This is an excerpt from a letter sent by President Jimmy Carter to Ayatollah Khomeini, the Supreme Leader of Iran, in 1979.

In the name of the American people, I ask that you release unharmed all Americans presently detained in Iran and those held with them and allow them to leave your country safely and without delay. I ask you to recognize the compelling humanitarian reasons, firmly based in international law, for doing so.
How did the global conflict addressed in this letter impact America?

Responses

A. It contributed to President Carter’s defeat by Ronald Reagan in the election of 1980.
B. It renewed the American people’s faith in the military.
C. It led to greater understanding and acceptance of Islam.
D. It ended the energy crisis and led to the deregulation of domestic oil price contr

Answers

Answer 1

The impact of the world war mentioned in this global conflict letter on America is In the 1980 election, it helped Ronald Reagan defeat President Carter.

The correct answer is A

What are the primary reasons for conflict around the world?

Religion, political leadership, and governance Many of the most important wars in the world's history have been sparked by these concerns and their related subjects, such as justice and human rights, and they still do so now because they are frequently the most basic to a society's framework.

Which 4 conflict types are there?

The book also outlines the four different categories of conflict: relationship, task, process, and status. I assumed we could rapidly delve into each of these, beginning with relational conflict. As a result of the fact that when we are at odds with someone, this is usually what we think of most frequently.

To know more about global conflict visit:

https://brainly.com/question/27972424

#SPJ1


Related Questions

What is the purpose of a body paragraph in an essay? to summarize main points to present the thesis statement to introduce the topic in an engaging way to include detailed evidence about the topic

PLS HURRY :)

Answers

detailed evidence about the topic!

Answer:

to include detailed evidence about the topic

Explanation:

Body of the essay is for analysing the topic, to discuss the evidence/argument in a detailed manner.

Which factor determines whether a municipality is a city or a town in Washington?

Answers

Population is what determines whether a municipality is a city or a town in Washington

Which factor determines whether a municipality is a city or a town in Washington?

In Washington, the distinction between a city and a town is determined by the form of government chosen by the municipality, rather than by population size or other factors.

Under Washington state law, a city has a charter or home rule charter, which means that it has greater authority to govern itself and to adopt its own laws and regulations. Cities may have a council-manager or mayor-council form of government, and they may also have additional departments and services, such as a police department, fire department,

Read more on municipality here:https://brainly.com/question/1061332

#SPJ1

How did the Napoleonic Wars contribute to revolutions acrOSs South America? The wars weakened Spain's connection to the colonies, causing upper-class colonists to begin self-rule. The wars strengthened the Spanish military and led Spain to send more military forces to the colonies. The wars led to the overthrow of Spain's royal famiy, and colonists demanded they take back rule. O The wars led to expenses for Spain, so the Spanish tried to sell its colonies to pay its debts. Mark this and return Save and Exit Next Sub​

Answers

Spanish Creoles in Spanish America began to doubt their allegiance to Spain after the Peninsular War, which was the result of Napoleon's occupation of Spain, which stoked independence.

What impact did the Napoleonic Wars and the French Revolution have on South American revolutions?

Latin Americans like Simon Bolivar rebelled against Spain as a result of the French Revolution of 1789. Additionally, Napoleon's rise was finally a result of the French Revolution. The Napoleonic wars kept Spain so busy that it was unable to devote adequate military might to quell uprisings in its colonies.

How did South America respond to the Napoleonic Wars?

Early independence movements originated in Latin America as a result of the European Napoleonic Wars. It's common to attribute the root of the problem to Napoleon's invasion of Spain.

To know more about Napoleonic war visit:

https://brainly.com/question/27245680

#SPJ1

During the era of King Cotton, slavery had the following political, cultural, and economic
characteristics...

Answers

Prior to the American Civil War, Southern politicians and writers regularly used the phrase "King Cotton" to emphasize the value of cotton production in terms of both politics and the economy.

What were some of the political and financial effects of the growth of the cotton kingdom?

The political pillar of the Democratic Party's control in the South became cotton. Eli Whitney's invention of the cotton gin in 1793, which was widely used, made cotton plantations productive and lucrative. The growth of the textile industries in the North and in Britain also boosted cotton consumption.

What impact did cotton's greater growth have on the economics of slavery?

There was a greater demand for slaves as cotton production grew. The demand for them in the Deep South resulted in slaves in the Upper South becoming incredibly more valuable as commodities. Many numbers of them were sold. As a result, there was the Second Middle Passage, which was the second-largest forced migration in American history.

Learn more about forced migration: https://brainly.com/question/14348880

#SPJ9

How well did the Great Compromise balance the interests of both the larger and smaller states, and what evidence can you provide to support your evaluation

Answers

Answer:The compromise provided for a bicameral federal legislature that used a dual system of representation: the upper house would have equal representation from each state, while the lower house would have proportional representation based on a state's population

Explanation:

Why was national network television important in the United States?
Responses

It helped to create a national culture in the United States.

It led to the construction of interstate highways.

It led to people driving farther on vacations.

It helped make local shows the main ones on television.

Answers

It helped make local shows the main ones on television.

How did the Soviet union system of government help to create conflict with the United States after World War II ?

Answers

Answer:

How did the Soviet Union's system of government help to create conflict with the United States after World War II? The Soviet system of government did not allow its people to choose their own leaders, which the United States thought was wrong.

Choose two of the following: commodore Perry's mission to Japan, the revolt in Hawai:
Co Open Door Policy; the building of the Panama Canali, Explain how the two were similar yet different in terms or goals and actions.

Answers

For instance, the Panama Canal and the Open Door Policy were comparable in that they served to further American business and trade interests through other countries.

Through the Open Door Policy, what goal did the United States expect to achieve?

The Open Door policy, which was first announced in 1899 and then followed up with a missive in 1900, was a key component of the United States' efforts to support China's territorial and administrative integrity and to establish an international protocol of equal privileges for all nations trading with China.

The Panama Canal was what it was. The waterway's two most important attributes are.

The Panama Canal, which connected the Atlantic and Pacific oceans in 1914, had a significant effect on global trade. Ships no longer need to travel the hazardous passage around South America's southernmost tip thanks to the 50-mile-long Isthmus of Panama.

Learn more about Open Door policy: https://brainly.com/question/29772022

#SPJ1

The life of a cowboy was erroneously
portrayed during what event?
A. Deadwood
B. Buffalo Bill's Wild West Show
C. Ringling Brothers Show
D. Barnum and Bailey Circus

Answers

The answer is B. Buffalo Bill's Wild West Show. The life of a cowboy was erroneously portrayed during Buffalo Bill's Wild West Show.

Why did sitting Bull the Wild West Show?

Sitting Bull joined the Wild West show in June 1885 for a signing bonus of $125 and $50 per week, which is 20 times more than what Native Americans who work as reserve policemen make now. Buffalo Bill anticipated that his new star would prove to be a magnetic attraction.

Why was the Wild West show significant?

In addition, the Wild West program promoted a certain romantic and militaristic interpretation of what happened in that region of the nation.

To know more about  Wild West Show visit:

brainly.com/question/7212603

#SPJ9

How can we develop logician justification about why each country expanded?

Answers

Answer:

Explanation:

The expansion of each country can be explained by a combination of political, economic, social, and cultural factors. Here are some possible justifications for each of these factors:

Political factors: The desire for power, security, and influence is a common political factor that has motivated countries to expand their territories. Some countries have expanded to create buffer zones or strategic territories to protect their borders or to gain control of key resources. Others have expanded to project their power and influence over neighboring regions or to establish colonies overseas.

Economic factors: Economic considerations have played a key role in the expansion of many countries. The desire to acquire new resources, markets, and trade routes has driven many countries to expand their territories. For example, European powers in the 19th century expanded their empires to gain access to raw materials and markets for their manufactured goods.

Social factors: Social factors, such as population growth and migration, can also drive expansion. As populations grow, there may be pressure to acquire new land or resources to support them. Migration can also lead to territorial expansion as people move into new areas and establish settlements.

Cultural factors: Cultural factors, such as religious or ideological beliefs, can also play a role in expansion. Some countries have sought to spread their religious or political beliefs to other regions, while others have expanded to protect their cultural heritage or to establish colonies where their culture can thrive.


Tell me if this answers your question.

Changes Lester Joseph Gillis (Baby Face Nelson) have on the criminal justice system.

Answers

Baby Face Nelson's actions did not result in major changes to the criminal justice system on their own, they were part of a larger movement towards more organized and effective law enforcement strategies in the United States.

How did Baby Face Nelson crimes affected the criminal justice system?

Lester Joseph Gillis, commonly known as Baby Face Nelson, was a notorious American gangster and bank robber during the early 20th century. While his criminal activities did not directly lead to significant changes in the criminal justice system, there are a few ways in which his actions had an impact:

1. Increased public awareness of the need for stronger law enforcement: Baby Face Nelson's high-profile crimes and ability to evade law enforcement for long periods of time made it clear that there were weaknesses in the criminal justice system that needed to be addressed.

2. More advanced and organized police tactics: In response to Baby Face Nelson and other high-profile gangsters, law enforcement agencies began to develop more advanced tactics to combat organized crime, including increased use of technology and cooperation between federal and local law enforcement agencies.

3. Heightened focus on the FBI's role in law enforcement: Baby Face Nelson was a major target of the FBI's efforts to combat organized crime, and his criminal activities helped to highlight the agency's role in law enforcement and its ability to pursue criminals across state lines.

Learn more on criminal justice system here;

https://brainly.com/question/5111667

#SPJ1

Sometimes, a justice's decision is different from older court rulings.

Which word could replace "decision" WITHOUT changing the meaning of the sentence?

change
option
ruling
doubt

Answers

The word that would change decision without changing the meaning is C. Ruling.

What is a court ruling ?

The sentence "Sometimes, a justice's decision is different from older court rulings" means that occasionally a judge's ruling in a case may differ from past rulings made by other judges or courts. The word "decision" in this sentence refers to the judgment or conclusion made by the judge in a particular case.

It can be replaced with the word "ruling" without changing the meaning of the sentence, since both words refer to a judgment or conclusion made by a judge. "Change" and "option" do not convey the same meaning as "decision" or "ruling," while "doubt" is not a synonym for either word.

Find out more on court rulings at https://brainly.com/question/8068423
#SPJ1

How did Indian society change as a result of British imperialism

Answers

Answer:

The British restricted Indian industries, such as textiles. An emphasis on cash crops resulted in the loss of self-sufficiency for many villagers. The conversion to cash crops reduced food production, which caused famines. British missionaries and racism threatened traditional Indian culture.

Explanation:

How long did the Japanese practice for
the attack and what was their hit rate?

Answers

The Japanese declaration of war, which was due in at 1300 hours, was timed to be delivered to Washington one hour after the attack.

How much time was spent training before the Japanese attack on Pearl Harbor?

Admiral Isoroku Yamamoto started formulating a strategy to attack the American base in Pearl Harbor, Hawaii, in January 1941. The Japanese continued to hone their strategies for eleven months while also attempting to defuse tensions with the United States through diplomatic means.

The Japanese began their pre-Pearl Harbor training when?

Although Admiral Osami Nagano, the Chief of the Navy General Staff, had not yet authorized a surprise attack on Pearl Harbor, Admiral Yamamoto ordered that For such an attack, extensive planning and training were to be done.

To know more about Japanese practice visit:-

https://brainly.com/question/20180908

#SPJ1

An indirect effect of Eli Whitney's invention of the cotton gin was:

the growth of cottage industries.

strengthening the reliance on slavery in the southern United States.

an increase in the types of cloth available for purchase.

the ability to make wider bolts of cloth.

Answers

An indirect effect of Eli Whitney's invention of the cotton gin was strengthening the reliance on slavery in the southern United States.

What was Slavery?

Slavery has a long past that spans several cultures, nations, and religions, from antiquity to the present. Similar to how its victims have come from a variety of racial and religious backgrounds.

People were abducted from the continent of Africa during the 17th and 18th centuries, sold into slavery in the American colonies, and exploited to labour in the cultivation of crops like cotton and tobacco. By the middle of the 19th century, America's westward migration and the abolitionist movement had sparked a heated discussion about slavery that would ultimately lead to the brutal Civil War. Even though the four million slaves were freed by the Union triumph, slavery's legacy persisted in American history, having an impact on everything from the Reconstruction to the civil rights movement that arose a century later.

To learn more on Slavery from the link:

https://brainly.com/question/9374853

#SPJ1

2. Apply knowledge of context clues to determine
the meaning of manifests as it is used in section.
number 8 of the article. Cite evidence to support
your definition. The power of the hero’s journey

Answers

To determine the meaning of word using context clues, you need to look at the words and phrases that come before and after the unfamiliar word.

What is a phrase?

A phrase is a group of words that functions as a single unit in a sentence. It does not have a subject or a verb, and it can be used in different parts of a sentence. Phrases can be categorized based on their structure and the function they serve in a sentence. Some common types of phrases include noun phrases, verb phrases, prepositional phrases, and participial phrases. Noun phrases consist of a noun and other words that modify it, while verb phrases consist of a verb and its complements. Prepositional phrases begin with a preposition and end with a noun or pronoun, while participial phrases consist of a participle and any modifiers or complements it may have. Understanding the different types of phrases can help improve one's writing and communication skills.

To learn more about phrases, visit:

https://brainly.com/question/13960684

#SPJ9

The major problem with the Articles of Confederation was that it created a central government that was weaker than the state governments.
True
False

Answers

Answer:

False

Explanation:

its false ahhhh the answer is false

This political cartoon appeared in Judge magazine in 1900.

What message about the influence of American imperialism in the Pacific is symbolized in this cartoon?

A. Imperialism forced America to give away its resources.
B. America only expanded into areas that welcomed intervention.
C. American imperialism did not benefit everyone.
D. Expansion threatened to destroy the American way of life.

Answers

This front-page cartoon by Victor Gillam for Judge amply displays Uncle Sam's insatiable hunger toward Cuba. The country is rapidly expanding thanks to US hegemony.

What is this political cartoon that was released in 1899 is about which result of American imperialism?

A symbolic picture of the American viewpoint here on Philippine-American War, which lasted from 1899 to 1902, is found in Louis Dalrymple's painting "He Can't Let Go." The war took place during that time period. Resulting from American imperialism, the Spanish-American War and the Philippine-American War both broke out after each other.

Which political cartoon's message on imperialism was it?

According to the website "American Social History Project - Center for Media and Learning," the cartoon depicts the concept of US imperialism as a helpful support from the US to both Cuba and also the Philippines.

To know more about Victor Gillam visit:

https://brainly.com/question/22776594

#SPJ1

Why is Sona Jobarteh's role as a griot unusual?

Answers

Sona Jobarteh's role as a griot unusual because she is the first kora player to have achieved achievement on a global scale.

Who was Sona Jobarteh?

Gambian singer, multi-instrumentalist, and composer Sona Jobarteh. She is the first professional female kora musician from a griot family and comes from one of the five main kora-playing griot families in West Africa. Maya was born in London.

Sona Jobarteh is the first female to become well-known on the kora and comes from one of the five main West African families that perform the instrument. This harp-like instrument with 21 strings was only handed down from father to son.

Know more about griot

brainly.com/question/13880792

#SPJ1

PLEASE I NEED HELP ON THIS Place the events leading up to the American revolution in the correct order to show the changes that ultimately led the colonists to declare independence from Great Britain and fight in a revolution to gain their freedom from monarchy

Answers

The events that led to the American Revolution in the correct order:

The Proclamation of 1763 was passed forbidding colonists from settling west of the Appalachians and tensions increased.The Boston Massacre (1770) left 5 colonists dead, and most colonists were infuriated.After the Boston Tea Party (1773), the British responded with more legislation including the Quartering Act which forced colonists to House British soldiers.The colonists objected (to the Stamp Act-1765) because they were not being represented in Parliament. Jefferson wrote the Declaration of Independence (1776) and the Revolutionary war started with the Battles of Lexington and Concord (1775).

What is the American Revolution?

The American Revolution or the United States War of Independence (1775–1783), was a rebellion in which 13 American colonies secured political independence and moved to set up the United States of America.

Learn more about the American Revolution at brainly.com/question/10972958.

#SPJ1

U.S. human rights policy in the 20th and 21 st centuries tried to balance the
need to promote human rights abroad with the need to

Answers

United States human rights policy in the 20th and 21st centuries attempted to balance the need to promote human rights abroad with the need to support military allies.

What is human rights policy?

A number of legal protections for human rights exist in the United States, including the Bill of Rights, state constitutions, international treaties, customary law, laws passed by Congress and state legislatures, as well as citizen initiatives and state referendums.

The Federal Government has granted its citizens and some non-citizens unalienable rights through a constitution that has been adopted. By way of  judicial precedent, legislation, and constitutional changes, these rights have developed over time.

Therefore, with the need to support military allies U.S. human rights policy in the 20th and 21st centuries tried to balance the human rights.

To learn more about human rights, click here:

https://brainly.com/question/12742766

#SPJ9

Your question is incomplete, but most probably the full question was,

U.S. human rights policy in the 20th and 21st centuries tried to balance the need to promote human rights abroad with the need to _____.

a. overthrow hostile governments

b. support military allies

c. encourage democracy

d. investigate human rights domestically

The United States led an international coalition to liberate which nation during the Persian Gulf War?

A. Afghanistan
B. Iran
C. Iraq
D. Kuwait

Answers

Answer:

C. Iraq

Hope this helps!

Conflict among the branches of government most likely arise as a result of their ability to one another.


Word Bank:

evaluate undercut check manage

Blank 1:

Answers

The explanation of the cause of the conflict among the branches of government is given below:

What is the conflict about?

Conflict among the branches of government can often arise as a result of their ability to undercut one another.

Each branch has its own set of powers and responsibilities, but when one branch oversteps its bounds and encroaches on the powers of another, tensions can quickly escalate.

Effective management of these tensions requires constant evaluation of the balance of power among the branches, as well as a willingness to check and balance one another.

When each branch is able to effectively manage their own powers while respecting the authority of the others, conflict can be minimized, and the government can function more smoothly.

Read more about judiciary here:

https://brainly.com/question/4166159

#SPJ1

This is an excerpt from a Supreme Court ruling written by Justice Hugo Black 1944.

We uphold the exclusion order as of the time it was made and when the petitioner violated it. In doing so, we are not unmindful of the hardships imposed by it upon a large group of American citizens. But hardships are part of war, and war is an aggregation of hardships. All citizens alike, both in and out of uniform, feel the impact of war in greater or lesser measure. Citizenship has its responsibilities as well as its privileges, and in time of war the burden is always heavier.
In this ruling, the Supreme Court upheld the constitutionality of which action taken by the federal government during World War II?

A. dropping the first atomic bomb on Hiroshima
B. forcing German prisoners of war to work on American farms
C. confining Japanese Americans in internment camps
D. funding the war effort through the use of deficit spending

Answers

The Supreme Court supported the validity of interning Japanese Americans during World War II in camps, constitutional as stated in the text.

Therefore, option C is the correct answer.

Constitutional, what did that mean?

pertaining to, inherent to, or having an impact on one's physical or mental composition; constituting the core of something; essential. 3.: being permitted or in conformity with a state's or society's constitution. a representative democracy.

constitutional - what does that mean?

Adjective. belonging to or innate to the structure or composition of the body or intellect. to one's health or constitution's benefit. vital, fundamental; having to do with the structure or makeup of anything.

To know more about constitutional visit:

https://brainly.com/question/4278982

#SPJ1

Which famous Roman structure do you see pictured here? The Aqueduct The Colosseum The Dome of the Pantheon The Tower of Hercules

Answers

The Colosseum is the Roman structure in the picture.

What is the colosseum known for?

The Colosseum in Rome, Italy, was a sizable arena that served as a venue for combative games and other events. Design Pics Inc. The Colosseum also named the Flavian Amphitheater, is a large theater in Rome. It was erected during the reign of the Flavian emperors as a gift to the Roman people. While lower bandied, the Colosseum's significance was actually far further than just as a theatre for mass entertainment; from its design and armature through to the events it played host to, the amphitheater served as a tool to Roman Emperors for political control. The Flavian Amphitheater, more known as the Colosseum, stands as one of the most spectacular architectural monuments of the ancient world. erected in the first-century bulletin, it's largely flashed back as the point of blood-sport entertainment involving pugilists, wild creatures, and further.

To learn more about the colosseum click on the given link:

https://brainly.com/question/3356070

#SPJ1

(06.03 MC)
Which of the following is an example of capital?
OA home-cooked meal
OA meal at a restaurant
O A factory
dy
OA government regulation

Answers

As an illustration of capital, consider a factory. The answer should be (c).

Capital is what?

A factory and its equipment, intellectual property like patents, or a person's or a business's financial assets are all examples of things that provide advantage or value to their owners. The term "capital" is a generic one that can refer to anything like these.

These investments all have the potential to provide flows of profitable outcomes. It is not the same as money, stocks, or bonds to have capital. They are linked to the finances because they are easily accessible.

According to economic theory, capital goods, often known as capital, are "those durable produced assets that are in turn used as productive inputs for future production" of goods and services. On a macroeconomic level, the nation's capital stock, in any one year, is made up of its inventories, equipment, software, and buildings.

As a result, the plant served as the center of the capital. As a result, choice (c) is accurate.

Learn more about capital: https://brainly.com/question/30055085

#SPJ1

5. Why did the U.S. try to remain neutral at the beginning of WWII?​

Answers

Explanation:

The US was facing a recession in there economy (The Great Depression) and didn't want to get involved in another war that could possibly cause more detriment to there economy even more.

Many people in the United States were isolationists after The Great War and the memory of losing loved ones was fresh in peoples minds. Many felt that Europes problems would not affect the US. Not until Pearl Harbor did the US enter the war, and initially only against the Japanese. It took the relationship between Roosevelt and Churchill to convince Americans to join the European war theatre.

Careers in agriculture, food, and natural resources require commitment, dedication, and consistency. True or False

Answers

I am pretty sure that is true. If not sorry.

Summarize: What factors contributed to the rise of the farmers' movement? How was the rise
of the Populist Party directly related to many of the issues of the Gilded Age we have discussed?

Answers

Farmers' movement occurred due to some hardship faced by farmers such as increased transportation cost, debts and limited access to credit.

What factors led to the rise of farmers' movement?

The farmers' movement in the late 19th century was driven by several factors, including falling crop prices, high transportation costs, and unfair economic practices by railroads and banks. Additionally, farmers were struggling with high levels of debt and limited access to credit.

The Populist Party, also known as the People's Party, emerged as a political force in the 1890s, largely as a result of the frustrations and grievances of farmers. The party advocated for policies such as government regulation of railroads and banks, the use of silver as a currency, and the direct election of senators.

Many of the issues driving the Populist Party's platform were related to the problems of the Gilded Age, including income inequality, corruption, and the consolidation of wealth and power in the hands of a few elites. The Populist Party represented a challenge to the status quo of the time and sought to address the needs and concerns of working-class Americans who felt left behind by the country's economic and political systems.

Learn more on farmer's movement here;

https://brainly.com/question/14173273

#SPJ1

What questions do you have about the experiences of Black Americans during this period of history?

Answers

1. How did Black Americans respond to the violence and discrimination they were subjected to?

What is  Violence ?

Violence is an extreme form of aggression consisting of physical, psychological, or emotional harm inflicted on another person or group of persons. It can involve physical assault, destruction of property, bullying, and other forms of aggression. In extreme cases, it can result in death. Violence can be used as a means of control, intimidation, or coercion and can occur between individuals, groups, or between societies. It is often used to gain power and can have long-lasting psychological effects on both the victim and the perpetrator.

2. How did Black Americans navigate the legal system to fight for their rights?

3. What strategies did Black Americans use to push for social, economic, and political equality?

4. How did Black Americans establish and maintain community and cultural networks during this period?

5. How did Black communities respond to the influx of immigrants at the turn of the century?

6. How did World War I and the Great Migration impact the lives of Black Americans?

7. How did African American organizations respond to the civil rights movement of the 1950s and 60s?

8. What challenges did African Americans face in their efforts to gain full access to the American political system?

To learn more about Violence

https://brainly.com/question/16923564

#SPJ1

Other Questions
A soccer ball with a mass of 0.43 kg is thrown to a 63 kg girl at rest who is wearing roller blades. She catches the ball and moves to the right. Her speed just after catching the ball is 0.2 m/s. How did covid affect school kids in Afrikaans 15. \( x=-5, \quad x=4, \quad x=-\frac{1}{2} \) factored form standard form 16. \( x=3, \quad x=-7, \quad x=0 \) (multiplicity of 2) factored form standard form\[ \text { 17. } x=\frac{2}{3} \text { what smaller 5.75 or 9/7 When the Europeans arrived in Central America, most countries fell to Spanish rule except ______, which became a British colony. i need help 16 divided by 6032 full solution A jet flying at 200 m/s north accelerates at a rate of 18.2 m/s for 15 seconds. What is the jet's final velocity? The RNA sequence GGAUCUCUUGUAGAUCUGUUCUCUAAACGAAC lies in a section of the COVID-19 viral genome that sets up translation, which is the process of reading the RNA to create the proteins the virus needs to survive.(a) Use the webserver to predict the lowest energy structure of the sequence. Print out a picture of it. (b)What do you think the effect will be of the RNA being longer than the stretch you just similated? (c) Design an RNA sequence that folds into a single stem-loop. Run it through the RNAfold server and print a picture of your folded design. consider a political discussion group consists of 6 democrates, 3 republicans, and 5 independents. suppose that two group members are randomly selected, in succession, to attend the political convention. find the probability of selecting a independent then a democrat According to the Kaplan-Meier plot, amplification of more than 10 copies of myc in neuroblastoma (see fig. 4-11b), decreases disease-free survival by more than 80% post-treatment. Explain two mechanisms that may contribute to gene amplification of myc? Even though both lens cells and liver cells have numerous transcription factors that are present in both colls, the lens cell makes the crystallin protein (not albumin), whereas the liver cell makes albumin (not crystallin) Which of the following explains this cell specificity?A. Different specific transcription factors made in each cell determine which genes are expressedB. At fertilization, specific colls are destined for certain functionsC. The activators needed for expression of the crystallin gene are present in all cells.D. The promoters are different for the different genes How does the author's discussion of different death rates help readers understand the spread of the Black Death? Use evidence from the text in your responsepls i need help!! a rock rolling down a slope from rest covers a distance of 4 m in the first second. What distance will it covers in 3 sec? 5 3/10 = 5 ?/50If anyone can please help me with the rest what happened to some native Americans during the Jackson presidency ? In order for following to be consistent,-3x +4y +7z =-4-11x +24y +kz = -452x -5y -8z =9solve for k ?please show full steps Air passes over the top of an airplanewing at 170 m/s, and over the bottomat 130 m/s. What is the difference inpressure between the top andbottom of the wing? Scarlett and Roger sipped their drinks on the porch, discussing all the things they still had to do before the Easter holiday. As Roger finished her last bit of burger, he sighed, "I'm stuffed." He complained of having a burning sensation in his lower chest. "You probably ate too much. How about taking some antacid?" asked Scarlett. "I use it every time I get indigestion." Roger left to search the medicine cabinet. He eventually felt better. Roger got his body test results the next day. He glanced at them briefly and put the paper in his bag. "Maybe later I will get a better sense of what all this means," he said.'Roger's test results(at rest and fasting levels)TEST Roger's Result Normal RangeHeart rate 90 beats/min 60-100 beats/minBlood pressure 138/95 mm/Hg 120/80 mm/HgTotal cholesterol 242 mg/dL create a journal from the perspective of a citizen living in paris during the french revolution CAN SOMEONE HELP ME PLEASE ASAP write three rations that are equivalent to 6/9