that accepted and claim responsibility for the injustice and discriminatory act of keeping the Japanese- American people in 'captivity' within barbed wires, akin to the concentration camps during the German discrimination of the Jews. Congress passed the Act as a formal apology to the Japanese-American community and also provided $20,000 as compensation to each surviving victim of the incarceration.


Related Questions

I was wondering if anyone can answer my question about high school unofficial and official transcripts. i was wondering if you have bad grades on your unofficial transcript but throught the year you recovered all of your bad grades to where your lowest is a C- will those bad grades still appear on a official transcript?

Answers

Answer:

yes

Explanation:

your transcript never changes

Answer:

yes

Explanation:

Why were early American industries located near water? please help!

Answers

Answer:

they were located near the water due to two main teasons.

Explanation:

firstly to let the waste of industries into the water.secondly most of the resources required water in large quanties.

During World War II, African-Americans: Group of answer choices experienced full equality before the law. witnessed the end of Jim Crow laws. served in integrated units in the armed forces. received equal access to the GI Bill of Rights benefits. witnessed the birth of the modern civil rights movement.

Answers

Answer:

Option:  witnessed the birth of the modern civil rights movement.

Explanation:  

The experiences in World War II lead African American to show their support in America and abroad as soldiers. The events of World War II ushered in a new era of civil rights movements. The civil rights organizations campaigned for African-American rights and challenged Jim Crow laws. World War II led to bring racial reform by removing injustice towards them and discrimination. The civil rights movement helped African American to gain their rights in America in the 1950s and 1960s.

France under Napoleon's rule might be best characterized as a:
Roman-style republic.
Greek-style democracy.
enlightened dictatorship.
reign of terror.

Answers

Answer:

Dictatorship

Explanation: he made every decision himself, he puts himself at a higher class than everyone else,and he manipulate the French citizens, and caused mass war with other countries in the Europe to expand his empire.

The belief that spirits inhabit natural objects in the world around us is known as

Answers

Answer:

The belief that spirits inhabit natural objects in the world around us is known as Animism.

Explanation:

Answer:

animism

Explanation:

Many young Cuban-American believe sanctions should be lifted. What information influences their opinion? A. That sanctions were making cuba prosperous B. That sanctions were not changing were not changing the Cuban government C. That the people of Cuba still wanted sanctions D. That the people of the United States were afraid of sanctions

Answers

Answer:

Option B

Explanation:

Many young Cuban-American believe sanctions should be lifted because that sanctions were not changing the Cuban government and they wanted the Cuban government to be changed.

Answer:

Option B

Explanation:

The young Cuban-Americans wanted the sanctions to be lifted because the sanctions were not changing the Cuban government. That is the information that influenced their opinion. The young Cuban-Americans wanted the Cuban government to be changed.

Which of the following contributed to the failure of Prohibition?

Answers

Answer:

Organized crime controlled illegal alcohol production

Explanation:

Crime connected with illegal alcohol production and sale became a major issue, so that even many people who had originally supported Prohibition decided that it needed to be repealed

Mobutu Sese Seko sought to remove European influence in the Congo? by forbidding traditional African names. eliminating all European names. stopping the sale of European products. preventing Congolese from traveling to Europe.

Answers

Answer: He tried to Africanize names by eliminating European names.

Mobutu Sese Seko sought to remove the European influence in the African societies such as Congo by the process of eliminating all the European names that existed in the society. Therefore, the option B holds true.

What is the significance of Mobutu Sese Seko?

Mobutu Sese Seko is highly remembered as the former president of the Democratic Republic of Congo. He held the position as the president of the Democratic Republic of Congo for a term that lasted over three decades between 1965 and 1997.

After the end of the European colonialism in the region, he sought to end the European influence in the Congolese society by leading an event of removal and elimination of all the European names that people held in the society as such.

Therefore, the option B holds true regarding the significance of Mobutu Sese Seko.

Learn more about Mobutu Sese Seko here:

https://brainly.com/question/8993726

#SPJ2

How did détente affect relations between the Soviet Union and the United States?

Answers

Answer:

Détente was the phase from 1967 to 1979 when Cold War tensions between the US and the Soviet Union were easing.

Explanation:

The period was marked by expanded trade and collaboration with the Soviet Union and the concerning the  Strategic Arms Limitation Talks. Nixon proclaimed his administration period to be an era of negotiations and after visiting China in 1972 he flew to Moscow, where he met with the Soviet leaders to ease out the tension between the two world powers. They addressed topics such as arms control, nuclear war prevention, and expanded trade between the two nations.

How did the Second Great Awakening contribute to westward expansion?
1)Americans were forced to leave states on the Atlantic coast because of religious fighting.
2)Americans felt like they should separate themselves from modern life in the East.
3)Americans wanted to establish Catholic missions throughout the West. 4)Americans believed they had a religious purpose to spread over the entire continent.

Answers

Answer:

Correct Answer:

4) Americans believed they had a religious purpose to spread over the entire continent.

Explanation:

The Second Great Awakening was a Protestant religious revival during the early 19th century which spread throughout the United States. The revival began in early 1800's among the Presbyterians, Methodists and Baptists. This brought comfort in the face of uncertainty as a result of the socio-political changes in America.

Also, New religious movements emerged during the Second Great Awakening, such as Adventism, Dispensationalism, and the Latter Day Saint movement which spread from America to other parts of the world.

what was south africa like after european colonization?

Answers

Answer:

cape town was banned from slavery and not all african society where affected

Explanation:

Answer:

After European colonization, South Africa's period of slavery had begun. South Africa faced Slavery, colonial intrusion and forced labour. They were forced to do work as slaves and labourers.

what were the changes and development made by British when they shifted their capital from calcutta to delhi?

Answers

Answer:

HI THERE

Explanation:

Why was India's capital shifted from Calcutta to Delhi? ... The capital was shifted from Calcutta as Delhi was the financial and political seat of many earlier empires and was located closer to the geographical center of India. The rising nationalist movement in Calcutta was also responsible for the shift.

PLS MARK ME THE BRAINLIEST

Why is Wikipedia an unreliable source?

Answers

Answer:

Anyone can edit Wikipedia pages

Explanation:

what were the effects of rapid industrialisation in Russia​

Answers

Answer:

The effects of rapid industrialisation in Russia are: Rapid influx of population in the cities of Russia, lack of venture capitalists, low labor productivity, The domestic markets were overwhelmed because of mostly poor population.

Explanation:

The economy of Russian had an increase between the years 1890 and  1910, due to exports of natural resources and the expansion of the Trans-Siberian Railway. This railways expansion helped to increase the output of coal in southern Russian.

The effects, this rapid industrialization brought included the influx of populations in the cities of Russian and this cities were unable to accommodate the growing population. for instance the workers in this cities faced low standard of living because of little wage and long hours at work.

There were also little technological advancement because of the past history of serfdom in Russia. hence Russia relied on other countries for machinery.

Plz answer fast I will mark u as brainlest

Answers

Answer:

1st blank :Dadabhai Naoroji

3rd  blank : King George V and Queen Mary

4th blank : false

Dadabhai naorji
King George V & Queen Mary
True I think but I’m not sure

3. Boards and Commissions do all of the following EXCEPT
A) work collaboratively with government officials
B) oversee public institutions
C) enforce local city and county laws
D) establish policy

Answers

Answer:

C) Enforce local city and county laws

Explanation:

A lot of people on boards and commissions are volunteers with other jobs. They mainly work on policy. Legally, they cannot be law enforcers unless their day job is policing or something of the sorts.

How did WW II come to an end in Europe and the Pacific

Answers

Answer:

Unsourced material may be challenged and removed. The end of World War II in Asia occurred on 2 September 1945, when armed forces of the Empire of Japan surrendered to the forces of the Allies. The surrender came almost four months after the surrender of the Axis forces in Europe and brought an end to World War II.

Explanation:

Answer:

The United States dropped atomic bombs on Hiroshima and Nagasaki in early Aug. 1945, causing Japan a week later to surrender and sign a peace treaty (by  Minister Shigemitsu) with the United States. That ended WWII in the pacific. For Europe, people whom represented the Allied high command approved and accepted the surrender of Nazi Germany

Explanation:

What new colonies were created in the “great land grab” initiated by King Charles II

Answers

Answer:

colonies

Explanation:

colonies

Which is a feature of an ideal ruler in Confucianism? exercising absolute power taxing peasants heavily setting a moral example ruling by popular vote

Answers

Answer:

Setting a moral example.

Explanation:

Place the following events in correct chronological order, from earliest to latest: A. Japan invades Manchuria, Tripartite Pact signed, US Oil embargo B. US Oil embargo, Japan invades Manchuria, Tripartite Pact signed C. Japan invades Manchuria, US Oil embargo, Tripartite Pact signed D. Tripartite Pact signed, Japan invades Manchuria, US Oil embargo

Answers

The correct answer is A. Japan invades Manchuria, Tripartite Pact signed, US Oil embargo

Explanation:

The three events are related to key events before and during the Second World War, especially in relation to Japan that belonged to the Axis Powers. The first event was the invasion of Manchuria, China by the Japanese Empire in 1931. This event is considered by some historians to be the beginning of the Second World War. Moreover, the event was an attempt for Japan to gain power. This event was followed by the Tripartite Pact in 1940 that was signed by Axis powers including Japan to officially form an Alliance during the Second World war.. Finally, the U.S. Oil embargo took place in 1941 as the U.S. that belonged to the Allies decided to ban the export of oil to Japan (Oil Embargo) as a way to weaken Japan powers in the War.

PLEASE HELP QUICKLY!!! California finally joined the Union following the death of President Millard Fillmore. President Zachary Taylor. Senator William Seward. Senator John C. Calhoun

Answers

Answer:

President Zachary Taylor

Explanation:

taylor was a slave owner but after his death california was finally able to join the union

Answer:

b or President Zachary Taylor.

Explanation:

Demand is usually shown as which type of line?
A. Perfectly horizontal
B. Perfectly vertical
C. Positively sloped
D. Negatively sloped

Answers

Answer:

B perfectly vertical is it

Prior to August 1914, most Americans believed Group of answer choices that war in Europe was inevitable. that war had become obsolete. that Woodrow Wilson would have his hands full with all the foreign policy problems at the time. that war with Japan would come within ten years.

Answers

What’s the question? I don’t understand u

What does Harriet Beecher Stowe describe in her novel Uncle Tom's Cabin?
A. The harsh conditions of slavery in the South
B. The story of a slave family killed in its cabin
C. The happy life of a free black living in the North
D. The miserable conditions of the Middle Passage
SUBMIT

Answers

Answer:

A

Explanation:

It is A because In Uncle Tom's Cabin, Harriet Beecher Stowe shared ideas about the injustices of slavery, pushing back against dominant cultural beliefs about the physical and emotional capacities of black people. Stowe became a leading voice in the anti-slavery movement, and yet, her ideas about race were complicated.

Answer:A

Explanation:

A P E X

What country has the highest population?

Answers

Answer:

The country with the highest population is China. It is then followed by India and the United States of America.

Explanation:

What was Roosevelt's primary argument with the Supreme Court?

Answers

Answer:

he was afraid that the U.S Supreme Court might undo his accomplishments.

Companies use offshoring in order to do what?

A. Increase market share
B. Reduce labor costs
C. Lobby the government
D. Protect infant industries

Answers

The answer is : Reduce labor costs

Companies use offshoring in order to do reduce labor costs. Therefore, the correct option is B.

Companies use offshoring as a strategy to reduce labor costs. Offshoring involves moving business operations or manufacturing processes to another country where labor is less expensive. By offshoring, companies can take advantage of lower wages and operating costs in foreign countries, which can lead to significant cost savings. This allows companies to remain competitive in the global market by reducing production costs and potentially increasing profit margins.

Thus, the ideal selection is option B.

Learn more about offshoring here:

https://brainly.com/question/28297679

#SPJ2

How does Section 7 of the U.S. constitution illustrate checks and balances?

Answers

Answer: It is a way the US government made sure that not any of the other branches would be too powerful, so all the branches are equally powerful

Explanation:

Both the Montgomery Bus Boycott and the Freedom Rides were successful in that they resulted in the integration of transportation. What was the difference in the way the successful outcomes were achieved

Answers

Answer:

the Freedom Rides succeded due to federal intervention; the Montgomery Boycott succeded due to local economic pressure.

Explanation:

In simple words, The distinction between the way the positive results were accomplished would be that the Freedom Rides succeeded because of government oversight; the Montgomery Protest succeeded because of regional economic coercion.

Throughout 1961, african americans and whites citizens demonstrated against all the segregation of public transit in the South. Such people found them the "Freedom Flyers" and wanted to use white people's facilities as allowed. This prompted police to interfere, and they were detained.

Citizens declined to ride buses in Montgomery , Alabama from December 5, 1955 to December 20. 1956, to condemn the imprisonment of Rosa Parks, a Black woman who declined to surrender her seat to a white commuter.

Answer:

The Freedom Rides succeeded due to federal intervention; the Montgomery Boycott succeeded due to local economic pressure.

Explanation:

I'm sorry it's been so long, but I'll just leave this here

What critique of U.S. economic policy is this protestor's sign making?
NO WTOI
REAL DEVELOPMENT,
NOT EXPLOITATION
A. The WTO is a corrupt organization that only serves to enrich its
leaders
B. Economic activity is environmentally damaging because it takes
too much energy to ship goods around the globe.
C. Wealthy nations should not be forced to contribute to nations that
are economically less successful
D. International economic development agencies harm poorer
nations by encouraging them to serve as exporters to wealthier
nations

Answers

Answer:

D

Explanation:

I'm 99.99% sure about this, because I saw it on Patriot Act I think.

Answer:

D

Explanation:

just took the test

Other Questions
Can someone help me with this one too John's lyrics are somewhat autobiographical and introspective on this '65 song that features brilliant harmonies throughout and lyrics that offer help to the forlorn listener. It is... Which two statements best describes the purpose of the passage ? please Evaluate ( 8/3) to the 2 power A). 8/9 B). 64/9 C). 64/3 D). 55 Line CD passes through points (0, 2) and (4, 6). Which equation represents line CD? Which of the following was true when Truman met Stalin in Potsdam in 1945? A.Their two nations were already enemies The war in the Pacific was still being fought. Britain had decided not to join them. World War II had ended. Please Help asap!!! Please give explanation If the price of biscuit per packet increased from N250 to N500 and the quantity bought per week decreased from 300 to 200 packets, determine the elasticity of demand for biscuit. Please answer this correctly without making mistakes What is the slope of the line passing through the points (6,7) and (1,5) An education researcher claims that 58% of college students work year-round. In a random sample of 400 college students, 232 say they work year-round. At alphaequals0.01, is there enough evidence to reject the researcher's claim? Complete parts (a) through (e) below. It is a well-known fact that Dr. Barnes rides a skateboard, sometimes even on campus. Suppose that Dr. Barnes selects a skateboard by first picking one of two skateboard shops at random and selecting a skateboard from that shop at random. The first shop contains two "rad" skateboards and three "gnarly" skateboards, and the second shop contains four "rad" skateboards and one "gnarly" skateboard. What is the probability that Dr. Barnes picked a skateboard from the first shop if he has selected a "gnarly" skateboard? What the answer to the question If a circle has a diameter with endpoints of (-3, 0) and (5, 4) then the equation of the circle is? Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code. B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein. C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein. D) Both B and C are possible outcomes. g A spontaneous process is one in which: A. releases a large amount of heat B. may happen (is possible) C. will rapidly approach equilibrium D. will happen quickly Based on the function F(x) = x^4 - 3x^3+ x^2 +2 and the graph of G(X) below,which of the following statements is true? The goal of a statement of purpose is: 62(1+2) isn't that should be 1 , cause in the calculator it said 9 but the order is the parenthisis/brakets first ?? so it should be like 2 times 3 then 66 which gives 1 . Which of the following pitches is a non-chord tone for the I chord in G major? - G - B - A - D