The following question is based on your reading of 1984 by George Orwell.

How or when do we know he is truly broken down?

Answers

Answer 1

Answer:

i want to say he broke down when he had some one die in his famly im not to sure but i was just trying to help

Explanation:

Answer 2

Answer:

he broke down when he had some one die in his family.


Related Questions

13 percent of adult Americans say they would absolutely refuse to even try recycled water, according to a recent study in the journal Judgment and Decision Making. “A small minority of people are very offended by this, and can slow it down or stop it because of legal and political forces,” said Paul Rozin, a psychology professor at the University of Pennsylvania who studies revulsion and a co-author of the study. –“Water Flowing from Toilet to Tap May Be Hard to Swallow,” John Schwartz Which piece of evidence best supports the author’s claim? Some politicians support the idea of using wastewater. Paul Rozin studies revulsion at the University of Pennsylvania. Thirteen percent of people in a study said they would never try recycled water. Judgment and Decision Making has posted a recent study related to recycled water.

Answers

Answer:

Thirteen percent of people in a study said they would never try recycled water.

Explanation:

This is because the main claim from the author is that people do not accept recycled water and will thus cause the progress to slow down.

The authors use the statistics in this excerpt to
describe the complexity of sumo scorekeeping.
explain in detail the intricacies of sumo wrestling.
make a case for the idea that sumo wrestling is rigged.
show the similarities in Japanese sumo and American wrestling.

Answers

Answer:

describe the complexity of sumo scorekeeping.

Hope this helps......

the score keeping and how it works

I HAVE TO WRITE A BIOGRAPHY ON SOMEONE I IDOLIZE AND LOOK UP TO I PICKED S H A H V E E R J A F R Y WHO IS A FAMOUS P A K I S T A N I YOU TUBE R... HOMEWORK IS DUE TONITE PLS HELP ME WILL GIVE BRAINLIEST PLS PLS HELP 25 PTS +BRAINLIEST!!!


I NEED AGE BACKGROUND FAMILY AND OTHER STUFF

Answers

Note: I am not able to mention his name and the platform he uses in my answer. I just left a blank line where I mentioned his name. I apologize for any confusion. I hope this helps!

___ was on November 26th, 1993 in Islamabad, Pakistan. ________ and his four brothers currently reside in Canada. While in Canada, ____ experienced major culture shock. His family’s overall culture and traditions were very different in comparison to his peers. Before upstarting his internet career, ____ attended school for business marketing. Though, throughout his whole life, he had a remarkable talent for comedy in which he claims to have inherited from his father. In 2013, ___ finally decides to take his talents to a new platform. Using his talent for comedy, he used his experiences as a person of color living in a majority white area to his advantage. With this, _______ was able to reach out to thousands of young teens with his relatable content.

Answer:

Explanation:

Use this format to help your write your essay:)

you are the Secretary of the friends of the environment club write a speech on the topic the need to keep the environment clean​

Answers

Answer:

good day my name is hankie,and I am here to tell you that we need to keep our environment clean our children our lying on the sick bed because of the bad environment and pollution we need to come up with a group that will clean the environment properly and maintain it very well and our children will be fine all we need to do is be developed and under developed so we need some people.

We also want to plead with the government for good resources and restoration in our country

midwife job description

Answers

Answer:

Explanation:

Midwives provide advice, care and support for women and their babies during pregnancy, labour and the early postnatal period. You'll help women to make their own decisions about the care and services they access and will provide health education and parenting advice until care is transferred to a health visitor.

Answer:As a midwife, you'll need to:

*monitor and examine women during pregnancy.

*develop, assess and evaluate individual programmes of care.

*provide full antenatal care, including screening tests in the hospital, community and the home.

*identify high risk pregnancies and make referrals to doctors and other medical specialists.

Read the sentence.

The peripheral nervous system—which is a network of nerves extending from your brain and spinal cord to all parts of your body carries signals back and forth.

Which revision of the sentence is now properly punctuated?

The peripheral nervous system—which is a network of nerves extending from your brain and spinal cord to all parts of your body carries signals back and forth.
The peripheral nervous system (which is a network of nerves) extending from your brain and spinal cord to all parts of your body carries signals back and forth.
The peripheral nervous system which is a network of nerves extending from your brain and spinal cord to all parts of your body carries signals back and forth.
The peripheral nervous system—which is a network of nerves extending from your brain and spinal cord to all parts of your body—carries signals back and forth.

Answers

I believe the correct answer is the last one

The peripheral nervous system—which is a network of nerves extending from your brain and spinal cord to all parts of your body—carries signals back and forth, is the properly punctuated revision. Thus, option D is correct.

What is punctuation?

Punctuation is the grammatical tools, symbols, and marks used for the correct structure and meaning of the sentence. In the given sentence hyphen (-) mark is used to join and interlink the two separate sentences.

Thus, a hyphen mark is inserted between the system—which, and body—carries.

Learn more about hyphens here:

https://brainly.com/question/27387883

#SPJ2

. If the prefix dis- means “exclude,” which bolded word means “to cause to be unfit”? Some tennis players are known to disagree with referee decisions. The passenger was disgruntled when the bus missed her stop. Runners knew that breaking the rules would disqualify them from the race. Because he was color blind, Will was not able to discriminate between red and blue.

Answers

Answer:

Runners knew that breaking the rules would disqualify them from the race.

Explanation:

They will not be allowed to run cuz breaking rules will show dat they r unfit to do the race

Hope this helps....

                              Pls mark my ans as brainliest :)

Read the excerpts from "The Royal House of Thebes" and "The Story of a Warrior Queen."

"We are women," she told her sister. "We must obey. We have no strength to defy the State." "Choose your own part," Antigone said. "I go to bury the brother I love." "You are not strong enough," Ismene cried. "Why, then when my strength fails," Antigone answered, "I will give up." She left her sister; Ismene dared not follow her.

–"The Royal House of Thebes"

Again and again the Romans were defeated, till it almost seemed as if the Britons really would succeed in driving them out of the country. Boadicea herself led the soldiers, encouraging them with her brave words. "It is better to die with honor than to live in slavery," she said. "I am a woman, but I would rather die than yield. Will you follow me, men?" and of course the men followed her gladly.

–"The Story of a Warrior Queen"

How are the themes presented in these two passages similar?

They both express the theme that women are as capable as men.
They both express the theme of loyalty to one's country.
They both express the theme that divine law comes above mortal law.
They both express the theme that family ties are stronger than political ones.

Answers

Answer:They both express the theme that women are as capable as men

Explanation: In the beginning paragraph of “The Royal House of Thebes” she says, “We are women, we must obey.” But her sister does not follow this rule. In “The Story of a Warrior Queen she says, “I am a woman, but I would rather die than yield.” And she does so as well

They both express the theme that women are as capable as men are the themes presented in these two passages similar. Hence, option A is correct.

What is the concept of the passages?

The word "defy" in the first passage clearly implies that Antigone is acting in a rebellious manner. Boadicea is "encouraging them with her courageous words" in the meantime. The second passage portrays her throughout as a warrior.

In these two passages, various archetypes are presented. Boadicea is depicted as a warrior, whereas Antigone is portrayed as a rebel, that is shown in the passage.

In "The Royal House of Thebes," despite her sister's pleadings, Antigona refuses to submit to the State. She rebels against the gender-specific expectations placed on her.

Thus, option A is correct.

For more details about click here:

https://brainly.com/question/11150668

#SPJ6

QUICKEST ANSWER GETS BRAINIEST List two events and give examples from your life, explaining how each event shaped you.

Answers

Answer:

i almost died playing with a baby bear and i almost died of poison

Explanation:

I've learned that if there is a baby bear the mama is always around and now i fear bears. i also almost died eating something i shouldn't and now i always check what I'm eating

1. my father walking out on me and my mother, he walked out because i was unwanted and my mother was no longer his type, i grew up angry at the world and hated just hearing his name. How did this event shape me? It made me realize that nobody is perfect, and that he made a large mistake that day, i recently got back into contact with my father and it has been amazing. It also made me realize that, while i didn’t have a father figure in my life, school teachers seriously teach you a lot, from tying your shoes to what’s right and what’s wrong, so i guess another thing that taught me was immense respect for those older than me.

2. discovering the game of soccer. When i say discover i don’t mean oh my gosh wow i just love kicking this ball around, which i did, but i mainly loved the friends i made from it, the late nights i stayed up to do my home work and studies, and all the values it taught me, a few of which are, watch your mouth because people hear everything, don’t be greedy because life isn’t just about you, and you’re not the only one going down this road, there are many others with you! It also taught me that being in shape, is very important as you move, feel, look, and even think different when you’re in shape. How did this shape me? It led me to getting a scholarship for college which made me the man i am today! - I hope this helped!

Activity
You've learned about the types of claims an author can make, as well as how an author supports those claims. In this activity,
you'll use what you've learned to analyze, discuss, and write an essay that defends or challenges the claims an author makes.
Part A
Read “Technology: Using it wisely e." Then analyze the argument by rereading each paragraph and recording your notes
in the table. Remember, to determine the credibility of the details and evidence in the passage, you may need to conduct
research or use your own experience and background knowledge.
Paragraph 1
Claim 1
Evidence and Details
Commentary
Explicit and Implicit
Meanings
Paragraph 2
Claim 2
Evidence and Details
Commentary
Explicit and Implicit
Meanings

Answers

Answer:

In “Technology: Using it Wisely,” the author claims that technology limits children’s brain development and that it negatively impacts the way people exercise.

To support the claim that technology limits children’s “healthy brain development,” the author cites evidence from “scientists and researchers” who state that technology “limits growth and creativity.” The author goes on to say that most computer games and forms of digital entertainment are not “intellectually challenging.” The author also implies that these types of games and entertainment could actually be harmful to childrens’ ability to think creatively.

To support the claim that technology negatively affects the way people exercise, the author provides details in the form of generalizations. For example, the author states that “many people” exercise indoors in gyms. The author goes on to state that people’s bodies are not being properly nourished because they aren’t spending enough time exercising outdoors. Additionally, the author states that a “walk in the woods” or an “open-air run” is vastly more effective than spending time “running on a treadmill.”

I believe the author’s credible evidence related to the first claim that technology limits “growth and creativity” in school-aged children. However, the author doesn’t include any credible evidence to prove that the additional details used to support that first claim are accurate. Personally, I have seen many computer-based activities and games that actually do help students learn new information and skills. The author’s second claim is also not supported by any data or credible evidence, so I find it hard to believe that working out in a gym offers significantly fewer benefits than walking or running outdoors. Therefore, based on the lack of evidence and credible details provided, I disagree with the author’s claims.

Explanation:

actual answer from PLATO

Answer:

Paragraph 1

Claim 1 Technology does not support healthy brain development in school-aged children.

Evidence and Details

Scientists and researchers think school-age children’s use of cellphones and tablets “limits the growth of creativity.”

Very few of the computer games and digital entertainment options that children use are “intellectually challenging.”

Commentary

The evidence about the effect of technology use on creativity is somewhat credible because it comes from science experts.

The detail that few computer games and digital entertainment options are “intellectually challenging” lacks support from a credible source, so it may not be a trustworthy fact.

Explicit and Implicit

Meanings

The author explicitly states the belief of experts that technology “limits the growth of creativity.”

By saying that “only a handful” of computer games and entertainment options are “intellectually challenging,” the author is implying there is almost no value in having children engage in these activities. This statement also implies that such activities could actually harm children’s ability to become creative thinkers.

Paragraph 2

Claim 2 Technology has had a negative impact on the way people exercise.

Evidence and Details

Many people work out in gyms, which are in enclosed spaces that are similar to their office work environments.

People are not getting enough fresh air, which is something our bodies need for “nourishment.”

A “walk in the woods” or an “open-air run” is much more “effective than running on a treadmill.”

Commentary The three details that the author uses to support the claim about technology and exercise are generalizations. They seem to be based on personal experience and background knowledge rather than facts and evidence from experts or other credible sources. Therefore, the author’s statements lack credibility.

Explicit and Implicit

Meanings The author explicitly states her or his beliefs about the need for outdoor exercise. The author implies that working out in a gym is an ineffective and “negative” way to nourish the body.

Explanation:

PLOTO

Write an advertisement for an imaginary haunted house. Use rich imagery in your description to make the place seem both scary and fun. Imagine the medium the advertisement will appear in, such as a website or a commercial on the radio, and adapt the text to fit. End the advertisement with some kind of enticing cliff-hanger that will make the audience want to find out what happens there.

Answers

Answer:

The Creepy Goblin House

About the property:

You will never want to leave this repulsive, gigantic 5

bedroom house. Full of spider webs and mice scurrying across

the floor. The grisly, dirty, old wood floors creek with every step

you make. There are 7 broken windows to allow creatures from

the outside to live with you. In addition, there is a large pool of

mud and dirt in the back yard for your kids to enjoy.

Located at:

722 Ghoulish Way

Slimeville, MD

sold by:

Ghosts and Goblin

Realtors

Featuring:

3 Stinky Bathrooms

5 Dark Bedrooms

Pool of mud and dirt

Mice, spiders, and ants

5 Freaky Ghosts

plz mark brainlist

Refer to Explorations in Literature for a complete version of this story
In the story "The Bet," what would be the best theme for this story?
O Time heals all wounds.
O Time goes by slowly when you aren't busy.
O To be happy one must be wealthy
O There are things in life that are more meaningful than money

Answers

Answer:

the last option

Explanation:

not only in the story does the author talk about life but aswell as crime punishment freedom etc

What does SUD mean when filling out a return to school form?

Answers

Hope this helps.. substance use disorder

What organizational method is used in the following passage? The bridge collapsed because it was constructed on ground that was not firm. Then the rains softened the soil and, finally, the small earthquake hit. A. order of importance B. chronological

Answers

A I’m Assuming because they could be cause and effect
The earthquake isn’t influenced by the previous events. It is in chronological order as this is the order that it happened in

a speech for the debate competition on the topic" save the children" on the team "for" and "againt"​

Answers

Answer:can you possibly post the speech?

Explanation:

my father gave him many advices correct this sentence

Answers

Answer:

His father gave him an advice

Answer:

My father gave him advice.

Explanation:

advice has no such plural form, and it is an uncountable noun.

many advices is grammatically incorrect.

The correct sentence would be:

My father gave him advice.

*PLEASE ANSWER MAKE SURE ITS ANSWERED CORRECTLY* What information should you include in a citation for a quote from an encyclopedia--if the citation is integrated into the sentence? a.) with the volume number and page number b.) the title of the encyclopedia and the title of the encyclopedia entry c.) the title of the encyclopedia followed by the volume number d.) the title of the encyclopedia and the page number where the quote appeared

Answers

Answer:

The correct answer is option d.) the title of the encyclopedia and the page number where the quote appeared.

Explanation:

Of all the options given, the best option is D.

It would be much better if you could include more complete information such as an editor's name and the volume of the encyclopedia, but if you do not have this information you can leave it out of your citation.

But it would be best if you at least have the name of the encyclopedia and the page number where the quote comes from.

So we can say that the correct answer is option D.

The correct answer is D

*15 POINT QUESTION* Read the following passage and answer the question. What man is there, what human being, who attains a greater happiness than mere appearances, a joy which seems to fade away to nothing? Which phrase best paraphrases the passage above? Answers: A. It's a good thing all men are happy. B. Can't we all just get along? C. Is there anything such thing as happiness that lasts? D. A man's appearance brings the greatest happiness.

Answers

Answer:

C. Is there anything such thing as happiness that lasts?

Answer:

C. Is there anything such thing as happiness that lasts?

What is the effect of a lifetime of adhering to the virtue Sincerity?
A. knowledge
B. ease of life
C. wealth
D. honor

Answers

Answer:

D. Honor

Explanation:

D. Honor

Hope this helps :)

Can someone pls write me a biography of the author J. W. Lynne. This should be at least one page long.

Answers

Answer:

J.W. Lynne writes inventive stories with twists, turns, and surprises. In ABOVE THE SKY, teens search for the truth in a seemingly-utopian society founded on lies. In THE UNKNOWN, eight children are kidnapped in the night and wake up in a mysterious world full of secrets. In LOST IN LOS ANGELES, a young woman must decide whether to trust an intriguing young man who she meets in a coffee shop. In LOST IN TOKYO, a college student carries out her missing mother's bucket list in a desperate attempt to finally find her. KID DOCS dives into the behind-the-scenes action at a hospital where gifted young children are trained to become pint-sized doctors. In WILD ANIMAL SCHOOL, a teen spends an unforgettable summer caring for elephants, tigers, bears, leopards, and lions at an exotic animal ranch.

Explanation:

I soon found the advantage of this change in my manners. The conversations |
engaged in went on more pleasantly. The modest way in which I proposed my
opinions, procured them a readier reception and less contradiction; I had less
mortification when I was found to be in the wrong, and I more easily prevailed
with others to give up their mistakes and join with me when I happened to be in
the right.
Which of the following was NOT an effect of Franklin's working toward humility?
A. Franklin noticed that his conversations with others were more pleasant.
B. Franklin found that he was in the right more frequently than ever before.
C. Franklin learned that when he was found to be incorrect, he was less
embarrassed.
D.Franklin saw that he was more effective in convincing others to agree with his opinions

Answers

Answer:

B

Explanation:

not A

"I soon found the advantage of this change in my manners"

not C

" The modest way in which I proposed my opinions, procured them a readier reception and less contradiction; I had less mortification when I was foud to be in the wrong"

not D

" I more easily prevailed with others to give up their mistakes and join me when I happened to be in the right"

HOPE THIS HELPS!!!:)

How does nature in Wordsworth's poetry differ from nature in Byron's description of the Byronic hero?

Answers

Answer:

Wordsworth tends to see Nature as 'out there'; a presence that surrounds humans, and contributes to human life, but is different from humans. If you look at a typical Wordsworth poem (There was a boy, ye knew him well ye rocks) - Wordsworth talks about Nature as something that needs to be learned about and understood, Nature is different from us.

If you look at a Byron poem (The Isles of Greece is a good one) - Byron looks at Nature mainly for what it already means to Man. Wordsworth will look at a landscape and see the mountains, trees, valleys, and rivers as almost spiritual presences - Wordsworth wants to get to know Nature.

Byron will look at the same landscape and he will want to know who lives there, what are the villages? Are there any farms or mines, is there some history?

Wordsworth looks at Nature for what it is; Byron is forever asking what it means.

Wordsworth thinks that humans are part of Nature; Byron thinks that Nature is part of being human.

When you read a Byron poem, you'll see that Byron primarily considers Nature in terms of what it already represents to Man. When Wordsworth sees a landscape, he sees the mountains, trees, valleys, and rivers as nearly spiritual presences; he wants to know Nature.

Wordsworth's poetry and Byron's:

Nature, according to Wordsworth, is something that has to be taught about and understood since it is distinct from us.

When Byron sees the same area, he wants to know who lives there and where the communities are. Is there any history, such as farms or mines?

Wordsworth sees Nature for what it is, but Byron is always wondering what it means.

Humans, according to Wordsworth, are a part of Nature, while Nature, according to Byron, is a part of being human.

Find out more about 'Byron'.

https://brainly.com/question/9527212?referrer=searchResults

Review the module writing prompt. How have these two authors expressed their relationships with nature? After reading and analyzing "Calypso Borealis," an essay by John Muir, and William Wordsworth's poem "I Wandered Lonely as a Cloud," write an essay in which you describe how each author views nature and answer the question. Support your discussion with evidence from the text. Using what you learned in the lesson, write an effective hook to introduce your topic and get your audience's attention. Write in complete sentences and state the hook strategy you chose to use.

Answers

Answer:

Explanation:

Authors above written in their masterpiece views nature as the most beautiful thing that they have ever felt.

They have recognized how beautiful and wonderful life is.

By reading their piece, it seems like they had some deep connection with what they have written about clouds, air, plants, and trees.

It feels like they feel what they have written into their piece of beautiful art.

Answer:

Nature is the antidote for the sickness of life, it is needed to have a sane, happy life.

-For my hook sentence, I used an unusual way to define nature in order to capture my readers interest. 

Explanation:

The hook should only be one to two sentences long. I also got this question correct when I submitted it.

(Please mark Brainliest.)

The French teacher, Mr. Bueller, realizes that Victor is faking his knowledge of French. Identify the event from Mr. Bueller’s past that leads him to keep the truth to himself. In what way does his decision help advance the plot? ( BTW this question is based off the story “Seventh Grade” by Gary Soto”

Answers

Answer:

Victor makes funny faces throughout the school day, as he believes that making people laugh is the most important thing. Victor is willing to do anything to get Teresa's attention, even if it means lying, because he likes her so much.

Explanation:

hope this helps...

Answer:

The French teacher, Mr. Bueller, realizes that Victor is faking his knowledge of French. Identify the event from Mr. Bueller’s past that leads him to keep the truth to himself. In what way does his decision help advance the plot? ( BTW this question is based off the story “Seventh Grade” by Gary Soto”

1

SEE ANSWER

Explanation:

PLEASE ANSWER MY QUESTION IN THE COMMENT, ANSWERS DOESn'T WORK FOR ME!!! :( IT'S ABOUT THE BOOK WIZARD OF OZ PLEASE HELP!!! :((( I DON"T HAVE THE BOOK!!! I WILL GIBE BRAINLIEST WHEN IT FINALLY WORKS :))!!!!!!!! What relationships are important/influential in this Dorothy's life? List three examples explaining how each shaped the character.

Answers

Answer:

3. Scarecrow.

2. The Wizard of Oz.

1. Toto.

Explanation:

Every relationship that Dorothy forms- both in the book and film- are important to her growth both as a character and a person in the real world. Try and put yourself in her shoes. You are living with your relatives when all of a sudden, a cyclone(or any natural event) whisks you away from them. How hard can that be? Forming new bonds and relationships can help to diminish some of that pain. I will explain why I think the bonds listed above are the most important:

1. Toto.

Toto is Dorothy's lovely companion throughout this entire tale. He sticks by her side, even as times get rough. This dog is just as humane as all of us combined, and he is one of the most important bonds that Dorothy will ever have.

2. The Wizard of Oz.

Even though his arc comes later than expected, this phony wizard is really nothing more than a sympathetic old man. He just wanted to feel accomplished, but he earned it through lies and shady practices. He is easy to understand, and even helps Dorothy return home. This is an influential bond that Dorothy has.

3. Scarecrow.

This man made of nothing but straw and more straw is one of the most humane protagonists to ever exist. His plight is easy to get: he wants to feel smart. Don't we all from time to time? His goal is simple: to go to the ruler of his land and ask for brains. Even though he is a bit naive, the Scarecrow man is much more intelligent than he appears. He is both important and influential to Dorothy.

Hopefully this helps you with your inquiry. I would advise reading the book to get your own opinion. Or watch the movie. It is a lovely adaptation.

the order is scarecrow, wizard of oz, and toto

What’s is the difference about an argumentative essay to a persuasive one? Also, can you explain me if I write a persuasive essay do I need to use a counterargument?

Answers

Answer:

A essay of argumentative text where you must express your personal opinion

A convincing essay is its own to convince

Explanation:

and do not oblige for conterargument

Answer:

Argumentative essays is based on logic, evidences and reasoning. These types of essays used straight facts and research to convince readers that your writing is true. On the other hand, Persuasive essays used emotions, personal ideas, etc.. to convince the reader to agree to their writings because of the emotional appeal. You don't need to research or gather evidences when writing persuasive essays, that's why you don't need counterarguments.

Explanation:

Which three literary elements do writers use to "show" readers a story’s setting rather than "tell" them about it?

Answers

Answer:

The story writer or poem writer uses imagery to 'show' the readers rather than to 'tell' them about it

There are 5 types of imagery

Visual imagery (sight)

Visual imagery (sight)Auditory imagery (hearing)

Visual imagery (sight)Auditory imagery (hearing)Olfactory imagery (smell)

Visual imagery (sight)Auditory imagery (hearing)Olfactory imagery (smell)Gustatory imagery (taste)

Visual imagery (sight)Auditory imagery (hearing)Olfactory imagery (smell)Gustatory imagery (taste)Tactile imagery (touch)

Using sound, visual, and other types of imagery

from Romeo and Juliet Act 2, Scene 2: What is most closely a theme of the passage below? “JULIET: ’Tis but thy name that is my enemy. Thou art thyself, though not a Montague. What’s Montague? it is nor hand, nor foot, Nor arm, nor face, nor any other part Belonging to a man. O, be some other name! What’s in a name? That which we call a rose By any other name would smell as sweet. So Romeo would, were he not Romeo call’d, Retain that dear perfection which he owes Without that title. Romeo, doff thy name; And for that name, which is no part of thee, Take all myself.” Question 14 options: a) It is important to change one’s name before marriage. b) Names can drive people apart. c) Names are a reflection of the actual person. d) A name in itself lacks physical reality because it can be easily changed.

Answers

Answer:

I think the answer is d "a name itself lacks physical reality because it can be easily changed" :)

Explanation:

Psychology 1A

Question:

“What did you have for dinner last night?” The answer to this question is in your ___ memory ___ which was encoded ___ as you ate dinner last night.

Answer:

Implicit; effortfully

Explicit; effortfully

Implicit; automatically

Explicit; automatically

Answers

The answer is implicit, automatically

When Eddie ask the blue Man “ how long have I been dead?” and the blue man response “a minute. An hour. A thousand years” what does he mean?

Answers

I haven’t read whatever book this is from, BUT here is my input.

The blue man means that it doesn’t matter how long Eddie has been dead. It’s like how long you’ve been asleep, you don’t remember it and it doesn’t ever feel as long as it actually was. The blue man means that time doesn’t matter in this instance.

Answer:

xcvlkjhgfdxghjk

Explanation:

Other Questions
Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code. B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein. C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein. D) Both B and C are possible outcomes. g A spontaneous process is one in which: A. releases a large amount of heat B. may happen (is possible) C. will rapidly approach equilibrium D. will happen quickly Based on the function F(x) = x^4 - 3x^3+ x^2 +2 and the graph of G(X) below,which of the following statements is true? The goal of a statement of purpose is: 62(1+2) isn't that should be 1 , cause in the calculator it said 9 but the order is the parenthisis/brakets first ?? so it should be like 2 times 3 then 66 which gives 1 . Which of the following pitches is a non-chord tone for the I chord in G major? - G - B - A - D When a negative amount is in the base period and a positive amount is in the analysis period (or vice versa), a meaningful percent change cannot be calculated.A. TrueB. False A cookie recipe requires 3 teaspoons of baking soda for 36 cookies. If the baker would like to make 480 cookies, how much baking soda will be required? a13.33 teaspoons b12 teaspoons c40 teaspoons d108 teaspoons The flesh of infants may be used asgloves and summer boots Swift objects to eating girls as old as 14because they would serve better asbreeders, and because people wouldobject that it is "a little bordering oncruelty"Although there are many suffering"aged, diseased," or injured people,nothing needs to be gone for thembecause they are already dying "as fastas can be reasonably expected"Poor Irish tenants, who have already soldtheir crops and cattle to pay the rent,will now be able to pay by selling theirchildren Jerry solved the system of equations. x minus 3 y = 1. 7 x + 2 y = 7. As the first step, he decided to solve for y in the second equation because it had the smallest number as a coefficient. Max told him that there was a more efficient way. What reason can Max give for his statement? The variable x in the first equation has a coefficient of one so there will be fewer steps to the solution. The variable x in the second equation has a coefficient of 7 so it will be easy to divide 7 by 7. The variable y in the second equation has a coefficient of 2 so it will be easy to divide the entire equation by 2. The variable x in the second equation has the largest coefficient. When dividing by 7, the solution will be a smaller number. Probability of landing on even # on a spinner; probability of rolling an odd # on a die The amount of flow through a solenoid valve in an automobile's pollution-control system is an important characteristic. An experiment was carried out to study how flow rate depended on three factors: armature length, spring load, and bobbin depth. Four different levels (low, fair, moderate, and high) of each factor were chosen, and a single observation on flow was made for each combination of levels.A) The resulting data set consisted of how many observations?B) Is this an enumerative or analytic study? Explain. Simplify each expression. 6mn3 -mn2 + 3mn3 +15mn2?? Read the following excerpt. The journalist spent a year researching the foreign government's sanctions. Finally, it was time to synthesize all of the relevant information that he had learned. His editor asked him to write a comprehensive article for the first piece in the series that was sure to win awards, inform the public, and elicit significant change in foreign policy. Using the context, the word "elicit" meansdeclarecausecriticizeend y=tan(x-30) period and amplitude which platonic solid has eight faces that are equilateral triangles? A, dodecahedron, B, octahedro, C, tetrahedron, D, icosahedron Families USA, a monthly magazine that discusses issues related to health and health costs, survey 19 of its subscribers. It found that the annual health insurance premiums for a family with coverage through an employer averaged $10,800. The standard deviation of the sample was $1095. A. Based on the sample information, develop a 99% confidence interval for the population mean yearly premiumB. How large a sample is needed to find the population mean within $225 at 90% confidence? (Round up your answer to the next whole number.) how to see the answer If a mutation occurs in a somatic cell that leads to a non-functional protein, what will happen to that somatic cell?A. It will prevent the cell from completing the cell cycle.B. It will enable the cell to fix the mutation. C. It will prevent the cell from finishing the S phase.D. It will continue through the cell cycle as normal There are grammatical error in the sentences given bellow , Circle the mistakes in each sentence , then rewrite the sentence . If there aren't any mistake, Put a tick mark next to the sentence. 1) Shall we do have a meeting on afternoon Saturday? 2)Can I do get you a glass juice of? 3) Let me take you home 4) If you want , I'll car the wash for you 6)Shall home we go now 6) Would like you another glass of juice? 7)You should finish you work today 8)Can I take help you with something? 9) Shall i bring your jacket? 10 Let's to go to the sushi restaurant for lunch.