A physical change is __________ if energy is given off.
Select one:
a. exothermic
b. endothermic
c. a chemical change
d. not possible
Answer:
A
Explanation:
Conduction, convection and radiation can occur in variety of ways. Give another example, like the campfire picture above, where you have seen all three methods occur.
Answer: Boiling water
Explanation:
Which one is correct? Please hurry, the audio is just reading the question!
If the absolute temperature of the gas in a balloon is halved, by how much will its volume change?
Answer:
Volume also reduced to half
Explanation:
Volume and absolute temperature are directly proportional to each others
How are mass and density different
Answer:
An object's density is the ratio of mass to volume of an object. The mass is how much it resists acceleration when a force is applied to it and generally means how much of an object or substance there is.
Answer:
brainleist
pls
Explanation:
An object's density is the ratio of mass to volume of an object. The mass is how much it resists acceleration when a force is applied to it and generally means how much of an object or substance there is.
Which of the following is composed mostly of ice?
Asteroids
Gaseous planets
Comets
Meteorites
Stars
Answer: The answer is C- comets!
Explanation: Callisto is composed mainly of rock and water ice, although other ices like ammonia ice and carbon dioxide ice may be present. Water ice occurs at the surface of Callisto so it would be comets.
2. Explain how to determine the wavelength of a wave.
Type your answer here.
I
Answer:
Hope it helps:)
Explanation:
Wavelength can be defined as the distance between two successive crests or troughs of a wave. It is measured in the direction of the wave. This means the longer the wavelength, lower the frequency. ...
To find the wavelength of a wave;
The wavelength is calculated from the wave speed and frequency by λ = wave speed/frequency, or λ = v / f.
Atoms of which element below are most likely to gain electrons?
Group of answer choices:
carbon
lithium
zinc
phosphorus
Answer:
Carbon and phosphorus
Explanation:
The atoms of carbon and phosphorus are most likely to gain electrons from the given choices .
The reason for this is because, both carbon and phosphorus are non-metals. Most non-metals usually accept electrons.
Metals are usually electron donors .
Metals are known for their electropositivity which is their ability to lose electrons. Non-metals are electronegative and will tend to have a strong affinity for electrons.What is independent variable
Answer:
An independent variable is exactly what it sounds like. It is a variable that stands alone and isn't changed by the other variables you are trying to measure.
A group of students were discussing the lonization energies of Selenium and Flourine. Which student is correct for the reason why their element has the highest lonization energy? O A Student C says F because the larger the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction the more energy is needed to remove a valence electron. B. Student B says Se because the smaller the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction, the more energy is needed to remove a valence electron. C. Student D says F because the smaller the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction, the more energy is needed to remove a valence electron. OD. Student A says Se because the larger the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction the more energy is needed to remove a valence electron.
I think the Answer is C because Flourine is stronger in electron attraction and is smaller so it has a stronger electronic pull. Hope this helps :)
For the reaction C+2H 2 —->CH 4 calculate the percent yield if 98 g of methane is produced when 100. g of carbon reacts with an excess of hydrogen?
The percent yield : 73.5%
Further explanationGiven
Reaction
C+2H₂⇒CH₄
Required
The percent yield
Solution
mol of Carbon(as a limiting reactant) :
[tex]\tt \dfrac{100}{12}=8.3[/tex]
mol CH₄ based on C, and from equation mol ratio C : CH₄, so mol CH₄ = 8.3
Mass of Methane(theoretical yield) :
[tex]\tt mass=mol\times MW\\\\mass=8.3\times 16=133.3~g[/tex]
[tex]\tt \%~yield=\dfrac{actual}{theoretical}\times 100\%\\\\\%yield=\dfrac{98}{133.3}\times 100\%=73.5\%[/tex]
What is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g
Answer:
H2O2
Explanation:
I know it's been awhile since the question was asked but for future people like me its H2O2 I got it right in the quiz.
The whole-number multiple is obtained by dividing its molar mass (34.02 g/mol) by the empirical formula mass. H₂O₂ is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g.
What is molar mass ?The mass of a sample of a chemical compound divided by the quantity, or number of moles in the sample, measured in moles, is known as the molar mass of that compound. The molar mass of a material is a bulk attribute rather than a molecular one.
The mass of 6.022 × 10²³ atoms, molecules, or formula units of a material are equal to its molar mass, which is the mass of 1 mole of that substance represented in grams per mole.
Molar mass is a crucial factor to consider while planning an experiment. The molar mass enables you to calculate the quantity you should weigh out on your scale when testing theories that call for specified amounts of a material.
Thus, H₂O₂ is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g.
To learn more about molar mass follow the link;
https://brainly.com/question/12127540
#SPJ3
J.J. Thompson in 1987, announced that cathode rays consisted of a stream
of ?
Hydrogen
Nuclei
Isotopes
Electrons
plzzzzzzzzzzzzz help i will mark you brainlest true orfalse/Air masses are responsible for the weather in a region
Answer:
True
Explanation:
Answer:
It is true!
I hope this helps. Have an awesome day <3
Convert the following word equation into a formula equation
fluorine + aluminum bromide → bromine + aluminum fluoride
Explanation:
Fluorine: F-
Aluminium: Al3+
Bromine: Br-
3F2 + 2AlBr3 => 3Br2 + 2AlF3
The balanced equation for the given chemical reaction can be given as
3F[tex]_2[/tex] + 2AlBr[tex]_3[/tex] [tex]\rightarrow[/tex] 3Br[tex]_2[/tex] + 2AlF[tex]_3[/tex]
What is balanced equation?An equation for just a chemical reaction is said to be balanced if both the reactants as well as the products have the same number of atoms and total charge for each component of the reaction. In other words, both sides of both the reaction have an equal balance of mass and charge.
The products and reactants of a chemical reaction are listed in an imbalanced chemical equation, but the amounts necessary to meet the conservation of mass are not specified.
The balanced equation for the given chemical reaction can be given as
3F[tex]_2[/tex] + 2AlBr[tex]_3[/tex] [tex]\rightarrow[/tex] 3Br[tex]_2[/tex] + 2AlF[tex]_3[/tex]
Therefore, the balanced equation for the given chemical reaction can be given as
3F[tex]_2[/tex] + 2AlBr[tex]_3[/tex] [tex]\rightarrow[/tex] 3Br[tex]_2[/tex] + 2AlF[tex]_3[/tex]
To know more about balanced equation, here:
https://brainly.com/question/29769009
#SPJ2
How many molecules are in 13.2 g NO2?
Answer:
No. of molecules= mass/molar mass ×avogadro no.
= 13.2/50×6.02×10°23
No. of molecules =1.59×10°23
Explanation:
Indicate which one of the two species is larger
A. Mg2+ or Ca2+
Answer:
Ca2+ is larger than Mg2+
Explanation:
Mg2+ has total 10 electrons and Ca2+ has total 18 electrons. So, Ca2+ will have more no of subshell which means greater particle size.
Question 5 please thanks! Due in 4 Minutes xoxo!.
the answer would be B
the particles wouldnt break, nor would the form new particles or just disappear
Discuss in detail the role of various scientists in the discovery of electrons, protons and neutrons
Answer: The atom has three components the electrons, neutrons and protons.
Explanation:
J.J Thomson is responsible for the discovery of electron. He discovered the electrons while determining the properties of cathode rays in 1897. Rutherford is responsible for the discovery of proton during 1909 while performing the gold foil experiment. W. Bothe and H. Becker is credited to the discovery of neutrons.
HELPPPPPPPPPPPPPPPPPP!!!!!!!!!!!!!!!!
Answer:
dalton
Explanation:
believe his first name is james, if your not to sure search it
2. What is the smallest unit of an organism that is classified as living? *
10 points
A. an atom
B. a molecule
C. an organ
D. a cell
Answer:
D
Explanation:
The cell is the basic structural, functional and biological unit of all known living organisms. Cells are the smallest unit of life that is classified as a living thing, and are often called the "building blocks of life.
Answer:
a cell
Explanation:
All living things are made of cells; the cell itself is the smallest fundamental unit of structure and function in living organisms.
what is the purpose of chemistry?
Answer:
To know more about chemicals and how to utilise them to solve man's probl
A sample of Nitrogen gas has a volume of 80.0 L at STP . If the temperature is held Constant what will the volume be at a pressure of 150 kPa?
Answer:
The final volume of the Nitrogen gas is 54.03 L.
Explanation:
Given;
initial volume of the Nitrogen gas, V₁ = 80 L
initial pressure of the Nitrogen gas, (at STP), P₁ = 101.3 kPa
final pressure of the Nitrogen gas, P₂ = 150 kPa
If the temperature is held constant, apply Boyle's law to determine the final volume of the Nitrogen gas.
V₁P₁ = V₂P₂
[tex]V_2 = \frac{V_1P_1}{P_2} \\\\V_2 = \frac{(80 \ L)(101.3 \ kPa)}{150 \ kPa} \\\\V_2 = 54.03 \ L[/tex]
Therefore, the final volume of the Nitrogen gas is 54.03 L.
plzz help this is timed! true or false/Continental air masses are cold. Maritime air masses are hot.
Answer:
False.
Explanation:
N204(0) + 2NO2(g)
Colorless Brown
Keq = 6.16 x 103
What is the predicted direction of change?
setup 1 : to the right
setup 2 : equilibrium
setup 3 : to the left
Further explanationThe reaction quotient (Q) : determine a reaction has reached equilibrium
For reaction :
aA+bB⇔cC+dD
[tex]\tt Q=\dfrac{C]^c[D]^d}{[A]^a[B]^b}[/tex]
Comparing Q with K( the equilibrium constant) :
K is the product of ions in an equilibrium saturated state
Q is the product of the ion ions from the reacting substance
Q <K = solution has not occurred precipitation, the ratio of the products to reactants is less than the ratio at equilibrium. The reaction moved to the right (products)
Q = Ksp = saturated solution, exactly the precipitate will occur, the system at equilibrium
Q> K = sediment solution, the ratio of the products to reactants is greater than the ratio at equilibrium. The reaction moved to the left (reactants)
Keq = 6.16 x 10⁻³
Q for reaction N₂O₄(0) ⇒ 2NO₂(g)
[tex]\tt Q=\dfrac{[NO_2]^2}{[N_2O_4]}[/tex]
Setup 1 :
[tex]\tt Q=\dfrac{0.0064^2}{0.098}=0.000418=4.18\times 10^{-4}[/tex]
Q<K⇒The reaction moved to the right (products)
Setup 2 :
[tex]\tt Q=\dfrac{0.0304^2}{0.15}=0.00616=6.16\times 10^{-3}[/tex]
Q=K⇒the system at equilibrium
Setup 3 :
[tex]\tt Q=\dfrac{0.230^2}{0.420}=0.126[/tex]
Q>K⇒The reaction moved to the left (reactants)
Answer:
The system will shift toward the products
The system is at equilibrium
The system will shift toward the reactants
Explanation:
This is correct on edg... Good Luck!!!!
In the lab you react 23 g of potassium iodide with an excess of lead (II) nitrate to form 18 g of lead (II) iodide precipitate. What is the percent yield of your experiment?
A) 28
B) 56
C) 84
D) 98
Answer:
B) Percent yield = 56%
Explanation:
Given data:
Mass of potassium iodide = 23 g
Mass of lead iodide formed = 18 g
Percent yield = ?
Solution:
Chemical equation:
2KI + Pb(NO₃)₂ → 2KNO₃ + PbI₂
Number of moles of potassium iodide:
Number of moles = mass / molar mass
Number of moles = 23 g/ 166 g/mol
Number of moles = 0.14 mol
Now we will compare the moles of PbI₂ and KI:
KI : PbI₂
2 : 1
0.14 : 1/2×0.14 = 0.07
Theoretical yield of PbI₂:
Mass = number of moles × molar mass
Mass = 0.07 × 461 g/mol
Mass = 32.27 g
Percent yield:
Percent yield = actual yield / theoretical yield × 100
Percent yield = 18 g/ 32.27 g × 100
Percent yield = 56%
Replication, Transcription, and Translation Chart
Please answer
DNA Replication:
1。Template Strand: Start with this nucleotide chain.
TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC
2。Complementary DNA Strand: Write directly below template strand.
Transcription:
3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).
Translation:
4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).
5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).
6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).
I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.
Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC
Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG
mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG
Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG
(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop
i need help asap. which are the products?
Answer:
A
Explanation:
The products of a chemical equation is what is being experimented with. However, the results in which you get are known as your solution.
When iso-propanol burns in oxygen, carbon dioxide and water are produced
Explanation:
When liquid isopropanol (C3H8O) burns in oxygen gas, carbon dioxide gas and liquid water are produced. When dissolved sodium hydroxide reacts with sulfuric acid, aqueous sodium sulfate and water are formed.
What is the mass of 5 moles of Fe2(CO3)3 ?
Answer:
1218.585
Explanation:
Looking at the subscripts we know there are 2 atoms of Fe, 3 atoms of C, and 6 of O.
Take the molar mass of each atom (from the periodic table) and multiply by the # of atoms
Fe: 55.845×2= 111.69
C: 12.011×3= 36.033
O:15.999×6=95.994
Add the values together: 243.717 g/mol
That is 1 mole of the molecule. Multiply by 5 for the final answer.
243.717×5=1218.585