PLZZ HELP I WILL GIVE 100 POINTS Read this excerpt from the passage. "...you cannot reproach me with the slightest coquetry. I have always said to you, 'I love you as a brother;...'" How do the words slightest coquetry best affect the meaning of this passage? A. They tell the reader that Fernand flirts too much with Mercédès, and that annoys and angers her. B. They illustrate how desperate Fernand is for Mercédès's affection. C.They show that even the smallest show of affection isn't going to make Mercédès change her mind. D.They highlight for the reader how put off Mercédès is by Fernand's behavior.

Answers

Answer 1

Answer:

Letter B is your answer

Explanation:

Answer 2

Answer:

Explanation: I know this is old but for someone who may need it.

PLZZ HELP I WILL GIVE 100 POINTS Read This Excerpt From The Passage. "...you Cannot Reproach Me With

Related Questions

why do we need a universal language​

Answers

Answer:

Is

Explanation:

We need a universal language for people all around the world to speak it, know it and learn it. For eg, English is a universal language.

Hope this helps...

Have a nice day!!!!

Explanation:

to have international communication we need a universal language that everyone around the world understand .

Which of the following quotes from the novel supports the idea that the soldiers feel like they aren't getting a lot of official information from the military? "Most of what we learned was from the television news." "CENTCOM is trying to figure out what happened to the 507th." "The sergeant repeated what Ahmed said into his radio." "We weren't at the front of the action and I was glad of that."

Answers

CENTCOM is trying to figure out what happened to the 507th

Select the correct answer. Identify the sentence with the misplaced modifier. A. We shivered as the wolves howled by the campfire. B. Dogs who bark often are protective of their owners. C. Rachel likes to start her day with a cold glass of lemonade.

Answers

Answer:

A. We shivered as the wolves howled by the campfire.

Explanation:

Modifiers are phrases, words, or clauses that describe sentences. Misplaced modifiers are modifiers that are used incorrectly and don't make logical sense.

For example, try to find the misplaced modifier in this sentence: "The tan faced Daniel with a number 2 on his face wrote on the paper with a pencil." The misplaced modifier is "the tan faced... with a number 2." Normally this would describe a pencil, right? It describes the wrong thing, Daniel's face.

The misplaced modifier does not have to have a rightful place in the sentence, it just has to be wrong for the thing it describes. For example: "The 10,000 foot tall Erik ate a hot dog."  

"10,000 foot" does not have a rightful place in the sentence, but it is still illogical and wrong, so it is misplaced. Now, let's take a look at the answers A, B, and C.

A: This is the sentence with the misplaced modifier. It is illogical that people would shiver-what you normally do when you are cold- while next to a campfire. Being near a campfire would make you warm-therefore making you not shiver- so that is a misplaced modifier.

B. This isn't illogical. It makes sense that dogs who bark are protective of their owners. It isn't illogical that dogs bark. So, this modifier makes sense.

C. Lemonade is usually served cold and in a glass, so this makes sense too. There isn't anything illogical going on in this sentence, so this modifier makes sense.

Misplaced modifiers are often hidden in plain sight. You don't know how to find one unless you know what a misplaced modifier is. Hopefully you understand misplaced modifiers now!

What is the value of sin45 degrees, using mathematical tables?

Answers

Answer:

sin45 degrees= 1/√2

Using mathematical table

Sin 45° = 2/4‾‾‾√ = 1/2‾√

If the text that introduces a quote is not a complete sentence, which punctuation mark should you use between that text and your quotation?

Answers

Answer:

colon

Explanation:

When a poem in one language is translated into a pose form in another language, what may be one rest of suchs
form change?

Answers

Answer:

its c

Explanation:

i took the test

Examine the impact of risky behavior on the different spheres of well-being by conducting interviews with at least four you adults. Include the evidence (written/audio recording) of each interview.Interviwees should be kept anonymous

Answers

The correct answer to this open question is the following.

These are the people I interviewed and what they say about taking risks.

Gentleman 1. "I did not like to take risks, but everything changed in 2006 when the company fired 40% of the employees in the marketing department. I was scared to death because I wasn't expecting that. Instead of looking for another job, my wife supported me and encouraged me to open my own business. I didn't want to but I have to, and that end up well."

Lady 2.

"I endured the unimaginable I was willing to endure more, but he asked me for the divorce. I was in shock. All of a sudden, I was alone. My family lives abroad. I was about to leave the country, but one of my friends invite me to join her bakery shop for one week, while she hired an employee. I shared some recipes from my country's cuisine, and I decide to stay for one more week, the one more month...and here I am. Alone, but with a great business partnership with my friend."

Gentlemen 3.

"I had a normal life until I was able to accept a scholarship in Oxford. I was afraid. Never before leaving this country. My family and my friends are here. I was stubborn and decided to stay in Maryland when my English grandmother told me that this opportunity only presents once in a lifetime. That piece of advice mad me change my perspective and I took the scholarship. It was the best that could have happened to me. I got back from Oxford 6 years later with a beautiful wife and a kid."

Lady 4.

"I am an explorer. Love risks. The tougher the better. Risks just are part of my life. If there were no risk in my life, it would not have sense. As simple as that."

What's the purpose of a Creative Commons license?
A. To identify people who use others' work without permission
B. To prevent people from using or sharing works that others create
C. To explain how creators would like other people to use and credit their work
D. To indicate how much creators get paid when people use or share their work

Answers

A. To identify people who use others’ work without permission.

Creative Commons licenses give everyone from individual creators to large institutions a standardized way to grant the public permission to use their creative work under copyright law.

To identify people who use others' work without permission is the purpose of a Creative Commons license. Hence, option A is correct.

What Creative Commons license means?

The most unrestricted license is CC BY. It allows to easily to redistribute, to make derivative works, such translations.

Even to use the publication for commercial purposes, as long as the author is properly credited and the user makes it clear if the publication has been altered.

Thus, option A is correct.

For more details about Creative Commons license, click here:

https://brainly.com/question/21539789

#SPJ2

Nuisance is something that A. Bothers you B. Can be dangerous C. Grows fast D. Is very small

Answers

A its someone that bothers you

The answer is A. It bothers you

The little boy stepped forward, eyeing the treasure beyond the monster. His hand fell to his sword. He wondered if he had the courage to defeat the monster and claim the treasure for himself.

Answers

Answer:

This isn't really considered a question but if we were to look at it in which point of view it is being said, I would say Third Person Omniscient

Explanation:

The narrator know what the boy is thinking. In a normal 3rd person pov the narrator would not be able to figure out what the kid was thinking

The American economic review has been producing articles on a range of economic topics since 1911. In order to be considered for publication, articles must be original work not published anywhere else. What kind of magazine is the American economic review?

Answers

Answer:

Scholarly

Explanation:

A scholarly magazine is characterized as the type of magazines that are authored by professionals or experts in a specific field or discipline. Such magazines are considered an authentic source of information for various studies or further researches as it offers first-hand data or information without having any chances of bias, prejudice, or falsity.

In this question, the magazine titled 'The American economic review' would be considered a 'scholarly magazine' as it offers peer-reviewed articles in the discipline of economics and it considers only articles that are authentic and first-hand and prepared by the experts/professionals with appropriate referencing. Thus, it justifies the above definition and is truly a 'scholarly' magazine.

According to Auden's "muse des beaux arts," who understands human suffering?

Answers

Answer:

the drowning of icarus is the real answer

Explanation:

Answer:

The "Old Masters"

Explanation:


What word best describes the tone of this excerpt from "The Fall of the House of Usher" by Edgar Allan Poe?
I looked upon the scene before me-upon the mere house, and the simple landscape features of the domain-upon the bleak walls-
upon the vacant eye-like windows-upon a few rank sedges-and upon a few white trunks of decayed trees-with an utter depression of
soul which I can compare to no earthly sensation more properly than to the after-dream of the reveller upon opium--the bitter lapse into
everyday life-the hideous dropping off of the veil. There was an iciness, a sinking, a sickening of the heart-an unredeemed dreariness
of thought which no goading of the imagination could torture into aught of the sublime. What was it-paused to think-what was it that
so unnerved me in the contemplation of the House of Usher? It was a mystery all insoluble: nor could I grapple with the shadowy fancies
that crowded upon me as i pondered. I was forced to fall back upon the unsatisfactory conclusion, that while, beyond doubt, there are
combinations of very simple natural objects which have the power of thus affecting us, still the analysis of this power lies among
considerations beyond our depth. It was possible, I reflected, that a mere different arrangement of the particulars of the scene of the
details of the picture, would be sufficient to modify, or perhaps to annihilate its capacity for sorrowful impression and acting upon this
idea, I reined my horse to the precipitous brink of a black and lurid tarn that lay in unruffled lustre by the dwelling, and gazed down-but
with a shudder even more thrilling than before-upon the remodelled and inverted images of the gray sedge, and the ghastly tree-stems,
and the vacant and eye-like windows.
OA
admiration
B.
terror
hope
D.
discovery
E.
loss

Answers

Answer:

D). Discovery.

Explanation:

The tone is demonstrated as the author's approach or attitude towards a specific subject matter which is clearly reflected through his/her word-choice and use of language. It primarily functions to provide the readers with a perspective to view the text and shape their responses or experiences.

In the given excerpt, the word 'discovery' most aptly describes its tone as it aims to display what the author found at the scene('landscape features of the domain-upon the bleak walls', 'vacant eye-like windows', 'a few rank sedges', etc.) and reveals his feelings of 'utter depression.' He is unable to analyze that 'what it was that unnerved him' and concludes that 'it was an insoluble mystery that was due to the distinct combinations and arrangements of the natural objects that have affected him. Thus, option D is the correct answer.

A.
B.
C.
D.
Thank you everone whoo tryna to answer my (???)

Answers

Answer:

c

Explanation:

Answer: it is c

Explanation:

In Farewell Address, George Washington most hopes to be remembered as a president whose long years of service outweighed any faults he may have had. Which passage from the text most strongly supports that hope? Question 7 options: a) “Though, in reviewing the incidents of my administration, I am unconscious of intentional error, I am nevertheless too sensible of my defects not to think it probable that I may have committed many errors.” b) “Who can doubt that, in the course of time and things, the fruits of such a plan would richly repay any temporary advantages which might be lost by a steady adherence to it?” c) “I shall also carry with me the hope that my country will never cease to view them with indulgence; and that, after forty five years of my life dedicated to its service with an upright zeal, the faults of incompetent abilities will be consigned to oblivion, as myself must soon be to the mansions of rest.” d) “...I anticipate with pleasing expectation that retreat in which I promise myself to realize, without alloy, the sweet enjoyment of partaking, in the midst of my fellow-citizens, the benign influence of good laws under a free government, the ever-favorite object of my heart, and the happy reward, as I trust, of our mutual cares, labors, and dangers.”

Answers

Answer:

The passage that most strongly supports that hope is:

c) “I shall also carry with me the hope that my country will never cease to view them with indulgence; and that, after forty five years of my life dedicated to its service with an upright zeal, the faults of incompetent abilities will be consigned to oblivion, as myself must soon be to the mansions of rest.”

Explanation:

First, let's remember what we are looking for. We want a passage in which Washington says he wishes people will forgive his mistakes and faults due to his dedication as a president. When we analyze what is said in letter C, that is precisely what we find. Washington is saying that he hopes people will be able to look at his past faults with tolerance - my country will never cease to view them with indulgence. He hopes his long years of service will outweigh such faults, causing people to forget (or forgive) them - after forty five years of my life dedicated to its service with an upright zeal, the faults of incompetent abilities will be consigned to oblivion. Therefore, the best answer is letter C.

Answer:c

Explanation: bc i said so

How does this expert best illustrate Modernist ideals? A. It questions the existence of tru love. B. It conveys a sense of isolation. C. It celebrates the beauty of nature. D. It uses rich, detailed imagery.

Answers

Answer:

The correct answer is option A. It questions the existence of true love.

Explanation:

As we know, modernism is a movement that arises in response to romanticism and puts more emphasis on the role that science and technology have in society.

We have evidence that this poem questions the existence of true love.

We have phrases like: "There is no light" and "spoiling the colors

of the whole world — you far off there under. "

Given this information we can say that the correct answer is option A.

PLS HURRY! 5 MINUTES LEFT!!! Read this excerpt from The Miracle Worker. ANAGNOS: . . . It will no doubt be difficult for you there, Annie. But it has been difficult for you at our school too, hm? Gratifying, yes, when you came to us and could not spell your name, to accomplish so much here in a few years, but always an Irish battle. For independence. (He studies ANNIE, humorously; she does not open her eyes.) This is my last time to counsel you, Annie, and you do lack some – by some I mean all – what, tact or talent to bend. To others. And what had saved you on more than one occasion here at Perkins is that there was nowhere to expel you to. Your eyes hurt? ANNIE: My ears, Mr. Anagnos. (And now she has opened her eyes; they are inflamed. Vague, slightly crossed, clouded by the granular growth of trachoma, and she often keeps them closed to shut out the pain of light.) ANAGNOS [SEVERELY]: Nowhere but back to Tewksbury, where children learn to be saucy. Annie, I know how dreadful it was there, but that battle is dead and done with, why not let it stay buried? Which of these statements provides the best summary of the scene? Anagnos notices that Annie’s eyes are closed, and he discusses her life in Tewksbury and her time at Perkins. Anagnos praises Annie’s work at Perkins and mentions her previous time in Tewksbury, a town on the Ipswich River. Anagnos is cruel as he expresses doubts about Annie’s ability to leave Perkins and begin teaching. Anagnos describes Annie’s progress at Perkins and her strong will, and he expresses concerns about her attitude.

Answers

Answer:

"Anagnos is cruel as he expresses doubts about Annie's ability to leave Perkins and begin teaching."

Explanation:

The dialogue shows that Anagnos is criticizing Annie of her lack of tact and talent.

Anagnos is cruel as he expresses doubts about Annie's ability to leave Perkins and begin teaching is the statements provides the best summary of the scene. Hence, option C is correct.

What is meant by ability?

Ability is the capability of the person in the specific sector or the reason to do something in the particular field. The ability of the person can be judged by the way of doing the things.

Ability of the person makes them most good in their life and achieve the heights of success.

Thus, option C is correct.

For more details about Ability, click here:

https://brainly.com/question/10632100

#SPJ2

19. When Pip and Estella reunite at Miss Havisham's house, Pip is hurt that

Y

O A. Miss Havisham has invited Orlick to her house.

O B. Estella has no interest in loving him.

OC. Miss Havisham encourages him to love Estella.

O D. Estella doesn't remember making him cry.

Answers

Answer: D. Estella doesn't remember making him cry.

Explanation:'

Book - Great Expectations  by Charles Dickens

When Pip first met Estelle at Miss Havisham's house, Estelle was harsh to him and insulted him as they played cards by making fun of his coarse hands and boots. This made Pip cry as he ate his lunch.

When they reunite again at Miss Havisham's house in Chapter 29, Estelle has become a very beautiful woman but again she hurts Pip, this time unwittingly because she does so by not remembering that she had made him cry with her insults the first time they met at Miss Havisham's house.

What best describes the underlined part of this
sentence?
O restrictive phrase
nonrestrictive phrase
O restrictive clause
O nonrestrictive clause

Answers

Answer:a

Explanation:test

Answer:

the answer is B

Explanation:

How does holi bring people of different castes and religious into harmony and fraternity?​

Answers

Answer:

Holi: A Festival of harmony and Fraternity.

Explanation:

Holi is a festival celebrated in India and Hindu culture. It is a festival of colors. This festival is marked with strong relationships and brotherhood. On this festival, people who have differences forget about it and forgive one another and come together to celebrate the festival.

On the eve of Holi, people from different castes and religion come together to celebrate the festival with happiness and brotherhood. India is a country of varying culture but still festivals are celebrated with togetherness. Thus we can say that Holi is a festival of harmony and fraternity, where people from different caste, culture, and religion come together.

A pet shop owner had a parrot with a sign on its cage that said "Parrot repeats everything it hears". Davey bought the parrot and for two weeks he spoke to it and it didn't say a word. He returned the parrot but the shopkeeper said he never lied about the parrot. How can this be? I WILL MARK BRAINLIEST FOR THE CORRECT ANSWER !

Answers

The parrot was deaf!


Describe a time that something totally unexpected happened.

Answers

Answer:

Explanation:

as I went to sleep last night, I heard the doorbell. I wondered who might it be. I slowly left my bed and walked towards the door. And as I opened it ....Ii felt a bit pain on my head ....I shouted as loud as I could ...and I realized that it was a dream..it was quite unexpected for a girl like me to shout while dreaming..............

Answer:

Ok these are both very scary but did happen to me so you can believe or not.

Explanation:

The first one was when I was helping my dad last month fill in the walls with insulation. When we started pumping the insulation in, we say a whole bunch of dead animals like crucified on the wall and there heads looking at our living room. Our pets never went in the living room. We later found out the previous owner was psycho and had neighbor reports of loud noises.

The second one is when my friend went to a Satanic Temple in Salem Massachusetts. One time, I went with him as a guest. They were doing there "hocus-pocus" stuff I laughed cuz it was so weird and funny. On the of the leaders asked me to go up to the stand and he did his "devil thing". Then the devil - animal stature behind him became alive and bit me in the arm.  Then I woke from the nightmare but I had bit marks on my arm of where it happened in the dream.

help. me hellpp pleaseeee​

Answers

Answer:

c.Had my bike fixed

d.get it translated

Explanation:

the first sentence is actually in past tense and the best thing to say is that:

I had my bike fixed two days ago.

the second sentence shows that something is about to happen or ought to happen so the correct thing to say is:

I can get it translated for you if you like.

who are the characters for "The hardy boys" books​

Answers

Answer:

Frank Hardy

Joe Hardy

Fenton Hardy

Laura Hardy

Aunt Gertrude

Chet Morton

Iola Morton

Biff Hooper

Tony Prito

Callie Shaw

Phil Cohen

Chief Ezra Collig

Sam Radley

Ethel Radley

Jerry Gilroy

Jack Wayne

Vanessa Bender

Belinda Conrad

The Gray Man

Samuel Peterson

Brian Conrad

Mrs. Conrad

Adam Franklin

Q. T.

Mimi Morton

Explanation:

Answer:

Character history.

Frank Hardy.

Joe Hardy.

Fenton Hardy.

Laura Hardy.

Aunt Gertrude.

Chet Morton.

Iola Morton.

Question #2: Choose the verb which correctly completes the sentence. My friends _______ their bills on time. A.pays B.pay

Answers

My friends PAY their bills on time.

The correct answer is B.

what special division of the navy JAG corps does comeder jo galloway work for?

Answers

Answer: Commander Jo Galloway works for the division of Defense Service Offices on the navy JAG corps.

Explanation: The story begins with the investigation of the passing of a marine on the U.S. As the events occur, two other marine officers are involved in the case, and Jo Galloway, along with Daniel Kaffee and Sam Weinberg, has the mission of defending the two suspects. The division of Defense Service Offices' job is, as the name suggests, to provide legal advice and representation to service members.

Select the error-free sentence.
A. The speakers reliance on notes made the question-and-answer session dull.
B. The speaker's reliance on notes made the question-and-answer session dull.
C. The speakeres reliance on notes made the question-and-answer session dull.
D. The speakers' reliance on notes made the question-and-answer session dull.

Answers

Answer:

B. The speaker's reliance on notes made the question-and-answer session dull.

Hope this helps.

Answer: B The speaker's reliance on the notes made the question-and-answer session dull.

Explanation: the apostrophe before the s shows possession.

" They understand Spanish" how can I change it to a passive sentence??​

Answers

Answer:

Spanish is understood by them.

Explanation:

In simple words, reverse the subject (who is performing the action) with the object (the receiver of the action).

Hector wrote a speech about segregation that appealed to emotion, and Emma wrote a speech about segregation that included metaphors. Based on this scenario, which speech is more effective?

Answers

Answer:

Hector's speech is more effective because it uses rhetoric.

Explanation:

In simple words, hectors speech is more effective as it takes into consideration the emotions of different individuals and thus is more persuasive to a very good extent.

People might not understand Emma's speech as everyone in the audience might not have such level of understanding in metaphor's but everyone do have emotions so they would easily relate to Hector.

Answer: hectors speech is more effective because it uses rhetoric

Explanation:

I just did the quiz also someone else already said it

Drag the tiles to the correct boxes to complete the pairs

Identify the audience for each type of nonfiction text.
[Business report] [academic paper] [music review] [coffee roasting data] Guitarist
Investor in a company
cafe owner
college professor

Answers

Answer:

1. Business report: Investor in a company.

2. Academic paper: College professor.

3. Music review: Guitarist.

4. Coffee roasting data: Cafe owner.

Explanation:

1. Business report: is an analysis, evaluation and summary of all activities such as finance, administrative, sales, procurement etc. associated with a business.

The audience of a business report is an investor in a company.

2. Academic paper: is a type of academic journal which comprises of the original research findings or entirely new inventions of a student.

The audience of an academic paper is a college professor.

3. Music review: is a write-up or an article that gives a well detailed description or overview about a song.

The audience of a music review is a guitarist.

4. Coffee roasting data: these are informations or data on the chemical and physical properties of a coffee.

The audience of a coffee roasting data is a cafe owner.

Just to make it easier

Other Questions
What the answer to the question If a circle has a diameter with endpoints of (-3, 0) and (5, 4) then the equation of the circle is? Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code. B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein. C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein. D) Both B and C are possible outcomes. g A spontaneous process is one in which: A. releases a large amount of heat B. may happen (is possible) C. will rapidly approach equilibrium D. will happen quickly Based on the function F(x) = x^4 - 3x^3+ x^2 +2 and the graph of G(X) below,which of the following statements is true? The goal of a statement of purpose is: 62(1+2) isn't that should be 1 , cause in the calculator it said 9 but the order is the parenthisis/brakets first ?? so it should be like 2 times 3 then 66 which gives 1 . Which of the following pitches is a non-chord tone for the I chord in G major? - G - B - A - D When a negative amount is in the base period and a positive amount is in the analysis period (or vice versa), a meaningful percent change cannot be calculated.A. TrueB. False A cookie recipe requires 3 teaspoons of baking soda for 36 cookies. If the baker would like to make 480 cookies, how much baking soda will be required? a13.33 teaspoons b12 teaspoons c40 teaspoons d108 teaspoons The flesh of infants may be used asgloves and summer boots Swift objects to eating girls as old as 14because they would serve better asbreeders, and because people wouldobject that it is "a little bordering oncruelty"Although there are many suffering"aged, diseased," or injured people,nothing needs to be gone for thembecause they are already dying "as fastas can be reasonably expected"Poor Irish tenants, who have already soldtheir crops and cattle to pay the rent,will now be able to pay by selling theirchildren Jerry solved the system of equations. x minus 3 y = 1. 7 x + 2 y = 7. As the first step, he decided to solve for y in the second equation because it had the smallest number as a coefficient. Max told him that there was a more efficient way. What reason can Max give for his statement? The variable x in the first equation has a coefficient of one so there will be fewer steps to the solution. The variable x in the second equation has a coefficient of 7 so it will be easy to divide 7 by 7. The variable y in the second equation has a coefficient of 2 so it will be easy to divide the entire equation by 2. The variable x in the second equation has the largest coefficient. When dividing by 7, the solution will be a smaller number. Probability of landing on even # on a spinner; probability of rolling an odd # on a die The amount of flow through a solenoid valve in an automobile's pollution-control system is an important characteristic. An experiment was carried out to study how flow rate depended on three factors: armature length, spring load, and bobbin depth. Four different levels (low, fair, moderate, and high) of each factor were chosen, and a single observation on flow was made for each combination of levels.A) The resulting data set consisted of how many observations?B) Is this an enumerative or analytic study? Explain. Simplify each expression. 6mn3 -mn2 + 3mn3 +15mn2?? Read the following excerpt. The journalist spent a year researching the foreign government's sanctions. Finally, it was time to synthesize all of the relevant information that he had learned. His editor asked him to write a comprehensive article for the first piece in the series that was sure to win awards, inform the public, and elicit significant change in foreign policy. Using the context, the word "elicit" meansdeclarecausecriticizeend y=tan(x-30) period and amplitude which platonic solid has eight faces that are equilateral triangles? A, dodecahedron, B, octahedro, C, tetrahedron, D, icosahedron Families USA, a monthly magazine that discusses issues related to health and health costs, survey 19 of its subscribers. It found that the annual health insurance premiums for a family with coverage through an employer averaged $10,800. The standard deviation of the sample was $1095. A. Based on the sample information, develop a 99% confidence interval for the population mean yearly premiumB. How large a sample is needed to find the population mean within $225 at 90% confidence? (Round up your answer to the next whole number.) how to see the answer