The three variations discussed, V131, T34K and K118R, are all expected to decrease the delta H for folding, and therefore lead to greater thermodynamic stability.
Thus, the correct answers are decreased; greater (A).
What is thermodynamic stability?Thermodynamic stability refers to the inherent stability of a system concerning the transition between different states. It's a measure of how likely the system is to remain in its present state rather than shift to another state. When a system is thermodynamically stable, its structure is stable, meaning that it won't spontaneously transform into another state or release energy.
V131 is thought to fill a cavity in the hydrophobic core, T34K adds a hydrogen bond, and K118R introduces an electrostatic interaction on the molecular surface. These variations, individually and collectively, are expected to decrease delta H for folding and lead to greater thermodynamic stability.
For more information about thermodynamic stability refers to the link: https://brainly.com/question/30330050
#SPJ11
Jane has the blood type AB and Pascal has the blood type AO. Together they have 4 children. What is the probability that at least 2 of their 4 children will have the blood type AB? Please show all work! And use a punnet square. To note, A: .5, B: .25 AB: .25. Can use complement rule or pascals triangle just show me an easier method please. An easier method is much appreciated for the exam.
The probability that at least 2 of their 4 children will have the blood type AB can be found by using Pascal's triangle. Pascal's triangle is a triangular array of numbers that shows the coefficients in the expansion of (a + b)^(n), where n is the row number.
For this problem, we can use the row corresponding to n = 4, which is 1 4 6 4 1. These numbers represent the coefficients in the expansion of (a + b)^4. In this case, a represents the probability of a child having the blood type AB, and b represents the probability of a child not having the blood type AB. So, the expansion of (a + b)^4 is:1(a^4) + 4(a^3)(b) + 6(a^2)(b^2) + 4(a)(b^3) + 1(b^4)We are interested in the probability that at least 2 of their 4 children will have the blood type AB, which is represented by the terms 6(a^2)(b^2) + 4(a)(b^3) + 1(b^4). Plugging in the given probabilities for a and b, we get:6(.25^2)(.75^2) + 4(.25)(.75^3) + 1(.75^4) = 0.3955So, the probability that at least 2 of their 4 children will have the blood type AB is 0.3955.Therefore, using Pascal's triangle, we can find the probability that at least 2 of Jane and Pascal's 4 children will have the blood type AB.Learn more about blood type inheritance here:https://brainly.com/question/27757703
#SPJ11
Using SIM deep, how do you know a bacterium is motile? Bacteria grows in colonies. Media tums red. Bacteria grows along the stab. Bacterial growth looks like an upside down pine tree.
SIM deep is used to identify the motility of bacteria. If the bacteria are motile, they will radiate from the stab mark and make the entire tube appear turbid. So, we can say that the correct answer is that Bacteria grow along the stab.
SIM (Sulfide Indole Motility) agar is a bacterial growth medium. It is used to detect hydrogen sulfide production, indole formation, and motility in microorganisms. The medium's semi-solid consistency allows the bacteria to migrate away from the central stab line and show motility. SIM deep is a good medium for testing bacteria because it can show several things about the bacterium in one test. Indole production and hydrogen sulfide production are revealed by the black coloration of the medium. Bacteria that are motile will disperse from the stab line, and the medium will appear cloudy.
Learn more about SIM deep at https://brainly.com/question/27818615
#SPJ11
How Will We Know When The NH OH And HCI Meet Through Diffusion? a. They React To Form A White Ring. b. They React To Form A Gas. c. They React To Form A Red Liquid. d. The React To Form A Blue Liquid.
When The NH OH And HCI Meet Through Diffusion they react to form a white ring.
The correct answer is option a.
When NH3 (ammonia) and HCl (hydrochloric acid) meet through diffusion, they react to form a white ring of NH4Cl (ammonium chloride). This is because the NH3 and HCl gases react to form a solid product, which appears as a white ring at the point where the two gases meet. This reaction is often used as a demonstration of the process of diffusion, as it provides a clear visual indication of where the two gases have met and reacted.
For more such questions on Diffusion, click on:
https://brainly.com/question/7161064
#SPJ11
Use the following terms and chemical compounds complete the equation that summarized the processes of aerobic cellular respiration: ATP, CO2 , CH2 H12, O2, Heat,H2, O2, O2, Energy 2. Outline for the overview of cellular respiration.
_____+6______+6_______+_______+…
The processes of aerobic cellular respiration are
[tex]C_{6}H_{12}O_{6}[/tex] + 6[tex]O_{2}[/tex] → 6[tex]CO_{2}[/tex] + 6[tex]H_{2}O[/tex] + Energy (ATP + Heat)
Аerobic cellulаr respirаtion is а process thаt occurs within cells to produce energy in the form of АTP. It involves the breаkdown of orgаnic compounds, such аs glucose, аnd the use of oxygen to produce energy, cаrbon dioxide, аnd wаter. The equаtion thаt summаrizes the processes of аerobic cellulаr respirаtion is аs follows:
[tex]C_{6}H_{12}O_{6}[/tex] + 6[tex]O_{2}[/tex] → 6[tex]CO_{2}[/tex] + 6[tex]H_{2}O[/tex] + Energy (ATP + Heat)
In this equаtion, [tex]C_{6}H_{12}O_{6}[/tex] represents glucose, [tex]O_{2}[/tex] represents oxygen, 6[tex]CO_{2}[/tex] represents cаrbon dioxide, [tex]H_{2}O[/tex] represents wаter, АTP represents аdenosine triphosphаte, аnd heаt represents the energy releаsed аs heаt during the process.
For more information about aerobic cellular respiration refers to the link: https://brainly.com/question/24726049
#SPJ11
Sequences without functional constraints are more likely to
mutate:
Group of answer choices
a. Quickly
b. Slowly
Sequences without functional constraints are more likely to mutate quickly. Therefore, the correct answer to this question is a) "quickly".
This is because there is no selective pressure to maintain the sequence, so mutations can accumulate without negatively affecting the organism. In contrast, sequences with functional constraints, such as those encoding important proteins, are under selective pressure to maintain their function and therefore are less likely to mutate or will mutate more slowly.
You can learn more about mutations at
https://brainly.com/question/17031191
#SPJ11
Mary Kramer, aged 47, goes to the doctor with complaints of not feeling well. She claims to have a lot of anxiety and is not able to concentrate. Her husband claims that she is no longer keeping up with the house work. She responds that she doesn’t feel ambitious because she just can’t focus anymore and she feels so weak. She also complains of heart palpitations. She said she has also had a lot of sugar cravings and always seems hungry. Last week, after eating dinner, she felt shaky and started to sweat. She then passed out. Upon examination, Ms. blood pressure is 90/64 mm Hg. Her pulse was a grade of +1 and her heart rate was 70 beats per minute. Her muscle strength was assessed at a grade 3. Fasting blood tests are ordered with the following results: Serum glucose- Low Serum calcium- 9.0 mg/dl Serum potassium- 3.2 mEq/L Serum sodium- 153 mEq./L Insulin- high ABG’s pH = 7.51 pCO2 = 51 mm Hg HCO3- = 29 mEq/L An electrocardiogram was also ordered with the following result: Slightly prolonged PR interval, ST depression, a flattened T wave and a U wave. The doctor notes the high insulin and low blood glucose levels and decides to order a CT scan of the pancreas. The scan shows a .75 cm insulinoma. An insulinoma is a tumor that secretes excess insulin. 1. The patient had a pulse that was given a grade of +1. What does this mean?
A pulse grade of +1 means that the patient's pulse is weaker than normal.
This is usually an indication of poor blood flow or decreased cardiac output. It can be caused by a variety of factors, including low blood pressure, heart disease, or blood loss. In the case of Mary Kramer, it is likely that her low blood pressure and weakened muscle strength are contributing to her weak pulse. Additionally, her heart palpitations and abnormal electrocardiogram results suggest that she may have underlying heart issues that are affecting her pulse.
For more question on electrocardiogram click on
https://brainly.com/question/11431788
#SPJ11
5. List and define the three morphological characteristics
commonly used to describe colonies.
The three morphological characteristics commonly used to describe colonies are form, margin, and texture.
1. Form: The form of a colony refers to its shape or overall appearance. Some common forms include circular, irregular, filamentous, and rhizoid.
2. Margin: The margin of a colony refers to the edge or border of the colony. Some common margins include entire (smooth and even), undulate (wavy), lobate (lobed), and filamentous (hair-like).
3. Texture: The texture of a colony refers to its surface appearance and can include characteristics such as smooth, rough, wrinkled, or slimy.
These characteristics are important for identifying and classifying different types of colonies and can provide valuable information about the organisms that make up the colony.
Learn more about morphological characteristics at
https://brainly.com/question/3291765
#SPJ11
According to the Kaplan-Meier plot, amplification of more than 10 copies of myc in neuroblastoma (see fig. 4-11b), decreases disease-free survival by more than 80% post-treatment. Explain two mechanisms that may contribute to gene amplification of myc?
Neuroblastoma is a type of cancer that develops in the nerve cells of the sympathetic nervous system. Amplification of more than 10 copies of the myc gene in neuroblastoma has been shown to decrease disease-free survival by more than 80% post-treatment, according to the Kaplan-Meier plot (see fig. 4-11b).
There are two main mechanisms that may contribute to gene amplification of myc:
Increased replication of the myc gene: One of the mechanisms that may contribute to gene amplification of myc is increased replication of the gene. This can occur due to mutations in the gene or in other genes that regulate its replication, leading to an increased number of copies of the myc gene in the cancer cells.Increased stability of the myc gene: Another mechanism that may contribute to gene amplification of myc is increased stability of the gene. This can occur due to mutations in the gene or in other genes that regulate its stability, leading to an increased number of copies of the myc gene in the cancer cells.Both of these mechanisms can contribute to the amplification of the myc gene in neuroblastoma, leading to decreased disease-free survival post-treatment.
See more about Neuroblastoma in:
https://brainly.com/question/17924689
#SPJ11
2 1 point
Ants are eating Bob's pea plants. He wants to test some household chemical, like dish soap, to see if it will kill the ants. What is the best experimental question for Bob to ask in order to conduct an experiment to test his hypothesis?
What is the most effective way to spread dishsoap over a garden?
Are red or black ants the hardest to kill?
What amount of dishsoap best kills ants?
Will ants eat dishsoap?
Best experimental question for Bob to ask in order to conduct an experiment to test his hypothesis would be: What amount of dish soap is required to effectively kill ants?
What is the best experimental question in order to conduct experiment to test hypothesis?This question addresses the hypothesis that dish soap may be effective in killing ants and allows a controlled experiment to determine the amount of dish soap needed to effectively kill ants. Other questions are not as relevant to the hypothesis being tested and do not provide clear experimental question to answer.
Hypothesis testing is used to assess the plausibility of hypothesis by using sample data and test provides evidence concerning the plausibility of hypothesis.
To know more about Hypothesis testing, refer
https://brainly.com/question/4232174
#SPJ1
This is the first- choice for venipuncture site because there are several major arm veins called antecubital veins which are close to the surface which makes it easy to locate and penetrate.
The first-choice for venipuncture site is the antecubital fossa because there are several major arm veins called antecubital veins which are close to the surface which makes it easy to locate and penetrate.
Antecubital fossa is the area located on the inside of the elbow, where the arm bends. The antecubital fossa is preferred for venipuncture because it contains several major arm veins, including the median cubital vein, cephalic vein, and basilic vein. These veins are close to the surface of the skin, which makes them easy to locate and penetrate with a needle. Additionally, the antecubital fossa is a relatively large and flat area, which provides a stable surface for the healthcare professional to perform the venipuncture procedure.
For more such questions on venipuncture, click on:
https://brainly.com/question/17370733
#SPJ11
Animals are used when research cannot be carried out with humans• Animals may be harmed only when: • There is no alternative• Benefits of the research justify the harm
Correct, animals are used in research when it is not ethical or feasible to carry out the research with humans. However, there are strict guidelines in place to ensure that animals are only used when necessary and that their welfare is taken into consideration. One of these guidelines is the "Three Rs" principle, which stands for Replacement, Reduction, and Refinement.
Replacement means that alternatives to using animals should be used whenever possible. This includes using computer models or cell cultures instead of live animals.
Reduction means that the smallest number of animals should be used to achieve the desired results. This helps to minimize the number of animals that are harmed in the research process.
Refinement means that the procedures used should be designed to minimize any pain or distress to the animals. This includes using appropriate anesthesia and providing proper care for the animals before, during, and after the research.
In conclusion, animals are used in research when it is not possible to use humans, but there are guidelines or Three Rs" principle in place to ensure that their welfare is taken into consideration and that they are only used when necessary.
Here you can learn more about Three Rs" principle
https://brainly.com/question/15304008#
#SPJ11
Adipose tissue is found in
Select one:
the dermis
the hypodermis
tendons and ligaments
the walls of arteries
most of the brain
The matrix of bone tissue consists
A tissue is a group of specialized cells, and there are different types of tissues. Adipose tissue is found in the hypodermis. The correct answer is ''hypodermis''
Adipose tissue is a type of connective tissue that is responsible for storing fat. It is composed of cells known as adipocytes, which store energy as fat. Adipose tissue is found in many places throughout the body, including the hypodermis, which is the layer of skin just below the surface.
This tissue acts as a natural insulator and cushion for the body. Adipose tissue can also be found in other areas of the body, including around the organs and in bone marrow. It serves an essential role in the body by storing excess energy in the form of fat, which can be used as a source of fuel when the body needs it.
In conclusion, the correct answer is ''hypodermis.''
See more about adipose tissue at https://brainly.com/question/3731743.
#SPJ11
You should be able to provide examples (using scientific name) of organisms with unique structures we covered, like capsules, endospores, mycolic acids, etc. 1
You should know what those components are in each differential stain. For example, the counstain for the gram stain is safranin
Organisms with unique structures, such as capsules, endospores, and mycolic acids, can be found among many different species which can be identified using staining techniques like Gram staining.
For example, the bacterium Bacillus subtilis is known for its endospore-forming ability, while Mycobacterium tuberculosis has a thick layer of mycolic acids in its cell wall. Pseudomonas aeruginosa is an example of a bacterium with a thick, gelatinous capsule.
The Gram stain is a differential stain used to differentiate between Gram-positive and Gram-negative bacteria. This is done by staining the cell wall of the bacterium with crystal violet, followed by a counterstain with safranin. Gram-positive bacteria retain the crystal violet, while Gram-negative bacteria take on the pinkish color of the safranin.
In addition to the Gram stain, other differential stains exist, such as the acid-fast stain and the endospore stain. The acid-fast stain, also known as the Ziehl-Neelsen stain, is used to identify organisms with a high degree of acid-fastness in their cell wall, such as Mycobacterium tuberculosis. The endospore stain is used to identify bacteria that produce endospores, such as Bacillus subtilis.
Know more about Gram stain here:
https://brainly.com/question/14969595
#SPJ11
42. What are the two risk factors of metabolic syndrome? A. "Pear" body type and insulin susceptibility B. "Pear" body type and insulin resistance C. "Apple" body type and insulin resistance D. "Apple
The correct answer is C. "Apple" body type and insulin resistance. Metabolic syndrome increases your risk of cardiovascular disease, stroke, and type 2 diabetes.
They include high blood pressure, high blood sugar, waist fat, and abnormal cholesterol or triglycerides.
An "apple" body type and insulin resistance are major risk factors for metabolic syndrome. Central obesity—an "apple" body type—is extra weight around the waist and abdomen.
This fat distribution increases metabolic syndrome risk.
Insulin resistance also increases risk. Insulin regulates blood sugar. Insulin resistance raises blood sugar, increasing the risk of metabolic syndrome.
In conclusion, the two risk factors of metabolic syndrome are an "apple" body type and insulin resistance.
Therefore, the correct answer is C. "Apple" body type and insulin resistance.
Read more about Metabolic syndrome.
https://brainly.com/question/28903424
#SPJ11
Describe and explain the potential somatosensory and motor signs AND symptoms that one would expect in clinical profile for a patient with a large left MCA infarct. Additionally, name one communication disorder that one would expect in a patient with a large left MCA infarct.
A large left middle cerebral artery (MCA) infarct can cause a range of somatosensory and motor signs and symptoms, including:
Weakness or paralysis on the right side of the body (hemiparesis or hemiplegia)Numbness or tingling on the right side of the body (sensory loss)Difficulty with coordination and balance (ataxia)Difficulty swallowing (dysphagia)
Additionally, a large left MCA infarct can cause communication disorders, as the left hemisphere of the brain is typically responsible for language and speech. One common communication disorder that may occur is aphasia, which is a disorder that affects a person's ability to understand or produce language.
There are different types of aphasia, but a patient with a large left MCA infarct may experience difficulty with speaking (expressive aphasia), understanding what others are saying (receptive aphasia), or both (global aphasia).
Learn more about somatosensory https://brainly.com/question/30828555
#SPJ11
Hydra is able to perform all the following functions except; A. Photosynthesis B. Feeding C. Movement D. Egestion
Answer:
A is the answer
because the hydra is able to perform the rest!
Answer:
please make me brainalist and keep smiling
Explanation:
A. Photosynthesis
Question 3 As temperature is increased, molecules diffuse ____ a. slower b. faster
c. neither faster not slower Question 4 The beaker solution (outside the bag) tested negative for ____ because those particles are too large to exit the holes in the dialysis tubing. a. iodine b. Benedict's Reagent c. starch d. sugar
Based on the following question, these are the answer.
Question 3: As temperature is increased, molecules diffuse faster.Question 4: The beaker solution (outside the bag) tested negative for starch because those particles are too large to exit the holes in the dialysis tubing.Here are the following explanations for each question.
Question 3: As temperature increases, the kinetic energy of molecules increases, causing them to move faster and therefore diffuse more quickly.Question 4: Starch molecules are larger than the pores in the dialysis tubing, so they cannot pass through and therefore the beaker solution outside the bag tested negative for starch.Here you can learn more about Molecules in the link https://brainly.com/question/19922822
#SPJ11
The activity of many end organs is regulated by negative feedback. Figure 9-3A shows the basic elements of a homeostatic control system. Figure 9-3B shows a feedback loop with initiates it is declining T3 and T4 levels in the blood, which produces a drop in metabolic rate. Fill in the information missing in the boxes to correctly complete this feedback loop. Also indicate whether it is a negative or positive feedback loop.
Can someone help me right now please?
The information missing in the boxes to correctly complete this feedback loop about the feedback in thyroid hormone secretion will be
Change defected by hypothalamusSecretes TSHActs on thyroid glandThis secretes thyroxineHow to explain the informationIt should be noted that parathyroid is the structure in the image. These glands, located behind the thyroid at the bottom of your neck, are about the size of a grain of rice.
The parathyroid hormone produced by the thyroid glands helps maintain the right balance of calcium in the bloodstream and in tissues that depend on calcium for proper functioning.
Learn more about gland on:
https://brainly.com/question/1128099
#SPJ1
The RNA sequence GGAUCUCUUGUAGAUCUGUUCUCUAAACGAAC lies in a section of the COVID-19 viral genome that sets up translation, which is the process of reading the RNA to create the proteins the virus needs to survive.(a) Use the webserver to predict the lowest energy structure of the sequence. Print out a picture of it. (b)What do you think the effect will be of the RNA being longer than the stretch you just similated? (c) Design an RNA sequence that folds into a single stem-loop. Run it through the RNAfold server and print a picture of your folded design.
The RNA sequence GGAUCUCUUGUAGAUCUGUUCUCUAAACGAAC is a section of the COVID-19 viral genome that is involved in the process of translation. Translation is the process of reading the RNA sequence to create the proteins that the virus needs to survive.
To answer the questions, we will use the RNAfold webserver to predict the lowest energy structure of the sequence and to design an RNA sequence that folds into a single stem-loop.
(a) To predict the lowest energy structure of the sequence, we can input the sequence into the RNAfold webserver and run the prediction. The webserver will provide a picture of the lowest energy structure, which we can print out. The picture will show the base pairs that form the structure and the free energy of the structure.
(b) If the RNA sequence is longer than the stretch we just simulated, the effect could be that the structure of the RNA will be different. The longer sequence may have additional base pairs that can form more interactions and create a different structure.
The free energy of the structure may also be different, as the longer sequence may have more favorable or unfavorable interactions.
(c) To design an RNA sequence that folds into a single stem-loop, we can create a sequence with a stretch of complementary base pairs that can form a stem, and a loop of unpaired bases at the end.
For example, the sequence GGAUCUCUUGUAGAUCUGUUCUCUAAACGAAC can fold into a stem-loop with the stem formed by the base pairs G-C, A-U, U-A, C-G, U-A, C-G, and the loop formed by the unpaired bases UUGUAGAUCUGUUCUCUAAACGAAC.
We can input this sequence into the RNAfold webserver and run the prediction to get a picture of the folded design, which we can print out.
To know more about RNA refer here:
https://brainly.com/question/20914096#
#SPJ11
A healthy dose of skepticism is an important component of the nature of science when scientists evaluate their own results and the results of others. However, sometimes skepticism can work against science and suppress scientific progress. How does this phenomenon depend on who is controlling the narrative?
A healthy dose of skepticism is an important component of the nature of science when scientists evaluate their own results and the results of others. However, sometimes skepticism can work against science and suppress scientific progress. This phenomenon depend on who is controlling the narrative because the skeptics are those who are evaluating the research and data.
If the skeptics are not open to new information, then they can slow or halt scientific progress, this can happen if the skeptics are overly cautious, or if they are biased in some way. It can also happen if the skeptics are under pressure from those who have a vested interest in the outcome of the research, such as government agencies, corporations, or advocacy groups. In addition, the skeptics may be influenced by their own beliefs or values, which can lead them to reject new information that does not fit their worldview. This is known as confirmation bias.
The phenomenon of skepticism working against science and suppressing scientific progress can also occur if the skeptics do not have access to the necessary resources or if they are not well-informed about the latest developments in the field. The phenomenon of skepticism working against science and suppressing scientific progress can happen if the skeptics are not open to the new information, or if they are biased in some way. It can also happen if the skeptics are under pressure from those who have a vested interest in the outcome of the research, such as government agencies, corporations, or advocacy groups. The skeptics may be influenced by their own beliefs or values, which can lead them to reject new information that does not fit their worldview.
Learn more about confirmation bias at:
https://brainly.com/question/30404177
#SPJ11
what is farm bill and how it is made and why it is important please
in your words don't just copy and paste from internet
The Farm Bill is a collection of laws and regulations that govern agricultural and food production in the United States. It is important because it sets the standards for food safety, provides agricultural research and development funding, and sets the pricing for certain commodities. It is made by Congress and is passed by both the Senate and the House of Representatives.
A farm bill is a comprehensive piece of legislation that is passed by the United States Congress and signed into law by the President. It covers a wide range of agricultural and food policy issues, including farm subsidies, crop insurance, conservation, nutrition assistance, and rural development. The farm bill is typically reauthorized every five years, and the most recent version was passed in 2018.
The process of creating a farm bill begins with hearings held by the House and Senate Agriculture Committees, where lawmakers hear testimony from stakeholders and experts about the needs and concerns of the agricultural community. The committees then draft their own versions of the bill, which are debated and amended by the full House and Senate. Once both chambers have passed their versions of the bill, a conference committee made up of members from both chambers works to reconcile the differences and create a final version of the bill. This final version is then voted on by both the House and Senate, and if it passes, it is sent to the President to be signed into law.
The farm bill is important because it sets the direction of agricultural and food policy for the country. It provides support to farmers and ranchers, helps to protect natural resources, and ensures that low-income families have access to healthy food. Without the farm bill, many of these programs and policies would not exist, and the agricultural industry would be left without the support it needs to thrive.
You can learn more about Farm Bill at
https://brainly.com/question/27087541
#SPJ11
Why might a recipient bacteria degrade the DNA that they receive
from conjugation? Which cell benefits from this interaction?
The recipient bacteria may degrade the DNA that it receives from conjugation in order to protect itself from potential foreign genetic material. This is beneficial for the recipient cell, as it prevents the uptake of any genetic material which could be potentially harmful.
A recipient bacteria may degrade the DNA that they receive from conjugation if the DNA is not compatible with their own genetic makeup. This can occur if the DNA is from a different species of bacteria or if it contains genes that are harmful to the recipient bacteria. The recipient bacteria may also degrade the DNA in order to obtain nucleotides, which are the building blocks of DNA, for their own use.
In this interaction, the recipient bacteria benefits from the degradation of the DNA because they are able to obtain valuable resources from it. However, the donor bacteria does not benefit from this interaction because they have lost their DNA and have not been able to pass on their genetic material to the recipient bacteria.
You can learn more about bacteria at
https://brainly.com/question/8695285
#SPJ11
Which extrinsic muscle of the tongue, in conjunction with the intrinsic muscles of the tongue, contributes most notably to the transport of the bolus through the oral cavity
The extrinsic muscle of the tongue that contributes most notably to the transport of the bolus through the oral cavity is the genioglossus muscle.
The genioglossus muscle is responsible for moving the tongue forward and backward, which is essential for the transport of the bolus from the oral cavity to the pharynx. This muscle works in conjunction with the intrinsic muscles of the tongue, which are responsible for changing the shape of the tongue, to help move the bolus through the oral cavity.
The genioglossus muscle is the most important extrinsic muscle of the tongue for the transport of the bolus through the oral cavity, and it works in conjunction with the intrinsic muscles of the tongue to achieve this.
For more such questions on muscle, click on:
https://brainly.com/question/13920046
#SPJ11
Explain the results observed on each of the slides and compare and contrast the effects of the various osmotic conditions on plant and animal cells. Explain any differences noted and relate them to differences in plant and animal cell structure.
Previous question
In the slides, the results observed depend on the osmotic conditions that the plant and animal cells were subjected to The osmotic conditions are determined by the amount of water and solutes present in the external environment.
When cells are subjected to hypotonic osmotic conditions (low amounts of solutes and high amounts of water), the plant cells will swell, while the animal cells will undergo a process known as lysis.
In contrast, when the cells are subjected to hypertonic osmotic conditions (high amounts of solutes and low amounts of water), the plant cells will shrink, while the animal cells will also shrink but not as much as the plant cells.
This is due to the differences in cell structure between the two types of cells.
Plant cells possess a cell wall, which is impermeable to most solutes and provides protection to the cell; whereas animal cells do not possess a cell wall and are therefore more vulnerable to changes in the external environment.
To know more about osmotic conditions click on below link:
https://brainly.com/question/4117247#
#SPJ11
Show me you understand the concepts of Moral Relativism and Absolutism by explaining to me why a society would and wouldn't allow for the use of IVF to have 8 children at once as in the case of the Octomom, Nadya Suleman. Be sure to include Kantian and Utilitarianism.
In the case of Nadya Suleman and IVF, a society which follows moral absolutism may take the stance that it is morally wrong to have 8 children at once. However, a society that follows moral relativism may take a more lenient stance as this decision is based on individual beliefs.
From a Kantian perspective, it could be argued that having 8 children at once via IVF is not respecting the autonomy of each individual child, as they are unable to make informed decisions about the circumstances of their life.
From a utilitarian perspective, the potential harm from allowing IVF to create 8 children at once would outweigh any benefit of the parents’ desires, as it could be a financial and emotional burden for the family.
Know more about IVF here:
https://brainly.com/question/15139582
#SPJ11
18. What is a loci? specific location on the chromosomes 19. What are linked genes? genes that tend to be inherited together This is because they are located close together on the same chromosome. Therefore it is less likely to become separated during crossing over
A loci is a specific location on a chromosome where a particular gene or DNA sequence can be found. It is used to identify the position of a gene or other genetic marker on a chromosome.
Linked genes are genes that are located close together on the same chromosome and therefore tend to be inherited together. This is because they are less likely to become separated during crossing over, the process in which homologous chromosomes exchange genetic material during meiosis. As a result, linked genes are often inherited together as a unit, rather than independently.
To know more about loci refer here:
https://brainly.com/question/14145665
#SPJ11
Which scenario describes an example of the bottleneck effect?
Cheetahs almost went extinct approximately 10,000 years ago during a mass die‑off of large mammalian species. Very few cheetahs survived, leaving the population with little genetic diversity.
Some of the rare, red‑winged finches from a small island fly to a nearby island to feed. They mate with the native, brown‑winged finches, which results in an increase in the red‑wing allele frequency on the new island.
A mistake during DNA replication causes the offspring of a yellow flowering plant to have blue flowers. The blue flower trait is passed on to successive generations.
In a population of rabbits, some individuals have spotted fur, which makes them more susceptible to predation. The proportion of rabbits that have spots decreases in the population for several generations.
The scenario that describes an example of the bottleneck effect is the first one: "Cheetahs almost went extinct approximately 10,000 years ago during a mass die‑off of large mammalian species. Very few cheetahs survived, leaving the population with little genetic diversity."
The bottleneck effect occurs when a population experiences a drastic reduction in size, often due to a catastrophic event or environmental change. This results in a decrease in genetic diversity, as only a small number of individuals are left to reproduce and pass on their genes.
In the case of the cheetahs, the mass die-off led to a reduction in the population size, leaving only a few individuals to repopulate the species. As a result, the genetic diversity of the cheetah population was greatly reduced.
Learn more about bottleneck effect here: https://brainly.com/question/26318776.
#SPJ11
1) What is Saccharomyces cerevisiae? What kingdom and domain does it belong to?
2) What is Saccharomyces cerevisiae? What kingdom and domain does it belong to?
3) Describe the shape of P. aeruginosa, and also describe its motility–its cells should be motile and pretty spectacularly so. What is the presumed anatomy of flagellar arrangement, given this motility result?
4) Describe the shape of S. cerevisiae cells, and use the ocular micrometer to estimate the diameter of these roughly spherical cells.
1) Saccharomyces cerevisiae is a species of yeast that is commonly used in baking and brewing. It belongs to the kingdom Fungi and the domain Eukarya.
2) Saccharomyces cerevisiae is a species of yeast that is commonly used in baking and brewing. It belongs to the kingdom Fungi and the domain Eukarya.
3) Pseudomonas aeruginosa is a rod-shaped bacterium that is motile, meaning it can move on its own. Its motility is due to the presence of flagella, which are whip-like structures that help the cell move through its environment. Pseudomonas aeruginosa is known for its spectacular motility, which is thought to be due to the arrangement of its flagella. It is believed that P. aeruginosa has a single polar flagellum, which is located at one end of the cell and allows it to move quickly and efficiently through its environment.
4) Saccharomyces cerevisiae cells are roughly spherical in shape, with a diameter of approximately 5-10 micrometers. Using an ocular micrometer, you can estimate the diameter of these cells by measuring the number of divisions on the micrometer that the cell spans. For example, if the cell spans 5 divisions on the micrometer, and each division is 2 micrometers, the diameter of the cell would be 10 micrometers.
To know more about Saccharomyces cerevisiae refer here:
https://brainly.com/question/30416155
#SPJ11
Would you choose a dry-heat oven, an autoclave, or incineration to heat sterilize the following items? State why.
a. Soiled dressings from a surgical wound:
b. Surgical instruments:
c. Clean laboratory glassware:
d. Clean reusable syringes:
a. Soiled dressings from a surgical wound: Autoclave, as it is the most effective and safest way to heat sterilize these materials. Autoclaves reach temperatures that are high enough to kill all types of microorganisms, and have the additional benefit of applying pressure to the material being sterilized.
b. Surgical instruments: Autoclave, as it is the most effective way to heat sterilize these materials. Autoclaves reach temperatures that are high enough to kill all types of microorganisms, and have the additional benefit of applying pressure to the material being sterilized.
c. Clean laboratory glassware: Dry-heat oven, as this is the best way to heat sterilize these materials without damaging them. Dry-heat ovens are capable of reaching the high temperatures required for sterilization while still protecting the material.
d. Clean reusable syringes: Incineration, as this is the most effective way to heat sterilize these materials. Incineration will reach the high temperatures needed to kill all types of microorganisms, and also reduce the materials to ash.
Here you can learn more about Autoclave
https://brainly.com/question/30906522#
#SPJ11
A biolofite is trying to correctly identify a macromoiecule preient in a cell. Ste determines it contains the elements C, H, and O. The molecule behares ina hydrophobic fashiom and appears to be composing the cell membrane. What type of macromolecule in the c=scientist most likely observing?
a. Protein
b. Nucleic acid
c. Carbohydrate
d. lipid
The type of macromolecule that the scientist is most likely observing is a lipid.
Lipids are composed of the elements carbon (C), hydrogen (H), and oxygen (O) and are hydrophobic, meaning they do not mix well with water. Additionally, lipids are a major component of cell membranes, providing a barrier between the inside and outside of the cell.
Proteins, nucleic acids, and carbohydrates are also present in cell membranes, but they do not have the same hydrophobic properties as lipids.
Therefore, the macromolecule the scientist is most likely observing is a lipid.
To know more about lipids click here:
https://brainly.com/question/3498396
#SPJ11