pls help with this its about science and i hate science so i need ur guys help pls!

Pls Help With This Its About Science And I Hate Science So I Need Ur Guys Help Pls!

Answers

Answer 1

Answer:

Number 1

Explanation:


Related Questions

why does the synthesis of DNA and RNA require hydrolysis of ATP to AMP rather than ADP?

Answers

Answer:

ATP provides the cell with a way to handle energy in an efficient manner. The molecule can be charged, stored, and used as needed. Moreover, the energy from hydrolyzing ATP is delivered as a consistent amount.

Explanation:

What do the arrows indicate?

Air moves in a direction that creates land breezes.
Air above land warms faster than air above water.
Air blows over long distances in a continual straight path.
Air pressure remains the same while cycling over land and water.

Answers

Answer: Air moves in a direction that creates land breezes.

Explanation:

The arrows indicate is air moves in a direction that creates land breezes. So, the correct option is A.

What are Land breezes?

Due to the difference in temperature of land and sea, land breezes are those winds which blow from land to sea at night.

The Sun heats both land and sea during the day, but land heats up more quickly than water. As a result, an area of ​​low pressure is generated as the air above the ground is heated and rises. As a result, cold sea air fills the space and creates a sea breeze that blows from sea to land.

The opposite happens at night. The air over the land becomes cooler and denser because the land cools faster than the sea. As a result, high pressure develops over the land. Then a land breeze is generated, which flows from land to sea by cold and dense air moving from land to sea.

So, the correct option is A.

Learn more about Land breezes, here:

https://brainly.com/question/29765563

#SPJ5

Jack And Betty are married, and they have two sons and one daughter. Jack's mother is deceased, but his father is still living. Betty's parents are both still alive. Jack's mother showed trait A, but his father does not. Jack and one of his sons show trait A, but the other son and daughter are free of the trait. No one on Betty's side of the family shows the trait. The trait is inherited as a recessive. Determine the genotype of each member of the extended family.

Answers

Answer and Explanation:

Due to technical problems, you will find the complete answer and explanation in the attached files    

In the skeletal system, which are the two main tissue responsible for structural support in the body.​

Answers

Answer:

compact bone and ligaments.

Explanation:

What is true about the function of DNA? ¿Qué es cierto sobre la función del
ADN? *
O
Its main job is to leave the nucleus and enter the cytoplasm (Su función principal es
salir del núcido y entrar al citoplasma.)
O
Its main job is to create sugars called deoxyribose (Su trabajo principal es crear
azúcares llamados desoxirribosa.)
Its main job is to hold instructions for your traits (Su trabajo principal es contener
instrucciones para tus rasgos.)

Answers

Answer:

To hold instructions for your traits.

Fault lines are:
A: the crust of the kryosphere that has fractured along plate boundaries and ridges
B: the crust of the biosphere that has fractured along plate boundaries and ridges
C: the crust of the asthenosphere that has fractured along plate boundaries and ridges
D: the crust of the lithosphere that has fractured along plate boundaries and ridges​

Answers

Answer:

D: the crust of the lithosphere that has fractured along plate boundaries and ridges

Explanation:

These fault lines in the lithosphere along plate boundaries and ridges are the causes of natural disasters like earthquakes.

5. Which of the following explains a way in which metamorphic rocks are formed?
a. through intense changes in heat
b. through intense change in pressure
c. through chemical changes
d. All of the above explain ways in which metamorphic rock can occur.

Answers

Answer:

D. All of the above explain ways in which metamorphic rock can occur.

what order does it go in?

Answers

compaction to cementation to sedimentary

Help
Which are characteristics of life?

Answers

Answer:

All living organisms share several key characteristics or functions: order, sensitivity or response to the environment, reproduction, growth and development, regulation, homeostasis, and energy processing. When viewed together, these characteristics serve to define life.

Explanation:

The level of glucose in the bloodstream drops. The person requires glucose in cells to meet the demand for ATP (glucose is broken down to create ATP). The body detects glucose levels with a particular receptor designed for this function. These receptors release hormones, chemical messages that initiate the start of the feedback mechanism. The hormones travel to their target tissue and initiate a corrective response. In this case, the corrective response is the secretion of more glucose into the bloodstream. Does this demonstrate POSITIVE or NEGATIVE FEEDBACK?

Answers

Answer:

Negative feedback.

Explanation:

It is negative feedback because the reactions triggered by low glucose levels are trying to rebalance the glucose concentrations in our body to make it work properly.

In positive feedback, a product will only stimulate more the components that lead to that product to produce more of it, increasing the product's effect and an imbalance.

describe common characteristics of all muscle type?​

Answers

Answer:

They all are have these characteristics in common :

Extensibility - they can be stretchedElasticity - they return to normal length after stretchingContractility - muscles call pull (not push) Excitability - they respond to the stimulus.

HELP PLEASE WILL MARK BRAINLIEST

Answers

1 is the first answer 2 is the last answer

Specifically how did Mary Mallon spread typhoid bacteria (Salmonella typhi) to the families she cooked for, as cooking food kills bacteria

Answers

Answer: Mary Mallon was able to spread the typhoid bacteria to the families she cooked for even as cooking kills bacteria because she was a healthy carrier of salmonella typhi who prepared certain foods for these families, that doesn't require cooking, without vigorously scrubbing her hands.

Explanation:

The genus salmonella consists of a group of bacilli which can affect man leading to the following conditions:

--> Enteric Fever

--> Gastroenteritis

--> Septicaemia and

--> Carrier state or condition.

Salmonella typi causes the enteric fever called TYPHOID FEVER. A healthy individual can be infected with the bacteria through injection of faecal contaminated food ( faeco- oral route). On reaching the gut,the organism attach themselves to the intestinal villi penetrating the lamina propria and submucosa. Their major factor of virulence is the inability to be killed after being phagocytosed by polymorphs and macrophages. They enter the blood stream through the thoracic duct causing transient bacteriaemia. During this period, the bacilli are then seeded into the liver, kidney and gall bladder where further multiplication occurs. The massive discharge of these bacilli from gall bladder leads to onset of the clinical disease.

These bacilli tends to persist in the kidney and gall bladder( as it's a good culture media for the organism). These are seen in individuals who become carriers following inapparent infection and they are called HEALTHY CARRIERS. They shed the bacilli intermittently from their faeces and urine

Mary Mallon, an Irish cook, was a healthy carrier of salmonella typhi who constantly shed the bacteria in her faeces and urine. Although the bacilli is destroyed when subjected to high temperature ( when cooking), the families she cooked for still came down with the illness. This was so because, since the bacteria can be transmitted through faeco- oral route, she wasn't educated enough to vigorously scrub her hands before handling foods that doesn't require cooking,for example vegetable salads.

Proteoglycans are part of the extracellular matrix; they provide structure, viscosity and lubrication, and adhesiveness. They are composed of proteins conjugated to carbohydrate components called glycosaminoglycans. The glycosaminoglycan component makes up the majority of the mass of a proteoglycan. Which of these are possible components of glycosaminoglycans

Answers

Answer:

This question lacks options, options are:  a. beta-D-fructofuranose b. amylose c. uronic acid d. N- acetylglucosamine. The correct answers are c and d.

Explanation:

Glycosaminoglycans are very long, unbranched polysaccharides, made up of repeating units of disaccharides. One of the disaccharides is always an amino sugar, which can be N- acetylglucosamine. The other is uronic acid (it can be iduronic acid or glucuronic acid and is often sulfated at position 2). The amino sugar is usually sulfated and the rest of the sugars have carboxyl groups, which give the structure a negative charge, which attracts a large amount of cations such as sodium. Glycosaminoglycans are often covalently bound to proteins to form proteoglycans. Hyaluronic acid is the only glycosaminoglycan that does not form protein bonds and does not have sulfate groups in its structure.

A liver cell has a volume of 5000 μm3. Its total membrane area, including the inner membranes lining organelles as well as the cell membrane, is 110,000 μm2. A cell in the pancreas that manufactures digestive enzymes has a volume of 1000 μm3 and a total membrane area of 13,000 μm2. Which cell is probably more efficient in carrying out activities that require extensive membrane surfaces? Why?

Answers

Answer:

The liver cell, since it has a higher surface to volume ratio will be more efficient in carrying out activities that require extensive membrane surfaces such as solute transport.

Explanation:

The cell surface area to volume ratio is important in order to determine the efficiency of the cell in carrying out its metabolic activities. The surface area of a cell is bounded by the cell membrane whose function in addition to many others is to let nutrients into the cell and let waste out of the cell. The rate of activity of a cell depends on its volume. The larger the volume the more the active the cell is. Since volume increases much more when compared to area, the ratio of the surface area of a cell to its volume becomes smaller with increase in volume of the cell.

Considering the liver cell and the pancreas cell in the question, the cell's surface area to volume ratio is given as follows:

Liver cell: volume = 5000 μm³; area = 110000 μm²

surface area to volume ratio = 110000 / 5000  = 22 : 1

Pancreas cell : volume = 1000 μm³ ; area = 13000 μm²

Surface area to volume ratio =13000 / 1000 = 13 : 1

The liver cell, since it has a higher surface to volume ratio will be more efficient in carrying out activities that require extensive membrane surfaces such as solute transport.

Antibiotics can be used to kill the specific pathogenic bacterium, Mycobacterium tuberculosis, that causes tuberculosis. The appearance of antibiotic-resistant strains has made it more difficult to cure M. tuberculosis infections. These antibiotic-resistant bacteria survive and pass on the genes to their offspring, making the resistant phenotype more common in the population. DNA analysis indicates that the genes for antibiotic resistance are not normally present in bacterial chromosomal DNA. Which of the following statements best explains how the genes for antibiotic resistance can be transmitted between bacteria without the exchange of bacterial chromosomal DNA

a. The antibiotic-resistant bacteria release a hormone that signals neighboring bacteria to become resistant
b. The genes for antibiotic resistance are located on a plasmid that can be passed to neighboring bacteria.
c. The antibiotic-resistant bacteria are the result of bacteria that specifically modify their own chromosomal DNA to neutralize the antibiotics
d. The antibiotic alters the bacterial genome of each bacterium, which results in an antibiotic-resistant population

How do you know your answer is the correct one?

Answers

Answer:

b. The genes for antibiotic resistance are located on a plasmid that can be passed to neighboring bacteria.

Explanation:

Conjugation refers to the process where one bacterium known as 'donor' transfers genetic material to another bacterium by direct contact. Conjugation enables bacteria to transfer genes that encode proteins conferring antibiotic resistance to another bacteria by transferring plasmids (i.e., small, extrachromosomal DNA molecules) containing these genes, which is known as horizontal transference. Plasmids that contain multiple antibiotic resistance genes confer Multidrug drug resistance (MDR) and they may severely limit the therapeutic efficacy of treatments against bacteria.

There are different kinds of antibiotics. The statement that best explains how the genes for antibiotic resistance can be transmitted between bacteria without the exchange of bacterial chromosomal DNA is that;

The genes for antibiotic resistance are located on a plasmid that can be passed to neighboring bacteria.

Bacteria are known to be able to get antibiotic resistance genes from other bacteria in different ways. It can be gotten when they undergo a simple mating process referred to as "conjugation".

Bacteria are known to transport genetic material such as genes encoding resistance to antibiotics that are resident on plasmids and transposons. This can be transferred from one bacterium to another.

Learn more about gene transfer from

https://brainly.com/question/7445281

What is something you learned about movement across the membrane

Answers

Answer:

Membrane transport is essential for cellular life. As cells proceed through their life cycle, a vast amount of exchange is necessary to maintain function.

Explanation:

Which of the following is the thickest layer of the Earth?

inner core

outer core

mantle

crust

Answers

the thickest layer is the inner core.

Which of the following is not an amniote?

Answers

I wanna say owl but I’m not sure.

What connective tissue is replaced by bone in the epiphyseal plates?

Answers

Answer:

A band of hyaline cartilage, the epiphyseal plate, forms between the two ossification centers. 8. Layers of cartilage cells undergoing mitosis make up the epiphyseal plate. matrix and are replaced with bone- building osteoblasts that deposit bone in place of calcified cartilage.

Explanation:

Compare Suspect 1 (S1) and Suspect 2 (S2) to the DNA evidence sample (E). Based upon the DNA fingerprints, which suspect was likely at the crime scene and why

Answers

Hello. Your question is incomplete and more information would be needed so that it could be answered accurately. However, I will try to help you in the best possible way.

As we know, fingerprints are formed by a unique pattern of lines that are not repeated between individuals. Thus, in order to discover who is a criminal, through the analysis of fingerprints, it is important to identify the pattern of lines left at the scene of the crime and analyze it with the pattern of lines in the suspect's fingerprint.

this type of energy put things in motion

Answers

Answer:

kinetic energy I think

Explanation:

not 100%

If the n number of an organism is 13, then the 2n number would be?

A.1
B.7
C.13
D.26

Answers

Well 2*13=26 . So D would be correct

Has anyone done the How do males and females skeleton differ work sheet if so let me know. :)

Answers

MALE BONES ARE BIGGER AND STRONGER, in both size and density. Peak male bone mass is around 50% more than women’s, and women lose bone faster as we age. Black people have significantly stronger bones than whites: black women’s peak bone mass is the same as white men’s.

WOMEN AND MEN HAVE THE SAME NUMBER OF RIBS. We have 12 pairs, though some people are born with 11 or 13 pairs to no ill effect.

MEN HAVE BIGGER HEADS AND LONGER ARMS AND LEGS than women, relative to body size. Sources differ on comparative limb length but they all agree women have smaller, lighter heads & necks. Did you know a human head weighs about 5kg?

The biological sex of an adult skeleton can be determined with 95% accuracy by measuring the hip bones alone, 83% accuracy by the skull, and 80% accuracy by the long bones (femur & tibia).

WOMENS ELBOWS AND SHOULDERS are slightly different from men’s. Our arms bend a little further from our bodies and are more mobile at both joints.

FINGER LENGTH: Greater exposure to androgens in utero leads to a 4th (ring) finger that is longer than the 2nd (index), as often seen in men.

WOMEN HAVE A LONGER TORSO. Our skeleton accommodates extra reproductive organs and finds space to push things out of the way during pregnancy. It makes our legs shorter than men’s.

THE LARGER FEMALE PELVIS is better adapted for childbirth. It’s wider, longer, and held together by ligaments that soften during pregnancy, allowing the two halves to slide apart because of their narrow pelvis. Women’s slanted thigh bones put extra pressure on the knee joints, which have to rotate while men’s do not.

MEN HAVE BIGGER BRAINS by more than 10% relative to body size. Women’s brains have more connections between the two hemispheres, using both sides of the brain much more often than men.

write a notice of the department of water and sewage​

Answers

Answer:

Explanation:

The following is a basic and common notice of the department of water and sewage...

The Water and Sewage Department is encouraging all Miami Residences, to conserve their water. Water flow is being interrupted and may not reach most residences for a few days. This is due to a Water Treatment plant issue, which we are working on fixing as soon as possible. Water services should resume normally in the next two days. Sorry for the invonvenience and for any information or problems that you may be experiencing regarding your Water system, please call us at XXX-XXXX

Which group of organisms can be considered a population

Answers

Answer: Is a group of organisms of the same species that interbreed for example a group of robins in North America

Answer: population is defined as a group of organisms of the same species that live in a particular area. There can be more than one population living within any given area. There can be a population of Saguaro Cacti, a population of Cactus Wrens and a population of Bark Scorpion living in the same areas.

Hope this helps (:

What is the layer under the Lithosphere called?

Answers

Below the lithosphere is the asthenosphere.

People try to conserve some resources, like fossil fuels, because they are
not replaceable. Why can't these resources be replaced?
A. They must be transported long distances
B. Processes to make them take longer than a human's lifetime
C.No one can afford to buy more of them
D. It is impossible to extract more from the Earth

Answers

Answer:

B. processes to make them take longer than a human's lifetime

define atomic number and mass number – describe how they differ

Answers

Answer:The major difference between atomic number and mass number is that the atomic number states the number of protons present in an atom whereas, the mass number indicates the total of the number of protons and the number neutrons present in an atom.i) Atomic number is the total number of protons present in the nucleus of an atom. It is also equal to the number of electrons for a neutral atom. Example, atomic number of sodium is 11. ii) Mass number is the number of protons and neutrons in the nucleus taken together. For example, mass number of sodium is 23 g/mol.

hope this helps have a great night❤️❤️❤️❤️

Explanation:


MULTIPLE CHOICE
Select the answer that lists the organization of genetic material in order from smallest to largest.
A
nitrogen base, DNA, gene, chromosome, cell
B
DNA, nitrogen base, chromosome, cell, gene
С
D
chromosome, cell, gene, nitrogen base, DNA
DNA, gene, nitrogen base, chromosome, cell

Answers

Answer:

a. and d. is the answer

Explanation:

Answer:

A

Explanation:

nitrogen bases are a part of DNA, Dna is copied into genes, chromosomes are made of genes, cells are the largest unit out of all of these.

plz mark me brainliest. ;)

Other Questions
Write the equation of the line that passes through the points (-1,3) and (-6, -7).Put your answer in fully reduced point-slope form, unless it is a vertical or horizontalline. Photosynthesis uses all of the following exceptto make food.carbon dioxideO light energyO chemical energywateris its A? Sally says her stomach and liver have nothing to do with her heart and blood, and that they are completely separate. What did she say that is wrong?What would be the correct statement?What are the facts youd use to correct her? In 1985, the Gramm-Rudman-Hollings Balanced Budget and Emergency Control Act was passed in order to ensure that the federal government submitted goals to meet the deficit. If the goals are not met, then the president must order spending cuts across the entire budget based on the recommendation of the comptroller general, a position appointed by the president.The scenario above describes which of the following powers attributed to Congress?a. Congressional oversight by reviewing appropriations requests that need to meet certain spending criteriab. Congressional response to presidential budget cuts based on the comptroller general's recommendationsc. Congressional subcommittees that can review improper relationships between the comptroller and the presidentd. Congressional action to block proposed spending cuts to all federal agencies by amending the executive budget to target items from the president's agenda Which is the dominantmouth shape for emojis inthe picture below?How do you know?Smiley = MFrowny = mSchilly ScienceSMILEYFROWNY Gary wants to buy a bike that is 30% off. The original price is $109.56. What is the amount of the discount? Loss of voluntary control over urination is calledO dialysisO incontinenceO neurogenic bladderO urgencyPrevious what is one sixth of the product of four and nine table saws you can use with __ or __ but not both at the same time HELP PLS What is the value of the x variable in the solution to the following system of equations? (1 point)4x + 2y = 6x - y = 3O-15-22 Do violence and alcohol have anything to do with each other? If so, what do they have in common? If they don't have anything in common, tell me why? (SAT Prep) Find the value of x. He math team does practice drills that each last hour. In February the team did practice drills for a total of 24 hours. How many practice drills did the math team do in feburary PLEASE ANSWER FAST!!!!Explain why the U.S. decided to change its goal from protecting western settlements to attacking Native Americans and forcing them onto reservations. i just asked my best friend if she talk ab me behind my back bc i kinda have trust issues and i dont get what she means by this.... do yall have any idea? Write and solve an equation to determine the value of x in the figure. a. 3x 84; 252 b. 3x 84; 28 c. 3x 84; 84 d. 3x 84; 81 Find the value of x. Plsssssss Help!!!!Look at the map. How might the Gupta empire have been able to flourish through trade? Identify geographic features to support your answer. transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC Hey can somebody get this for me been stuck for five min