The sum of three consecutive natural numbers is 555, find the numbers.

Answers

Answer 1

Answer:

184, 185, 186

Step-by-step explanation:

If the first number is x, the other numbers are x + 1 and x + 2, therefore we can write:

x + x + 1 + x + 2 = 555

3x + 3 = 555

3x = 552

x = 184 so the other numbers are 185 and 186.


Related Questions

PLEASE EXPLAIN IN DETAILS HOW TO SOLVE LINEAR INEQUALITIES. Heres an example problem. Please solve and show your steps/explain.
6(x+8) ≥ ‒43+4x

Answers

Answer:

[tex]x \geq -91/2[/tex]

Step-by-step explanation:

[tex]6(x+8) \geq -43 + 4x[/tex]

Resolving Parenthesis

[tex]6x+48 \geq -43 + 4x[/tex]

Collecting like terms

[tex]6x - 4 x \geq -43-48[/tex]

[tex]2x \geq -91[/tex]

Dividing both sides by 2

[tex]x \geq -91/2[/tex]

Answer:

x ≥ - 91 / 2

Step-by-step explanation:

In this sample problem, the first thing we want to do is expand the part in parenthesis through the distributive property. This will make the simplification process easier. Another approach would be to divide either side by x + 8, but let's try the first.

Approach 1 : [tex]6(x+8) = 6x + 6 8 = 6x + 48[/tex]

[tex]6x + 48 \geq - 43+4x[/tex] - so we have this simplified expression. We now want to isolate x, so let's combine common terms here. Start by subtracting 6x from either side,

[tex]48 \geq - 43-2x[/tex] - now add 43 to either side,

[tex]91\geq -2x[/tex] - remember that dividing or multiplying a negative value changed the inequality sign. Dividing - 2 on either side, the sign changes to greater than or equal to, with respect to x,

[tex]- 91 / 2 \leq x[/tex], or in other words [tex]x \geq - 91 / 2[/tex]. This is our solution.

An important proportion that the ancient Greeks used was the

Answers

the ancient Greek used the golden ratio

Answer:

An important proportion that the Ancient Greeks used was the Golden Mean, the a0

Step-by-step explanation:

Also known as Golden Ratio, Divine Proportion, or Golden Section

What is the quotient in polynomial form?

Answers

Answer:

Step-by-step explanation:

We are given the polynomial [tex]x^3+2^2-2x+3[/tex] and we are dividing by (x+3). So by performing one step of synthetic division we get

1 2 -2 3|-3

 -3 3 -3

1 -1 1   0

So the quotient in polynomial form is [tex]x^2-x+1[/tex]

What is the equation of the line whose y-intercept is 3 and slope is 1? A.y = x + 3 B.y = 3x + 1 C.y = x - 3

Answers

Answer:

The answer is option A

Step-by-step explanation:

Equation of a line is y = mx + b

where

m is the slope

b is the y intercept

From the question

b / y intercept = 3

m / slope = 1

Substitute these values into the below equation

y = mx + b

We have the answer as

y = x + 3

Hope this helps you

Answer: A. Y= x+3

Step-by-step explanation: since the value of the slope is 1 it would go next to the x but x is also equal to 1x. And you add 3 since the y intercept is 3 and the format of the equation is y equals slope plus the y intercept hope this helps

What is the missing side lenght in the triangle below?​

Answers

Answer:

45

Step-by-step explanation:

Let's call the missing side x

This is a right triangle and in right triangles the square length of hypotenuse is equal to sum of square length of base and side lengths

53^2 = 28^2 + x^2

x = 45

[tex]3\sqrt{2} - 5 \sqrt{18}[/tex] Help is appreciated!! Thank you so much! :D ❤❤

Answers

Here is the answer, I couldn’t type it out so I took a picture of it, if you need the steps please let me know

1. Manuel quiere fabricar banderitas chilenas para venderlas en los partidos de la selección nacional. Si se demora 1 hora en hacer 45 banderitas y trabaja 5 horas diarias. ¿Cuántos días se demorará en fabricar 1800 banderitas?

Answers

Answer:

[tex]\large \boxed{\text{Eight days}}[/tex]

Step-by-step explanation:

1. Calculate the hours

[tex]\text{Hours} = \text{1800 flags} \times \dfrac{\text{1 h}}{\text{45 flags}} = \textbf{40 h}[/tex]

2. Calculate the days

[tex]\text{Days} = \text{40 h} \times \dfrac{\text{1 da}}{\text{5 h}} = \text{8 da}\\\\\text{It will take $\large \boxed{\textbf{eight days}}$ to make 4500 flags.}[/tex]

What is the equation of the following line? Be sure to scroll down first to see all answer options.



A.
y = 18x

B.
y = 9x

C.
y = -9x

D.
y = - x

E.
y = -18x

F.
y = x

Answers

Answer:

y=9x

Step-by-step explanation:

rise over run the rise is the y=9 and run is x=1.

9/1=9x

please help me ☣️☢️☢️⬅️⬅️⬅️⬅️⬅️⬅️⬅️⬅️⬅️⬅️⬅️⬅️⬅️⬅️⬅️⬅️⬅️⬅️⬅️⬅️⬅️⬅️▫️​

Answers

Answer:

acute isosceles triangle

vertex angle, y =  44.0 degrees. (smallest angle)

Step-by-step explanation:

If the sides are in the ratio 4:4:3,

two of the sides have equal lengths, so it is an isosceles triangle.

Also, the sum of square of the two shorter sides is greater than the square of the longest side, so it is an acute triangle.

To find the smallest angle, we draw the perpendicular bisector of the base (side length 3) and form two right triangles.

The base angle x is given by the ratio

cos(x) = 1.5/4 = 3/8

Consequently the base angle is  arccos(3/8) = 68.0 degrees.

The vertex angle equals twice the complement of 68.0

vertex angle, y = 2 (90-68.0) = 44.0 degrees. (smallest angle)

match the inequality, x²≥0, with it's equivalent interval notation​

Answers

Answer:

[tex](-\infty, \infty)[/tex]

Step-by-step explanation:

Every number, when you raised to the second power is positive, therefore that inequality would be all real numbers.

[tex](-\infty, \infty)[/tex]

A fair die is rolled. What is the probability of rolling a 3 or a 4?

Answers

Answer:

2/6 which when simplified, is equal to 1/3

Answer:

1/3

Step-by-step explanation:

We wish to estimate what percent of adult residents in a certain county are parents. Out of 500 adult residents sampled, 175 had kids. Based on this, construct a 99% confidence interval for the proportion p of adult residents who are parents in this county. Express your answer in tri-inequality form. Give your answers as decimals, to three places.

Answers

Answer:

The 99% confidence interval  is  [tex]0.3003 < I < 0.3997[/tex]

Step-by-step explanation:

From the question we are told that

     The sample size is  [tex]n = 500[/tex]

      The the number that are parents  x =  175

The  proportion of parents is  mathematically represented as

       [tex]\r p = \frac{x}{n}[/tex]

substituting values

      [tex]\r p = \frac{175}{500}[/tex]

     [tex]\r p = 0.35[/tex]

The  level of confidence is given as 99%  which implies that the level of significance is  

       [tex]\alpha = 100 - 99[/tex]

       [tex]\alpha =[/tex]1%

      [tex]\alpha = 0.01[/tex]

The critical value for this level of significance is obtained from the table of critical value as

          [tex]t_{x, \alpha } = t_{175, 0.05} = 2.33[/tex]

Generally the margin of error is mathematically evaluated as

       [tex]M =\frac{ t_{175, 0.01 } * \sqrt{\r p (1-\r p)} }{\sqrt{n} }[/tex]

substituting values

     [tex]M =\frac{ 2.33 * \sqrt{\r 0.35 (1-0.35)} }{\sqrt{500} }[/tex]

     [tex]M = 0.0497[/tex]

Generally the 99% confidence interval is mathematically represented as

        [tex]I = \r p \pm M[/tex]

    [tex]\r p -M < I < \r p + M[/tex]

substituting values

    [tex]0.35 -0.0497 < I < 0.35 + 0.0497[/tex]

    [tex]0.3003 < I < 0.3997[/tex]

WILL MAKE BRAINLIST----- Describe both rotational symmetry and reflection symmetry. Find four examples of symmetry in your classroom.

Answers

Answer:

When an obect has rotational symmetry, that means the object will look the same after a certain amount of rotating. When an object has reflection symmetry, it means the object mirrors itself at the midpoint.

Step-by-step explanation:

A circular garden has a diameter of 12 feet. About how much trim is needed to surround the garden by placing trim on the garden's circumference?

Answers

Trim = circumference

        = 2[tex]\pi r[/tex]

        = 2 x 3.14 x 6

        = 37.68 feet

Choose the correct equation for the parabola based on the given information. Given: Focus:(4,-3) Vertex: (-2,-3) a. 24(y+3) = (x+2)^2 b. 24(x+2)=(y+3)^2 c. 6(x-4)= (y+3)^2 d. 6(y+3)=(x-4)^2

Answers

Answer:  b.  24(x + 2) = (y + 3)²

Step-by-step explanation:

Vertex: (-2, -3)

Focus:  (4, -3)

                  ↓

                same y-value so equation will be y²

Equation: a(x - h) = (y - k)²

a = 4p where p is the distance from Vertex to Focush is the x-coordinate of the Vertexk is the y-coordinate of the Vertex

Given: h = -2,  k = -3,   a = 4[4 - (-2)] --> a = 24

Input those values into the equation:  24(x + 2) = (y + 3)²

 

Mai invests $20,000 at age 20. She hopes the investment will be worth $500,000 when she turns 40. If the interest compounds continuously, approximately what rate of growth will she need to achieve her goal? Round to the nearest tenth of a percent.

Answers

Answer:16.1%

Step-by-step explanation:

Answer:

The investment needs the rate of growth to be approximately 16.1%.

Step-by-step explanation:

Imagine you have a data set with 9,987 names. The data set is sorted alphabetically. You want to find out if the name "David Joyner" is in the data set. Using a linear search, what is the minimum number of names we might have to check?

Answers

Answer:

  1

Step-by-step explanation:

David Joyner might be the first name, so you may only have to check 1 name.

3 + 5x, for x = 10

A. 350

B. 120

C. 53

D. 75

Answers

Answer:C

Step-by-step explanation:

Pemdas

3+5(10)

5*10=50

3+50=53

the initial population of a town is 16,237 and it grows with a doubling time of 24 years. what will the popluation be in 2 years.

Answers

Answer: 17,203 people

Step-by-step explanation:

The formula for solving this is;

[tex]P(t) = P_{0} (2)^{t/dt}[/tex]

Where;

P(t) is the population at time t

[tex]P_{0}[/tex] is the initial population

t is the year of interest

dt is the amount of time it takes to double.

[tex]P(t) = P_{0} (2)^{t/dt}[/tex]

[tex]P(2) = 16,237 (2)^{2/24}[/tex]

=  17,202.50

= 17,203 people

These two polygons are similar.
Find the value of z.
z = [?]

Answers

Answer:

Definitely 3 hmmm..

Step-by-step explanation:

6/2=3 so 9/z=3

tfo 9/3=3

The missing variables have values of 12, 5, 9, and 3, respectively, for x, y, w and z.

Given that there are two similar polygons with dimension:

Larger polygon = 9, 6, w, 15, x.

Smaller polygon = z, 2, 3, y, 4.

We need to find the missing value of the side length.

According to the definition of the similar polygons, the corresponding sides shows proportionality.

9/z = 6/2 = w/3 = 15/y = x/4

Solving for each variable =

i) Solve for z:

9/z = 6/2

Cross-multiplying:

6z = 9 × 2

6z = 18

Dividing both sides by 6:

z = 18/6

z = 3

ii) Solve for w:

6/2 = w/3

Cross-multiplying:

2w = 6 × 3

2w = 18

Dividing both sides by 2:

w = 18/2

w = 9

iii) Solve for y:

6/2 = 15/y

Cross-multiplying:

6y = 30

Dividing both sides by 6:

y = 5

iv) Solve for x:

6/2 = x/4

Cross-multiplying:

2x = 24

Dividing both sides by 2:

x = 12

Hence the values of the missing variables are x = 12, y = 5, w = 9 and z = 3.

Learn more about similar polygons, click;

https://brainly.com/question/29287674

#SPJ4

In a sequence, the 40th term is 70, the 41st term is 72 and the 42nd term is 74.


a) State the term-to-term rule

b) Work out the first term

c) Work out the 80th term

Answers

Answer:

term to term rule is +2

The first term is -8

80th term is 150

Step-by-step explanation:

70 to 72 is adding 2

72 to 74 is adding 2

term to term rule is +2

The equation for a sequence like this is

xn = a + d(n−1)

where n is the term number  a is the first term and d is the term to term rule

Using the 40th term is 70

70 = a + 2( 40-1)

70 = a + 2( 39)

70 = a + 78

Subtract 78 from each side

-8 = a

The first term is -8

80th term

xn = a + d(n−1)

x80 = -8 +2 (80-1)

     = -8+2(79)

    = -8+158

   = 150

The ratio of men to women working for a company is 7 to 5 . If there are 90 women working for the company, what is the total number of employees?

Answers

Answer:

The Total of employees

=216 employees

Step-by-step explanation:

Ratio of men to women is 7 to 5

Meaning

Men/women= 7/5

If their are 90 women

Let men= x

X/women= 7/5

X= women *7/5

X= 90*7/5

X= 18*7

X= 126

There are a total of 126 men

The Total of employees=men + women

The Total of employees=126+90

The Total of employees

=216 employees

When a fish is selected at random from a tank, the probability that it has a green tail is 0.54, the probability that it has red fins is 0.18, and the probability that it has both a green tail and red fins is 0.02. What is the probability that the selected fish will not have a red fin or a green tail? A) 28% B) 70% C) 2% D) 30%

Answers

Answer:

the answer is C

Step-by-step explanation:

hope this helps

The probability that the selected fish will not have a red fin or a green tail is 0.30.

To find the probability.

What is probability?

probability is the ratio of the number of favorable outcomes and the total number of possible outcomes.

Given that:

G=fish has green tail

R=fish has red fin

G^R = fish has both a red fin and a green tail

P(G)=.54

P(R) = .18

P(G^R) = .02

P(GvR) = P(G) + P(R) - P(G^R) = .54 + .18 - .02 =

P(GvR) =.72 - .02 = .7

P(neither G nor R) = 1-.7 = .3 = 30%

So, the probability that the selected fish will not have a red fin or a green tail is 0.30.

Learn more about probability here:

https://brainly.com/question/17078963

#SPJ2

A researcher studying public opinion of proposed Social Security changes and asks a random sample of adult Americans whether or not they support the proposed changes. To say that the distribution of the sample proportion of adults who respond​ yes, is approximately​ normal, how many adult Americans does the researcher need to sample in the following​ cases
(a) if 37​% of all adult Americans support the changes?
(b) 25% of all adults Americans support the changes?

Answers

Complete question is;

A researcher studying public opinion of proposed Social Security changes and asks a random sample of 30 adult Americans whether or not they support the proposed changes. To say that the distribution of the sample proportion of adults who respond​ yes, is approximately​ normal, how many adult Americans does the researcher need to sample in the following​ cases

(a) if 37​% of all adult Americans support the changes?

(b) 25% of all adults Americans support the changes?

Answer:

A) 13 adults

B) 23 adults

Step-by-step explanation:

A) We are given;

p = 37% = 0.37

Since we are told that this is an approximately normal distribution, we will use the formula;

np(1 - p) ≥ 10

Thus;

0.37n(1 - 0.37) ≥ 10

n ≥ 10/(0.63 × 0.37)

n ≥ 42.9

We need a whole number, thus n = 43

From the question, we have already 30 adults , so the required number of adults are; 43 - 30 = 13 adults

B) We are given;

p = 25% = 0.25

Since we are told that this is an approximately normal distribution, we will use the formula;

np(1 - p) ≥ 10

Thus;

0.25n(1 - 0.25) ≥ 10

n ≥ 10/(0.75 × 0.25)

n ≥ 53.33

n ≈ 53

From the question, we have already 30 adults , so the required number of adults are; 53 - 30 = 23 adults

Solve the given simultaneous equations : 2x + 3y = 17 ; 3x - 2y = 6

Answers

Answer:

x= 4, y=3

Step-by-step explanation:

2x + 3y = 17

3x - 2y = 6

----------

If we double the first and triple the second equation, and add up, we can get rid of y:

4x+6y= 34+9x - 6y= 18-----------------13x= 52x= 4

Then it is easy to find the value of y:

2*4+3y= 173y= 9y= 3

Answer is: x= 4, y=3

Four friends are on a basketball team. During a game, each friend kept track of how many shots they attempted and how many of those attempts they made. Henry made 0.45 of his shots. Allison made Arthur made of her shots. of his shots. Trevor missed 58% of his shots. Which friend had the best record for the number of shots made?

Answers

Answer:

Henry had the best record for the number of shots made

Step-by-step explanation:

From the given information.

Four friends are on a basketball team.

Henry

Allison

Arthur

Trevor

We are being told that Henry made 0.45  of his shots out of all his attempts

Allison made Arthur made of her shots  of his shots.

i,e Arthur did the work for Allison , so out of Arthur's shot , we have to  figured out Allison shots,

Trevor missed 58% of his shots.

i.e Trevor failed 0.58 of his shot, If he failed 0.58 shot

Then the attempts Trevor made is :

= 1 - 0.58

= 0.42

SO , Trevor made 0.42 shots out of all his attempt

N:B We are not given any information about Arthur's shots , so we can't determine Allison shot as well.

Therefore; we will focus on only Henry and Trevor shots

So ;

Henry made 0.45  of his shots

Trevor made 0.42 out of his shots

We can thereby conclude that :

Henry had the best record for the number of shots made

6th grade math , help me please :)

Answers

Answer:

a= 7/20

b=35

Step-by-step explanation:

A was simple because 7 people with blue eyes for every 20 people written in fraction form. For b they say what if it was 100 total people so 20 x 5 = 100 so 7 x 5= 35 so your answer to b is 35

I NEED HELP ASAP PLEASE

Answers

Answer:

D. x^2 - 6x + 7.

Step-by-step explanation:

The roots are 3 plus or minus sqrt(2). That means the equation is...

(x - [3 + sqrt(2)]) * (x - [3 - sqrt(2)])

= [x - 3 - sqrt(2)] * [x - 3 + sqrt(2)]

= x^2 - 3x - xsqrt(2) - 3x + 9 + 3sqrt(2) + xsqrt(2) - 3sqrt(2) - (sqrt(2))^2

= x^2 - 3x - 3x + 9 - 2 - xsqrt(2) + xsqrt(2) + 3sqrt(2) - 3sqrt(2)

= x^2 - 6x + 7.

Hope this helps!

Solve the equation for X. 2(2x-4)=3(x+4) A -4 B 4 C 20 D 6

Answers

Answer:

X=20

Step-by-step explanation:

The answer is C

Digital music distribution provides an opportunity for everyone to get their music heard. In order to get on a service like iTunes, one needs to pay for distribution through a service like Tunecore or CD Baby. These services make sure that your music is heard in the different platforms. Suppose the distributor charges the artist a $50.00 cost for distribution, and the streaming services pays $4.00 per one thousand streams. Model the profit for the total number of streams by answering the questions below: Use the cost for distribution to build your y-intercept. What is the y-intercept? Hint: the y-intercept is a point on the y axis, so your answer should be an ordered pair. Hint: you have to keep in mind that any time you pay for something, you are SPENDING money, if your y-intercept is incorrect, all your numbers will be off Use the payment per thousand streams to build your slope. What is the slope? Use the slope-intercept format (y = mx + b) to give the equation of the line. What is the equation of this line? Graph the line by adjusting the sliders below. Show your line by attaching an image below. After how many streams will you pay for the distributor charges? (hint: this is where the line crosses the x-axis, round to the nearest thousand) How many streams would it take to profit $300,000? Challenge Question: In 2019, Old Town Road became one of the most streamed songs of all time passing the previous record holders, Despacito and One Sweet Day. The second week the song was #1, it set an all time streaming record. It was streamed 143 million times (143,000,000) in the US, nearly 30 million higher than the previous record holder Drake, In My Feelings. Calculate the profit earned using these numbers. (Hint: use the slope intercept format to build this equation).

Answers

Answer:

the answer is 1.00

Step-by-step explanation:

pls mark me as the brainliest and tell me thanks

Other Questions
The diversity committee at State U. is a long-standing committee with a stable membership. During the first meeting of the year, Sam, a relatively new member of the group, asks, "What are the plans for fall orientation?" Given that the group has a high-context culture, which of the following is the most likely response to Sam's question?a) We will have a special meeting at the end of the month to brainstorm ideas. We will appoint a subcommittee to draw up a schedule and deadlines for tasks, and proceed from that schedule.b) We will probably do the same thing we did last year.c) We will need to consult with the students who will be involved to get their input before we proceed. Then we can work on making a schedule and setting deadlines.d) That is the next thing on our agenda. Let's get busy deciding on a schedule, activities, and deadlines. Can someone help me with this one too John's lyrics are somewhat autobiographical and introspective on this '65 song that features brilliant harmonies throughout and lyrics that offer help to the forlorn listener. It is... Which two statements best describes the purpose of the passage ? please Evaluate ( 8/3) to the 2 power A). 8/9 B). 64/9 C). 64/3 D). 55 Line CD passes through points (0, 2) and (4, 6). Which equation represents line CD? Which of the following was true when Truman met Stalin in Potsdam in 1945? A.Their two nations were already enemies The war in the Pacific was still being fought. Britain had decided not to join them. World War II had ended. Please Help asap!!! Please give explanation If the price of biscuit per packet increased from N250 to N500 and the quantity bought per week decreased from 300 to 200 packets, determine the elasticity of demand for biscuit. Please answer this correctly without making mistakes What is the slope of the line passing through the points (6,7) and (1,5) An education researcher claims that 58% of college students work year-round. In a random sample of 400 college students, 232 say they work year-round. At alphaequals0.01, is there enough evidence to reject the researcher's claim? Complete parts (a) through (e) below. It is a well-known fact that Dr. Barnes rides a skateboard, sometimes even on campus. Suppose that Dr. Barnes selects a skateboard by first picking one of two skateboard shops at random and selecting a skateboard from that shop at random. The first shop contains two "rad" skateboards and three "gnarly" skateboards, and the second shop contains four "rad" skateboards and one "gnarly" skateboard. What is the probability that Dr. Barnes picked a skateboard from the first shop if he has selected a "gnarly" skateboard? What the answer to the question If a circle has a diameter with endpoints of (-3, 0) and (5, 4) then the equation of the circle is? Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code. B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein. C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein. D) Both B and C are possible outcomes. g A spontaneous process is one in which: A. releases a large amount of heat B. may happen (is possible) C. will rapidly approach equilibrium D. will happen quickly Based on the function F(x) = x^4 - 3x^3+ x^2 +2 and the graph of G(X) below,which of the following statements is true? The goal of a statement of purpose is: 62(1+2) isn't that should be 1 , cause in the calculator it said 9 but the order is the parenthisis/brakets first ?? so it should be like 2 times 3 then 66 which gives 1 .