Ronald Reagan Group of answer choices was the U.S. President who took on Khrushchev during the Cuban Missile Crisis. was the U.S. President who ended the Iran Hostage Crisis and the Cold War. was the U.S. President who ordered the atomic attack of Hiroshima and Nagasaki. All of the above.

Answers

Answer 1

Answer:

The answer is B. Ronald Reagan was the U.S. President who ended the Iran Hostage Crisis and the Cold War.

Explanation:

The U.S. President who took on Khrushchev during the Cuban Missile Crisis was John F. Kennedy.

The U.S. President who ordered the atomic attack of Hiroshima and Nagasaki was Harry S. Truman.


Related Questions

How did Kennedy's presidency affect the nation during the Cold War?

Answers

Answer:

Kennedy had successfully quelled what was arguably the Cold War's edgiest situation. Perhaps inspired by his successful diplomatic resolution of the Cuban Missile Crisis, Kennedy attempted to pursue diplomacy in other situations.

please hurry ! The Ottoman's became known as great seamen and navigators. How would this effect the economy of the Ottoman Empire? a) Maritime trade would open export markets to a wider audience. b) The Ottoman Empire because the largest ship builders in the world. c) The large Turkish navy would drain heavily on the Ottoman treasury. d) The economy of the Ottoman Empire was not affected by its navy.

Answers

Answer:

A.

Explanation:

The Ottomans became known as great seamen and navigators. Maritime trade would open export markets to a wider audience would this affect the economy of the Ottoman Empire. The correct option is A.

What were the Ottomans known for?

The Ottoman Empire was renowned for its contributions to art, science, and medicine. Istanbul and other important cities throughout the empire were regarded as centers of the arts, particularly during Suleiman the Magnificent's rule.

The Ottomans relied more on their land. They conducted trade both within and outside of their empire. They gained entry to Europe after taking Constantinople, where they were able to slightly widen their sphere of influence. Not that the Ottomans never engaged in the maritime trade of any kind.

Thus, the ideal selection is option A.

Learn more about The Ottoman Empire here:

https://brainly.com/question/19205737

#SPJ3

"Three Sisters" farming was an agricultural system of companion planting innovated by the Iroquois-
speaking peoples of the Northeast; farmers planted corn, beans, and squash together. The beans used the
cornstalks as a trellis to grow on, but how did beans benefit the other two plants in the system?
Choose 1 answer:
Bean shoots reached out and strangled weeds, leaving the way clear for the other companion
plants
B
Bean leaves provided crucial shade for the squash, which can be damaged by too much direct
sunlight; the shade enabled the squash to develop vital nutrients
Bacteria on the roots of beans 'fix' nitrogen from the atmosphere into the soil, fertilizing the
earth for the benefit of the corn and squash

Answers

Answer:

The last choice.

Explanation:

Beans help the nitrogen cycle along, while many other crops tend to destroy it if used too long. Thus, farmers rotated crops like beans into the cycle to allow fields to "recharge" their nitrogen content so that more popular crops like wheat and corn would have nutriets to grow by.

In the agriculture system of ''Three Sisters'', the beans benefited the other two plants like corn and squash, as the Bacteria on the roots of beans 'fixed' nitrogen from the atmosphere into the soil, fertilizing the earth for the benefit of the corn and squash. Therefore, the option C holds true.

What is the significance of the ''Three Sisters'' agricultural system?

The ''Three Sisters'' agricultural system was sought as an ideal way of practicing agriculture in the United States, as the three crops grown in this system complemented the growth of each other, and had the least amount of effect over the fertility of the soil on which it was practiced.

Therefore, the option C holds true and states regarding the significance of the Three Sisters agricultural system.

Learn more about the ''Three Sisters'' agricultural system here:

https://brainly.com/question/24430651

#SPJ2

Read the excerpt from Thomas Paine's Common Sense. What techniques does he use here to convince reluctant colonists that they should seek independence from Great Britain? What reasons does he mention for why a colonist might want to remain loyal to Britain, and how does he dismantle those reasons?

Answers

Answer:

He used common Colonial language to make colonies understand and unite.

Explanation:

Thomas Paine played a significant role by publishing pamphlet named Common Sense, which encouraged the colonists to think of the present situations and to fight against the British. In Common Sense, Paine argued about politics and talked about moral. His pamphlets became the source for the colonists to come together as patriots to fight for their independence. The reason for the colonist to remain loyal to Britain was the benefits, which included naval protection, free-trading area, easy credit, cheap manufactures, etc. Paine urges colonies to progress without British support and think about good for the community. According to Paine, he denounced the monarchy and argued for equality.

Can anyone help me with this and explain how you got your answer? Brainiest and reward!!!

Answers

Answer: Choice A

CF is perpendicular to AE

=================================

Why is this?

Because triangle AFC is congruent to EFC, we can see that angle AFC = angle EFC (by CPCTC). Then notice how the two angles in question form a straight angle of 180 degrees. If each angle is x degrees, then,

x+x = 180

2x = 180

x = 180/2

x = 90

So angle AFC and angle EFC are both 90 degrees each. This leads to showing CF is perpendicular to AE.

Side note: triangle AEC is isosceles with AC = CE

Answer:

A. Line CF is perpendicular to line AE.

Explanation:

If you take a look at lines CF and AE, you can see that they are perfectly perpendicular.

Hope this helped and good luck! :)

This map shows the spread of Islam by 750 CE. Which list of present-day nations best represents the areas where Islam had spread by 750 CE?

Answers

The correct answer to this open question is the following.

Unfortunately, you forgot to attach the map.

However, we can say the following. The present-day nations best represented in the areas where Islam had spread by 750 CE are Spain (most of the Iberian Peninsula), the southwest part of France. Of course, all the Arabian peninsula, the United Arab Emirates, Saudi Arabia, Qatar, Yemen, Oman, Iraq, Syria, Iran, Jerusalem, Jordan, parts of Afghanistan and Pakistan, and the region of North Africa, including Egypt, Morocco, parts of Argelia and Libya.

Islam spread during these years through trade, conquests, and evangelization. The Umayyads did not force conversion to Islam but tried to persuade people to embrace the Muslim religion. The Umayyads moved the capital from Mecca to Syria, in the Middle East.

Answer:

Iraq, Afghanistan, Egypt, Morocco, and Spain

Explanation:

i got this right on a test, hope it helps

The Habeas Corpus Act of 1679 contributed to what political development? A. The outbreak of a civil war B. The overthrow of King James I C. The limitation of monarchical power D. The rise to power of William and Mary

Answers

Answer:

C) The limitation of monarchical power

Explanation:

The Habeas Corpus Act strengthened the ancient and powerful writ which had been a feature of English Common Law since before Magna Carta. It served to safeguard individual liberty, preventing unlawful or arbitrary imprisonment. Habeas Corpus is Latin for “you may have the body” – subject to legal examination before a court, or a judge.

The Act contributed to the limitation of monarchical power.

The Habeas Corpus Act 1679 was Act enacted on 27 May of 1679 in England.

Its is important to understand that during this period, England practiced Parliament system of government with a Monarch as the Head of state.

The Act provisions required court in England to examine thoroughly the lawfulness of a prisoner's detention and thus preventing any unlawful imprisonment.

Thus, the Act prevented the monarchs from having opponents arrested because of power vested in them.

In conclusion, the Act was established in line with the England constitution which requires check on power of the Monarch.

Learn more about Habeas Corpus Act 1679 here

brainly.com/question/20726327

Many Asian immigrants came to the United States in the 1960s and 1970s because of push factors, including
the possibility of religious freedom.
economic opportunities.
the chance of family reunions.
poverty and chaos.

Answers

Answer: D) poverty and chaos.

The primary reason for Asian immigrants to come to America was economic opportunity.

When did the Asian immigrants came to America?

The first great wave of Asian immigration to the continental United States happened mostly on the West Coast at some stage in the California Gold Rush.

Asian immigrants had been sought, no longer only in California, but throughout the US, to fill the excessive demand for reasonably-priced hard work in mines, factories, and on the Transcontinental Railroad.

Some plantation proprietors in the South sought Chinese hard work as a reasonably priced approach to replace the unfastened hard work of slavery.

Therefore, from the above announcement, it is clear that economic opportunity is suitable answers

Learn more about Asian immigrants, refer to:

https://brainly.com/question/15295503

Drag the following terms or phrases to the sentences in which they belong.

Answers

Answer:

1.Nationalism

2.third

3.Haiti

4.first and second

5.absolute monarchies

Explanation:

it says correct on edmentum

Nationalism, third, Haiti, first and second and absolute monarchies are the correct match of the sentence.

What is Nationalism?

Nationalism is the belief that your country, which is frequently defined by a common ethnicity or set of ideals, is superior to all other countries.

Aggression toward other nations is one way that nationalism can be manifested, and it frequently is.

Thus, these statements are matched in above sentence.

For more details about Nationalism, click here:

https://brainly.com/question/1018147

#SPJ5

During the Gilded Age the US population rose

Answers

Answer: nearly 40 million.

Explanation:

Answer:

During the gilded age the US population rose from nearly 40 million in 1870 to nearly 80 million in 1900

Explanation:

edge 2021

Select the correct answer.
Who established the imperial rule of Japan?
O A
descendants of the Sun
O B. descendants of Akitsu Mikami
O c.
descendants of Inari
OD
descendants of Ninigi-no-Mikoto
Reset​

Answers

Answer:

i pretty sure its d

Explanation:

i took the quiz

Answer : D) descendants of Ninigi - no - Mikoto reset
***HOPE THIS HELP YOU***

Which of the following was NOT something the West offered to pioneers? A. security B. opportunity C. freedom D. land

Answers

Answer:

Hey there!

I think the answer is A. Security. As America was expanding, people went to the west for more jobs, (opportunity) and more land. Thus, they were more free to do what they wanted.

Hope this helps :)

Answer:

Security

Explanation:

This is the answer because there wasn't high technology at the time and you had to be prepared

The influence of Montesquieu's idea of a separation of powers on the founders of the United States is BEST seen in which document? A the Bill of Rights B the U.S. Constitution C the Articles of Confederation D the Declaration of Independence

Answers

Answer:

B.

Explanation:

The US constitution states that the government will have three branches: Executive, Legistlative, and Judicial

How can the First World War be regarded as a "total war?" Can I please get help

Answers

Answer: who knows

Explanation:

The Fertile Crescent includes parts of Iraq, _____ and Israel.

A. Saudi Arabia
B. Syria
C. Jordan
D. Iran

Answers

Answer:

Thee answer is B and it's correct.

Explanation:

The Fertile Crescent includes parts of Iraq, _____ and Israel.

A. Saudi Arabia

B. Syria

C. Jordan

D. Iran

Answer:

B- Syria

Explanation:

The Fertile Crescent includes part of Iraq, Syria, and Israel.

How much should a 13 year old weight

Answers

Answer:it depeendes on her

Explanation:

Answer: The average weight of 13-year-old boys is 51.64 kg

Explanation:

Why were Thomas Jefferson and Alexander Hamilton political opponents?

Answers

Answer:

Jefferson was an Anti-Federalist and Hamilton was a Federalist

Explanation:

Jefferson believed in state's rights, a weak national government, and laissez-faire economics, and Hamilton believed in a strong federal government that would have an active role in helping the economy.

According to current NIH Guidelines, which of the following is adequate justification for exclusion of women from NIH-funded research?

There is compelling evidence that inclusion would be inappropriate with respect to the health of the subjects.
Inclusion of women would complicate analysis of the results and increase the costs of conducting the clinical trial.
The woman is of child-bearing potential.

Answers

Answer:

There is compelling evidence that inclusion would be inappropriate with respect to the health of the subjects.

Explanation:

The National Institutes of Health Guidelines outline safety standards and management protocols for clinical research including recombinant or synthetic nucleic acid molecules, the development, and utilization of organisms and viruses containing recombinant or synthetic nucleic acid molecules. The exclusion of women based on health risk raises the question of sexual bias because the same risk is there for men in the research.



Under the Dominion of New England, American colonists

A .felt the rights secured for them by the Magna Carta were being violated.

B. were empowered by the rights secured for them by the Magna Carta.

C. had more flexibility to own land and other forms of property.

D. were no longer subjected to the authority of the English king.

Answers

Answer:

A. Felt the rights secured for them by the Magna Carta were being violated.

Explanation:

The Dominion of New England was the unification of several states in New England that was done as an administrative purpose by King James II of England in 1686. This union was part of a larger plan that will lead to further power to tighten control over the American colonies.

This political move led to the British government exercising more power over the colonies in America. This also led to the colonists feeling that their rights under the Magna Carta were being violated. The Magna Carta that was created in 1215 guaranteed certain rights of the people and also provided them protection as regards to their interests. So, the establishment of the Dominion was contradictory to the ideals of the Magna Carta.

Thus, the correct answer is option A.

Answer:

A. Felt the rights secured for them by the Magna Carta were being violated.

Explanation:

The Dominion of New England was the unification of several states in New England that was done as an administrative purpose by King James II of England in 1686. This union was part of a larger plan that will lead to further power to tighten control over the American colonies.

This political move led to the British government exercising more power over the colonies in America. This also led to the colonists feeling that their rights under the Magna Carta were being violated. The Magna Carta that was created in 1215 guaranteed certain rights of the people and also provided them protection as regards to their interests. So, the establishment of the Dominion was contradictory to the ideals of the Magna Carta.

Thus, the correct answer is option A.

The decline in Anglo-Spanish relations in the years 1569-85 was caused by Elizabeth I. How far do you agree to explain your answer .Drakes voyages to the new world .The Netherlands

Answers

Answer:

The decline in the relationship between England and Spain caused by Elizabeth I.

Explanation:

England considered Spain as its enemy because of its religion differences. England maintains hateful toward Catholic since Henry VIII of England broke from Rome papacy and its Church by claiming himself as of the Church of England. The stress among England and Spain grew in 1585 when Elizabeth I restored protestant in the country. Philip II of Spain was not happy with Elizabeth I decision.

Both England and Spain were known for having a strong Navy. Their ships were active in trade and often in competition with one another. Elizabeth supported some of her men, including Drake for stealing supplies (piracy) from the Spanish ships.

English involvement in the Netherlands also brought a certain tension because the Netherlands was part of the Spanish Empire. The Treaty of Nonsuch signed by Queen who agreed to become engaged in the Netherlands. She assured protection by sending troops in the Netherlands that led to the war between England and Spain.  

Which list correctly orders the Yuan dynasty social classes from most powerful to least powerful?
O non-Chinese, northem Chinese, Mongols, southern Chinese
o Mongols, non-Chinese, northern Chinese, southern Chinese
O northem Chinese, southem Chinese, Mongols non-Chinese
southern Chinese non-Cheese. northern Chinese Mongols . please helpp!!​

Answers

Answer:

B

Explanation:

Answer:

B

Explanation:

List three ways in which the American and French declarations are similar.

Answers

Each document was writing to inspire social and political change.

The Declaration of Independence refers to the people of the United States as being free, and outlines how the British royalty stands in the way of free people living freely. This is similar to the first clause of the French Declaration, where it states that all people are free and are to live in equality.

When leaders come together to compose documents such as these, they rarely neglect to remind that everyone is born equal.

Three ways in which the American and French declarations are similar is that "they both incorporated the Enlightenment idea of natural rights."

Both documents were also used to declare their rebellion against the monarchy that abused its powers towards the citizens.

Both documents were made to establish the freedom and equality of the citizens.

The American Declaration of Independence was made in 1776, while the French Declaration of the Rights of Man and the Citizen was made in 1789.

Hence, in this case, it is concluded that both the American and French Declaration was written for a similar purpose.

Learn more here: https://brainly.com/question/5841284

How did Theodore Roosevelt affect the progressive movement?
(A) He weakened the progressive movement because he was unable to control the conservative wing of the
Republican party.
(B) He weakened the progressive movement because he was a Republican.

(C) He strengthened the progressive movement by making major changes that fit the progressive agenda.
(D)He strengthened the progressive movement by ensuring that his presidency would be followed by
another progressive president, Woodrow Wilson.

Answers

Answer:

C

Explanation: Roosevelt implemented a number of progressive policies during his presidency.

Yes C. Sounds more right and correct

What was President Wilson’s approach towards the defeated Central Powers after World War I?

Answers

Answer:

he pursued a policy of rehabilitation and reconciliation.

Explanation:

Which European explorer destroyed the Aztec civilization?
O A. Coronado
O B. Champlain
O C. Cortés
O D. Cabot​

Answers

Answer:

C. Cortés

Explanation:

Why is it Important to identify the purpose of a plece of writing?
to generate as many ideas as possible to include in the writing
to understand the age and educational background of the audience
to consider what you want to accomplish with the writing
to determine a topic that has a lot of Information to include

Answers

Answer:

its B

Explanation:

The New Deal will be remembered in American history: Group of answer choices as a set of public policy initiatives that did not result in sustained prosperity. as more powerful in scope than future European welfare states. for recasting the idea of American freedom to include a public guarantee of economic security for ordinary people.

Answers

Answer:

as a set of public policy initiatives that did not result in sustained prosperity.

for recasting the idea of American freedom to include a public guarantee of economic security for ordinary people.

Explanation:

The New Deal refers to a series of social policies implemented in reaction to the Great Depression and created a wide variety of federal government initiatives that aimed to provide the struggling with economic relief, control the private sector, and expand the economy. However, the initiative of  President Franklin D. Roosevelt that expanded the role of the federal government in economics improves alot. Finally, the massive expenditure for military purposes drove the U.S from the shackles of economic depression.

Why did explorers take gold and animal pelts from North America? Bring wealth to their countries Keep ships warm Make the trip faster Share discoveries with the world

Answers

The answer is....

A.) Bring wealth to their countries.

What is a current problem with Social Security? A. People live longer, meaning there are more people receiving benefits B. It has recently been called unconstitutional by the Supreme Court C. The money had to be used to fund recent wars D. People no longer want to pay Social Security

Answers

Answer:

A

Explanation:

One of the biggest problems facing Social Security is a demographic shift -- namely the retirement of baby boomers. Between 2010 and 2030 we're liable to see more than 70 million baby boomers enter retirement, which means a big surge in the number of eligible beneficiaries.

The technology developed during World War I resulted in
(1) smaller nations becoming part of larger empires after the war
(2) a smaller number of refugees during the war
(3) increased military casualties in battles fought during the war
(4) a slowdown in transportation improvements after the war

Answers

Hey there! I'm happy to help!

Let's look for answers that have to do with technology.

Smaller nations becoming part of larger empires is not really related to new technology, so this answer is not right.

Technology would not have allowed a smaller number of refugees during the war because the main thing that would have allowed a smaller number is more peaceful countries and places to take refuge, not necessarily new technology.

A slowdown in transportation improvements does not make much sense because if technology was improving it should have been easier to improve this.

New technology could have allowed for more military casualties because new and more destructive weapons such as machine guns, flamethrowers, tanks, etc. that would have caused many more people to perish.

Therefore, the answer is 3) increased military causalities in battles fought during the war.

Have a wonderful day!

As a result of technology developed in WW1, a situation arose where there were (3) increased military casualties in battles fought during the war.

World War 1 technology included:

Better guns that fired more bullets faster Tanks Chemical warfare Use of planes to monitor and attack

As a result of these, more people died whenever sides fought as these weapons were much more deadly and efficient at killing.

In conclusion, more casualties resulted from WW1 technologies.

Find out more about these technologies at https://brainly.com/question/7193038.

Other Questions
parts of the middle east have a mediterranean climate. this means they have hot, dry summers and warm, ____ winters what word completes the sentence The diversity committee at State U. is a long-standing committee with a stable membership. During the first meeting of the year, Sam, a relatively new member of the group, asks, "What are the plans for fall orientation?" Given that the group has a high-context culture, which of the following is the most likely response to Sam's question?a) We will have a special meeting at the end of the month to brainstorm ideas. We will appoint a subcommittee to draw up a schedule and deadlines for tasks, and proceed from that schedule.b) We will probably do the same thing we did last year.c) We will need to consult with the students who will be involved to get their input before we proceed. Then we can work on making a schedule and setting deadlines.d) That is the next thing on our agenda. Let's get busy deciding on a schedule, activities, and deadlines. Can someone help me with this one too John's lyrics are somewhat autobiographical and introspective on this '65 song that features brilliant harmonies throughout and lyrics that offer help to the forlorn listener. It is... Which two statements best describes the purpose of the passage ? please Evaluate ( 8/3) to the 2 power A). 8/9 B). 64/9 C). 64/3 D). 55 Line CD passes through points (0, 2) and (4, 6). Which equation represents line CD? Which of the following was true when Truman met Stalin in Potsdam in 1945? A.Their two nations were already enemies The war in the Pacific was still being fought. Britain had decided not to join them. World War II had ended. Please Help asap!!! Please give explanation If the price of biscuit per packet increased from N250 to N500 and the quantity bought per week decreased from 300 to 200 packets, determine the elasticity of demand for biscuit. Please answer this correctly without making mistakes What is the slope of the line passing through the points (6,7) and (1,5) An education researcher claims that 58% of college students work year-round. In a random sample of 400 college students, 232 say they work year-round. At alphaequals0.01, is there enough evidence to reject the researcher's claim? Complete parts (a) through (e) below. It is a well-known fact that Dr. Barnes rides a skateboard, sometimes even on campus. Suppose that Dr. Barnes selects a skateboard by first picking one of two skateboard shops at random and selecting a skateboard from that shop at random. The first shop contains two "rad" skateboards and three "gnarly" skateboards, and the second shop contains four "rad" skateboards and one "gnarly" skateboard. What is the probability that Dr. Barnes picked a skateboard from the first shop if he has selected a "gnarly" skateboard? What the answer to the question If a circle has a diameter with endpoints of (-3, 0) and (5, 4) then the equation of the circle is? Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code. B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein. C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein. D) Both B and C are possible outcomes. g A spontaneous process is one in which: A. releases a large amount of heat B. may happen (is possible) C. will rapidly approach equilibrium D. will happen quickly Based on the function F(x) = x^4 - 3x^3+ x^2 +2 and the graph of G(X) below,which of the following statements is true? The goal of a statement of purpose is: