Roberto has $200 in spending moneyHe wants to buy some video games that cost $25.50 eachWrite solve an inequality to find the number games, that Roberto can buy Enter your answer in the box
x>24 or x<24

Answers

Answer 1

Answer:

Roberto can buy 7 videogames.

Step-by-step explanation:

Given that Roberto has $ 200 in spending money and he wants to buy some video games that cost $ 25.50 each, to determine the number of games he can buy, the following inequality must be resolved:

25.50X = 200

X = 200 / 25.50

X = 7.84

Thus, since the whole number is 7, with $ 200 you can buy 7 video games, and there will be $ 21.5 (200 - 178.5) left over.


Related Questions

ASAP!!!! HELP!!!! Will mark you brainliest

Answers

Answer:

f(1) = 2

Step-by-step explanation:

Since f(x) = x^4 + 4 x^3 + 5 x^2 - 4 x - 4

When we evaluate this for x = k = 1, we replace x with the value 1 as shown below:

f(1) = 1^4 + 4 * 1^3 + 5 * 1^2 - 4 * 1 - 4 = 1  + 4 + 5 - 4 - 4 = 10 - 8 = 2

Using your answer from #3, how many hours will
Victoria need to babysit if she raises her hourly
charge to $15 per hour and she still wants to
earn at least $75?

Answers

Answer:

5 hours cuz 75 divided by 15 is 5 or 15 x 5 is 75

I don’t know what the answer from number three was, but 75÷15 = 5 hours

I need help plz ❤️️️

Answers

Answer:

x= 273

Step-by-step explanation:

Answer:

273

Step-by-step explanation:

3549/13=23

(Hope this helps u and u get it correct!)

-AestheticSnowy

work out yhe value of 6.105×10^8/3.7×10^3 give your answer in standard form​

Answers

1.65 x 10^11

Hope this helps

What is the surface area of the solid...?​

Answers

580 square units !!
hope this helps you :))

. The scatterplot shows the time spent playing a video game and the number of points scored by several students. Video Game 1,350 1,200 1,050 900 Number of Points Scored 750 600 450 300 150 0 5 10 15 20 25 30 35 40 45 Time (minutes) Based on the scatterplot, which is the best prediction of the number of points scored by a student who spends 45 minutes playing the video game?​

Answers

Answer:

c is the answer

Step-by-step explanation:

is the not maybe

What is the value of -5 4/5 + 7 1/3 write your answer as an improper fraction

Answers

Answer:

[tex]\frac{193}{15}[/tex]

Step-by-step explanation:

Here

The value of 2^3 + 3^3 = .

Answers

Answer: (2^3) +  3^3

2^3 +  3^3

35

Step-by-step explanation:

you most likely just have to add 8 and 27 together im guessing

8 ÷ one third = ___. one twenty fourth alt=twenty four twenty fourths 24 48

Answers

Answer:

Twenty four (24)

Step-by-step explanation:

8 ÷ one third

one third = 1/3

8 ÷ 1/3

= 8 × 3/1

= 24/1

= 24

help pls i'll give brainliest, are they inverses or not explain why or why not

Answers

Is that algebra,????????

The equation of a function is
y = 12x - 7. What is the output when the input is 5?

A. 50
B. 53
C. 56
D. 60

Answers

the answer is B. 53
12 times 5 then sub 7
hope it helps
the answer is D
hope this helped

20 POINTS
look at the rectangle below. the sum of the measures of the 3 interior angles of any triangle is always 180° . What is the measure of A - 30°
B - 45°
C - 60°
D - 120°

Answers

Answer: i think its 30°

Step-by-step explanation:

Write
360 000 in standard form.​

Answers

Answer:

300 + 60 + 000

Step-by-step explanation:

Just break these up easy answer. Your welcome :)

Please please help!! I really need help on this question

Answers

Answer:

They purchased 20 ounces of candy total

Step-by-step explanation:

just add 12 + 8

=20 ounces

Of people who died in the United States in recent years, 86% were white, 12% were black, and 2% were Asian. (This ignores a small number of deaths among other races.) Diabetes caused 2.8% of deaths among whites, 4.4% among blacks, and 3.5% among Asians. The probability that a randomly chosen death is a white person who died of diabetes is about:____

Answers

Answer:

The probability that a randomly chosen death is a white person who died of diabetes is of 0.0241 = 2.41%.

Step-by-step explanation:

Conditional Probability

We use the conditional probability formula to solve this question. It is

[tex]P(B|A) = \frac{P(A \cap B)}{P(A)}[/tex]

In which

P(B|A) is the probability of event B happening, given that A happened.

[tex]P(A \cap B)[/tex] is the probability of both A and B happening.

P(A) is the probability of A happening.

In this question:

Event A: The person is white

Event B: Died of diabeters.

Of people who died in the United States in recent years, 86% were white

This means that [tex]P(A) = 0.86[/tex]

Diabetes caused 2.8% of deaths among whites

This means that [tex]P(B|A) = 0.028[/tex]

The probability that a randomly chosen death is a white person who died of diabetes is about:

This is [tex]P(A \cap B)[/tex]. So

[tex]P(B|A) = \frac{P(A \cap B)}{P(A)}[/tex]

[tex]P(A \cap B) = P(B|A)*P(A) = 0.028*0.86 = 0.0241[/tex]

The probability that a randomly chosen death is a white person who died of diabetes is of 0.0241 = 2.41%.

Fill in the blanks. See picture and give answers please as quickly as possible.

Answers

Concave down
Max is 4
Vertex is (1,4)
Axis of symmetry is x=1
Y intercept is 3

2. What is the
meaning of the
slope in this
situation?

Answers

Answer: The value of the intercept represents the predicted highway mileage for gas city mileage of 0 mpg, and such a prediction would be invalid, since 0 is outside of the range of data.

Step-by-step explanation:

Answer:

The meaning of slope is like the middle number.

The solving equation for the slope is

y2-y1 and x2-x1

Step-by-step explanation:

what do i do with this

Answers

Answer: you should plot it a -3.2

Step-by-step explanation:

Consider the following hypothesis test: H 0: 50 H a: > 50 A sample of 50 is used and the population standard deviation is 6. Use the critical value approach to state your conclusion for each of the following sample results. Use = .05. a. With = 52.5, what is the value of the test statistic (to 2 decimals)? Can it be concluded that the population mean is greater than 50? Select b. With = 51, what is the value of the test statistic (to 2 decimals)? Can it be concluded that the population mean is greater than 50? Select c. With = 51.8, what is the value of the test statistic (to 2 decimals)? Can it be concluded that the population mean is greater than 50? Select

Answers

Answer:

Part a:

The calculate value of Z = 2.946 lies in the critical region so the null hypothesis is rejected and alternate hypothesis is accepted that population mean is greater than 50.

Part b:

The calculate value of Z = 1.17851 does not lie in the critical region so the null hypothesis is accepted that population mean is not greater than 50.

Part c:

The calculate value of Z = 2.1213  lies in the critical region so the null hypothesis is rejected and concluded that population mean is greater than 50.

Step-by-step explanation:

Data as given

H 0: μ ≤ 50 against the claim H a:  μ> 50  one tailed test

Z (0.05)= ± 1.645

Sample size n= 50

Using the central limit theorem

Population Standard Deviation= σ=s=6

X= 52.5 , 51 and 51.8

Part a:

Z= x-μ/ s/ √n

Z= 52.5- 50 / 6/ √50

Z= 2.5/0.84853

z= 2.946

The calculate value of Z = 2.946 lies in the critical region so the null hypothesis is rejected and alternate hypothesis is accepted that population mean is greater than 50.

Part b:

Z= x-μ/ s/ √n

Z= 51- 50 / 6/ √50

Z= 1/0.84853

z= 1.17851

The calculate value of Z = 1.17851 does not lie in the critical region so the null hypothesis is accepted that population mean is not greater than 50.

Part c:

Z= x-μ/ s/ √n

Z= 51.8- 50 / 6/ √50

Z= 1.8/0.84853

z= 2.1213

The calculate value of Z = 2.1213  lies in the critical region so the null hypothesis is rejected and concluded that population mean is greater than 50.


Pick the object that matches this description:

The object is a square with an equilateral triangle Inside of it. One side of the
square is also a side of the triangle.

A.
B.
C.

Answers

The answer to your problem is C

(5.25) An owner of a home in the Midwest installed solar panels to reduce heating costs. After installing the solar panels, he measured the amount of natural gas used y (in cubic feet) to heat the home and outside temperature x (in degree days, where a day's degree-days are the number of degrees its average temperature falls below 65 degrees F) over a 23-month period. He then computed the least-squares regression line for predicting y from x and found it to be

Answers

This question is incomplete, the complete question is;

An owner of a home in the Midwest installed solar panels to reduce heating costs. After installing the solar panels, he measured the amount of natural gas used  y (in cubic feet) to heat the home and outside temperature x (in degree-days, where a day's degree-days are the number of degrees its average temperature falls below 65oF) over a 23-month period.

He then computed the least-squares regression line for predicting y from x and found it to be:   y^=80+16x.  

How much, on average, does gas used increase for each additional degree-day?

Answer : ______ cubic feet.

(Give your answer as a whole number.)

Answer:

Amount of natural gas used increased by 19 cubic feet.

Step-by-step explanation:

Given the data in the question;

Let the dependent variable y be the amount of natural gas used ( ft³ )

Also let an independent variable x be be the degree days temperature ( in °F)

So the least squares regression equation is;

[tex]y^{bar}[/tex] = 80 + 16x

or

amount_of_natural_gas_used = 80 + 16(degree_days_temperature

Th slope or the standardized regression coefficient of the given regression equation is;

b₁ = 16

the slope coefficient b₁ = 16 is tells us that for each additional one-degree days temperature, an amount of natural gas used increased by 19 cubic feet.

Therefore, amount of natural gas used increased by 19 cubic feet.

The difference of sixteen and four is greater than ten






Write the sentence as an equation

Answers

16-4>10

Difference means subtracting

A jar contains n nickels and d dimes. There are 22 coins in the jar and a total value of the coins is $1.50. How many nickels and how many dimes are in the jar?

Answers

Answer:

1.50 + 22

Step-by-step explanation:

23.5

Answer:

12 nickels. 9 dimes

Step-by-step explanation:

12 nickels is equal to 60 cents

9 dimes equals 90 cents

90 plus 60 equals 150 which is $1.50

PLEASE HELP MATH MIDTERM
Find the measure of angle A. Round only your final answer to the nearest hundredth.

Answers

Answer:

73.74 degrees

Step-by-step explanation:

Somebody please help pleaseeeee I’ll make brainlest please help anybody .

Answers

Answer:

C Is The Correct Answer

The correct answer would be C :)

Which figure best represents a rhombus?

Answers

Answer:

it's the second one a rhombus is a diamond

It’s the first one I believe

A. 504 units(squared)

B. 436,8 units(squared)

C. 218 units(squared)

D. 283,2 units(squared)

Answers

Answer:

D. 283.2 units²

Step-by-step explanation:

Surface area of the triangular prism = 2×Base Area + Perimeter of triangular base×height of prism

Base Area = ½*bh

b = 6 km

h = 5.2 km

Base area = ½*6*5.2 = 15.6 km²

Perimeter of triangular base = 6+6+6 = 18 km

Height of prism = 14 km

Plug in the values into the equation

Surface area of triangular prism = 2×15.6 + 18×14

= 31.2 + 252

= 283.2 km²

what's 2 + 2?
plzzzzzz help​

Answers

Answer:

4 ;)

Step-by-step explanation:

Answer: 4

Step-by-step explanation:

11. The coordinate grid shows points P, Q, R, and S. All the coordinates for these points
are integers.


What is the value of the x-coordinate of point P?

Answers

Answer:

-6

Step-by-step explanation:

Answer: -6

Step-by-step explanation:

Please help me I’ll mark brainless .

Answers

I think it’s D I’m sorry if u get it right but 180 equals 10.39 like the last one
Other Questions
Sally says her stomach and liver have nothing to do with her heart and blood, and that they are completely separate. What did she say that is wrong?What would be the correct statement?What are the facts youd use to correct her? In 1985, the Gramm-Rudman-Hollings Balanced Budget and Emergency Control Act was passed in order to ensure that the federal government submitted goals to meet the deficit. If the goals are not met, then the president must order spending cuts across the entire budget based on the recommendation of the comptroller general, a position appointed by the president.The scenario above describes which of the following powers attributed to Congress?a. Congressional oversight by reviewing appropriations requests that need to meet certain spending criteriab. Congressional response to presidential budget cuts based on the comptroller general's recommendationsc. Congressional subcommittees that can review improper relationships between the comptroller and the presidentd. Congressional action to block proposed spending cuts to all federal agencies by amending the executive budget to target items from the president's agenda Which is the dominantmouth shape for emojis inthe picture below?How do you know?Smiley = MFrowny = mSchilly ScienceSMILEYFROWNY Gary wants to buy a bike that is 30% off. The original price is $109.56. What is the amount of the discount? Loss of voluntary control over urination is calledO dialysisO incontinenceO neurogenic bladderO urgencyPrevious what is one sixth of the product of four and nine table saws you can use with __ or __ but not both at the same time HELP PLS What is the value of the x variable in the solution to the following system of equations? (1 point)4x + 2y = 6x - y = 3O-15-22 Do violence and alcohol have anything to do with each other? If so, what do they have in common? If they don't have anything in common, tell me why? (SAT Prep) Find the value of x. He math team does practice drills that each last hour. In February the team did practice drills for a total of 24 hours. How many practice drills did the math team do in feburary PLEASE ANSWER FAST!!!!Explain why the U.S. decided to change its goal from protecting western settlements to attacking Native Americans and forcing them onto reservations. i just asked my best friend if she talk ab me behind my back bc i kinda have trust issues and i dont get what she means by this.... do yall have any idea? Write and solve an equation to determine the value of x in the figure. a. 3x 84; 252 b. 3x 84; 28 c. 3x 84; 84 d. 3x 84; 81 Find the value of x. Plsssssss Help!!!!Look at the map. How might the Gupta empire have been able to flourish through trade? Identify geographic features to support your answer. transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC Hey can somebody get this for me been stuck for five min Select the correct answer from the drop-down menu.What is implied by the underlined section in the passage?Caesar's statement to Brutus implies that imagine being in spanish course on edmentum its pretty hard not gonna kap