Please help me solve !!!!

Please Help Me Solve !!!!

Answers

Answer 1

Answer:

length of rectangular prism: 9 feet

width of rectangular prism: 9 feet

Step-by-step explanation:

volume= length x width x height

567/7=81

Since 81 cubic feet squared is the area of the base; the square bottom, you will need to find the square root of 81 which is 9 since 9 times 9 equals 81.


Related Questions

What are the zeros of the polynomial function?

Select all correct zeros of each function.

Function −3 −2 −1 0 1 2 3
f(x)=2x(3−x)(x+1)
negative 3 – f left parenthesis x right parenthesis equals 2 x left parenthesis 3 minus x right parenthesis left parenthesis x plus 1 right parenthesis
negative 2 – f left parenthesis x right parenthesis equals 2 x left parenthesis 3 minus x right parenthesis left parenthesis x plus 1 right parenthesis
negative 1 – f left parenthesis x right parenthesis equals 2 x left parenthesis 3 minus x right parenthesis left parenthesis x plus 1 right parenthesis
0 – f left parenthesis x right parenthesis equals 2 x left parenthesis 3 minus x right parenthesis left parenthesis x plus 1 right parenthesis
1 – f left parenthesis x right parenthesis equals 2 x left parenthesis 3 minus x right parenthesis left parenthesis x plus 1 right parenthesis
2 – f left parenthesis x right parenthesis equals 2 x left parenthesis 3 minus x right parenthesis left parenthesis x plus 1 right parenthesis
3 – f left parenthesis x right parenthesis equals 2 x left parenthesis 3 minus x right parenthesis left parenthesis x plus 1 right parenthesis
f(x)=2(x−3)(x+2)2(x−1)
negative 3 – f left parenthesis x right parenthesis equals 2 left parenthesis x minus 3 right parenthesis left parenthesis x plus 2 right parenthesis squared left parenthesis x minus 1 right parenthesis
negative 2 – f left parenthesis x right parenthesis equals 2 left parenthesis x minus 3 right parenthesis left parenthesis x plus 2 right parenthesis squared left parenthesis x minus 1 right parenthesis
negative 1 – f left parenthesis x right parenthesis equals 2 left parenthesis x minus 3 right parenthesis left parenthesis x plus 2 right parenthesis squared left parenthesis x minus 1 right parenthesis
0 – f left parenthesis x right parenthesis equals 2 left parenthesis x minus 3 right parenthesis left parenthesis x plus 2 right parenthesis squared left parenthesis x minus 1 right parenthesis
1 – f left parenthesis x right parenthesis equals 2 left parenthesis x minus 3 right parenthesis left parenthesis x plus 2 right parenthesis squared left parenthesis x minus 1 right parenthesis
2 – f left parenthesis x right parenthesis equals 2 left parenthesis x minus 3 right parenthesis left parenthesis x plus 2 right parenthesis squared left parenthesis x minus 1 right parenthesis
3 – f left parenthesis x right parenthesis equals 2 left parenthesis x minus 3 right parenthesis left parenthesis x plus 2 right parenthesis squared left parenthesis x minus 1 right parenthesis
f(x)=x3(x−2)(x+3)

Answers

The zeros of the following functions are

1. f(x)=2x(3−x)(x+1) , the zeros are x = 3 and -1

2.f(x)=2(x−3)(x+2)2(x−1), the zeros are x = 3 ,-2 and 1

3. f(x)=x3(x−2)(x+3), the zeros are x = 2 and -3

What are zeros of a function?

On a graph of the function, the zeroes will be the x-coordinate values at the points where the line intersects with the x-axis, or where the y-coordinate value is zero. Linear functions have one zero, but polynomial functions can have multiple zeroes. They can also have no zeroes at all.

1. 2x(3−x)(x+1) = 0

2x = 0

x = 0

3-x = 0

x = 3

x+1 = 0

x = -1

2. 2(x−3)(x+2)2(x−1) = 0

x-3 = 0

x = 3

x+2 = 0

x = -2

x -1 = 0

x = 1

3. f(x)=x³(x−2)(x+3) = 0

x³ = 0

x= 0

x-2 = 0

x = 2

x+3 = 0

x = -3

learn more about zeros of function from

https://brainly.com/question/65114

#SPJ1

solve the inequality |3x-7| < |4x+5|​

Answers

Answer:

x=6

Step-by-step explanation:

5. 100 people have food for 20 days at the rate 2kg per person per day. If 20 people left, how long will the food last if they eat (a) 2kg per person daily? (b) 1.8 kg per person daily?​

Answers

Answer:

25

Step-by-step explanation:

let the no of days food avl for eat be X .

according to question...

100/80=X/20

=X × 80 = 100×20

=80x =2000

= x =2000/80

x=25 days

WILL MAKRK AS BRAINLIEST!!!!!
A Norman window has the shape of a semicircle atop a rectangle so that the diameter of the semicircle is equal to the width of the rectangle. What is the area of the largest possible Norman window with a perimeter of 34 feet?

Answers

The dimensions of the window that maximize the area of the window is x = 17/(π - 1)(2) and y = 17 - (17/(π - 1)(2)) (1 + π ).

What is area?

An area is just a surface that is empty. The length and breadth of a form are used to compute its area. The units used to measure length are unidimensional and include feet (ft), yards (yd), inches (in), etc. Nevertheless, a shape's area can only be measured in two dimensions. As a result, it is expressed in square units such as square inches (in2), square feet (ft 2), square yards (yd2), etc. Most forms and things have edges and corners. When determining an object's area, the length and breadth of these edges are taken into account.

Let us suppose the width of the rectangle = x.

The length of the rectangle = y

Thus,

Perimeter = 2 (x + y) + πx

34 = 2x + 2y + πx

2y = 34 - 2x + πx

The area of the window is:

A = (1/2)πx²+ xy

Substitute y = 34 - 2x + πx / 2

To maximize the area we differentiate the area and equate it to 0:

A = (1/2)πx²+ x(34 - 2x + πx / 2)

A =  (1/2)πx²+ 17x - x² + π/2x²

dA/dx = πx + 17 - 2x + πx

2πx + 17 - 2x = 0

2x(π - 1) = - 17

x = 17/(π - 1)(2)

Substitute the value of x in equation:

2y = 34 - 2x + πx

2y = 34 - 2(17/(π - 1)(2)) + π( 17/(π - 1)(2))

y = 17 - (17/(π - 1)(2)) (1 + π )

Hence, the dimensions of the window that maximize the area of the window is x = 17/(π - 1)(2) and y = 17 - (17/(π - 1)(2)) (1 + π ).

Learn about perimeter here:

https://brainly.com/question/30252651

#SPJ1

a suitcase with measures 80cm*48cm*24cm is to be covered witha trapulin cloth .how many meters of tarapaulin of width 96cm is reqired to cover 100 such suitcases

Answers

To cover one suitcase, we need to find the surface area of the suitcase that needs to be covered. The surface area of the suitcase can be calculated by finding the sum of the areas of its six sides.

Area of one side of the suitcase = length x height = 80cm x 48cm = 3840 sq.cm

Area of the opposite side of the suitcase = length x height = 80cm x 48cm = 3840 sq.cm

Area of the other four sides of the suitcase = width x height = 24cm x 80cm + 24cm x 80cm + 24cm x 48cm + 24cm x 48cm = 7296 sq.cm

Total surface area of one suitcase = 3840 sq.cm + 3840 sq.cm + 7296 sq.cm = 14976 sq.cm

To cover 100 such suitcases, we need to multiply the surface area of one suitcase by 100.

Total surface area of 100 suitcases = 14976 sq.cm x 100 = 1497600 sq.cm

To find the amount of tarapaulin required, we need to divide the total surface area of 100 suitcases by the width of the tarapaulin.

Amount of tarapaulin required = (1497600 sq.cm) / (96 cm) = 15600 sq.cm

We now need to convert the required area into meters.

1 sq.cm = 0.0001 sq.m

15600 sq.cm = 15600 x 0.0001 sq.m = 1.56 sq.m

Therefore, we need 1.56 sq.m of tarapaulin to cover 100 such suitcases, assuming that there is no overlap of the tarapaulin.

A population has a mean of 400 and a standard deviation of 90. Suppose a sample of size is 100 selected and is used to estimate What is the probability that the sample mean will be within 8 of the population mean

Answers

By answering the above question, we may state that As a result, there is standard deviation a roughly 0.9999 or 99.99% chance that the sample mean will be within 8 of the population mean.

What is standard deviation?

A statistic known as standard deviation may be used to indicate the variation or variability of a set of statistics. A low standard deviation means that the values tend to be closer to the established mean whereas a large standard deviation shows that the values are widely spread. The standard deviation serves as a gauge for how far the data are from the mean (or ). The data tend to cluster around the mean when the standard deviation is low, and are more scattered when the standard deviation is high. Standard deviation is a measurement of the data set's average variability. It displays the standard deviation of each score with respect to the mean.

population + standard deviation departure from the mean / sqrt (sample size)

Standard deviation is 90/sqrt(100) and equals 9.

z is equal to (x - ) / ( / sqrt(n)).

where:

The sample mean is x. We are looking for the probability given the following conditions: where is the sample size, which is 100; is the population mean, which is 400; is the standard deviation of the distribution of sample means, which is 9;

When we change the values, we obtain:

[tex]Z = (9 / sqrt(100) / (x - 400)\\z = (x - 400) / 0.9\\P(392 < = x < = 408)\s= P[(392 - 400) / 0.9 < = z < = (408 - 400) / 0.9] .9]\\= P[-8.89 < = z < = 8.89] .89]\\[/tex]

To determine this probability, we can use a calculator or a conventional normal distribution table.

[tex]P[-8.89 < = z < = 8.89] = 0.9999[/tex]

As a result, there is a roughly 0.9999 or 99.99% chance that the sample mean will be within 8 of the population mean.

To know more about standard deviation visit:

https://brainly.com/question/23907081

#SPJ1

D=25 m
39⁰
Can someone work this out so I can check my answers thanks !

Answers

Answer:[tex]m[/tex] = [tex]d[/tex]/[tex]25[/tex]

Step-by-step explanation:I don't know if this is correct but i think it is:

Solve D=25m

Evaluate powers D = 25m

Subtract D from both sides D= 25m[tex]1[/tex] - D

Add D to both sides D=25m1

Evaluate powers D=25m

Divide both sides by 25 D/25 =m

Solution m = D/25

1. Parameter and Statistic In a Citrix Security survey of 1001 adults in the United States, it was found that 69% of those surveyed believe that having their personal information stolen is inevitable. Identify the population and sample. Is the value of 69% a statistic or a parameter?

Answers

The population in this case is all adults in the United States, and the sample is the 1001 adults who were surveyed by Citrix Security.

Is the value of 69% a statistic or a parameter?

The sample was selected in such a way as to be representative of the larger population of adults in the United States.

The value of 69% is a statistic, not a parameter. A statistic is a measure that describes a characteristic of a sample, while a parameter is a measure that describes a characteristic of a population. In this case, the 69% refers to the proportion of the 1001 adults surveyed who believe that having their personal information stolen is inevitable, which is a characteristic of the sample. It does not necessarily reflect the proportion of all adults in the United States who hold this belief, which would be a parameter.

Learn more about statistics here:

brainly.com/question/29093686

#SPJ1

Given a right triangle, ABC, where C = 90° and AB = 8 in. and BC = 3 in. Determine the exact value of cot (A).

Answers

The value of cot A is √55/3

What is trigonometric ratio?

Trigonometric Ratios are defined as the values of all the trigonometric functions based on the value of the ratio of sides in a right-angled triangle. The ratios of sides of a right-angled triangle with respect to any of its acute angles are known as the trigonometric ratios of that particular angle.

cot A = 1/tanA

AC = √ 8²-3²

AC = √64-9

AC = √ 55

tanA = 3/√55

cot A = 1/tanA

cot(A )= 1/(3/√55)

cot( A) = √55/3

therefore the value of cot(A) = √55/3

learn more about trigonometric ratio from

https://brainly.com/question/24349828

#SPJ1

i need help asap it is homework

Answers

Answer:

See below.

Step-by-step explanation:

Hello!

The topic we should review for this problem is Order of Operations.

What is Order of Operations?

Order of Operations is a rule that identifies which part of an equation should be simplified first.

You might've heard of PEMDAS, where;

P for Parentheses, always first unless there's an exponent inside.

E for Exponent, simplified after the Parentheses.

M or D - Multiplication or Division after the Exponent(s).

A or S - Addition or Subtraction after Multiplication or Division.

[tex](5+3^2)+18[/tex]

First we know that there's an Exponent inside the Parentheses, so we must evaluate that number first.

[tex](5+9)+18[/tex]

Next, evaluate what's in the Parentheses.

[tex]14+18\\32[/tex]

Our correct answer is 32.

We are asked what mistake did Raquel make, and what's the correct simplified version of the expression.

1a.) Raquel's mistake is combining unlike terms. It's impossible to combine together a natural number (5) and an exponential number. (3²)

1b.) The correct simplified version of the expression is represented here;

[tex](5+9)+18\\(First \ Step)[/tex]

Which equation has the same solution set as (x - 3)² = 0 ?
-2x²-18
x²-9=0
x² + 6x = -9
12x -18=2x²

Answers

Answer:

x^2 - 9 = 0

Step-by-step explanation:

its right one.......

There are 50 volunteers to start a community service project. The project organizer expects this number to increase by 6% every hour for the next
5 hours. If the organizer is correct, which value is closest to the number of volunteers the project will have at the end of five hours?
63
65
67
71

Answers

65 after 5 hours the project will increase by 30% so it will be 65

Consider the following piece wise function:
Evaluate the expression: 2f(6) + f(-5) - 3f(-1) = {fill in the blank }

Answers

The value of expression [tex]2F(6) + F(-5) - 3F(-1)[/tex] is 6 while considering the given piece wise function.

What is piece wise function ?

A piecewise function is a function that is defined by different mathematical expressions or formulas for different intervals or "pieces" of the domain. In other words, a piecewise function is a function that is defined by multiple sub-functions, each corresponding to a different part of the domain.

While considering piece wise function:

[tex]F(6) = 4[/tex]                                                                 [tex](x \geq 3)[/tex]

[tex]F(-5) = x + 3 = (-5) + 3 = -2[/tex]                            [tex](x\leq -3)[/tex]

[tex]F(-1) =[/tex] [tex]-x^2 + 1 = -(-1)^2 + 1 = -1 + 1 = 0[/tex]       [tex](-3 < x < 3)[/tex]

Now put the value of F(6), F(-5) and F(-1) in the expression :

[tex]2F(6) + F(-5) - 3F(-1)[/tex]

we get :

[tex]= 2F(6) + F(-5) - 3F(-1) \\= 2(4) + (-2) -3(0)\\= 8 -2\\= 6[/tex]

Therefore, the value of expression [tex]2F(6) + F(-5) - 3F(-1)[/tex] is 6 while considering the given piece wise function.

To learn more about domain from the given link :

https://brainly.com/question/28135761

#SPJ1

Which graph best represents the function f(x)=4x−4f(x)=4x−4?

Answers

The best represent graph of the function is option a.

What is a function?

It is an expression which contains one independent variable and another is dependent variable.

The given function is

   f(x)= [tex]4^{x[/tex] - 4

As it is an exponential function so it must have a horizontal asymptote. Here the horizontal asymptote is f(x)= -4

For x intercept we need to take f(x)=0 and for y intercept substitute 0 for x and solve for y. [Here y can be treated as f(x).]

Here x intercept(s)= None

y intercept(s) = (0,-3)[ putting x=0 in   f(x) so 1-4= -3]

Hence the graph is given below.

To know more about function https://brainly.com/question/11624077

from the given link.

#SPJ1

Evaluate d3a2−(c+b)
if a=−2
, b=3
, c=−12
, and d=−4
.

Answers

After evaluating the given expression, d3a2−(c+b) equals -39 when a=-2, b=3, c=-12, and d = -4

What is Algebraic expression?

An Algebraic expression is a combination of numbers, variables, and mathematical operations (such as addition, subtraction, multiplication, and division) that can be simplified and evaluated.t may contain one or more variables, which are symbols that represent unknown quantities or values that can vary.

Algebraic expressions can be written using letters, symbols, or a combination of both, and they can be used to model real-world situations, solve problems, and express mathematical relationships. For example, "3x + 5" is an algebraic expression that represents a linear equation with one variable "x".

The given expression is d3a2−(c+b), where a = -2, b = 3, c = -12, and d = -4. Substituting these values, we get:

d3a2−(c+b) = (-4)3(-2)² - (-12 + 3) = -434 - (-9) = -48 + 9 = -39

Therefore, d3a2−(c+b) equals -39 when a=-2, b=3, c=-12, and d=-4.

To learn more about algebraic expression from given link 

brainly.com/question/28884894

#SPJ1


I need help on this question please anyone ?!!!!??!!!

Answers

PLEASE GIVE BRAINLIEST <3

Answer:

I'm pretty sure it's bumper cars ( B ).

Hope this helped! <3

the price of a ticket on the local commuter train can be determined from the expression 1.35 + 0.40(s), where s is the number of stops for which the passenger will be on the train

Answers

The price οf the ticket when the number οf stοps is 13, fοund using the given expressiοn, is $6.55.

What is an expressiοn?

Mathematical expressiοns cοnsist οf at least twο numbers οr variables, at least οne maths οperatiοn, and a statement. It's pοssible tο multiply, divide, add, οr subtract with this mathematical οperatiοn. A finite cοmbinatiοn οf symbοls that are well-fοrmed in accοrdance with cοntext-dependent principles is referred tο as an expressiοn οr mathematical expressiοn. There are twο sοrts οf expressiοns in mathematics: numerical expressiοns, which οnly cοntain numbers, and algebraic expressiοns, which alsο include variables. Expressiοns can be categοrised as arithmetic/numerical expressiοns, fractiοnal expressiοns, οr algebraic expressiοns depending οn the terms they cοntain.

Given the expressiοn as:

1.35 + 0.40(s)

This is used tο calculate the price οf a ticket οn the lοcal cοmmuter train.

s = number οf stοps

Nοw the cοmplete questiοn is tο calculate the price οf the ticket fοr 13 stοps.

Sο s = 13

Substitute in the expressiοn,

1.35 + 0.40(s) = 1.35 + 0.40 * 13 = 1.35 + 5.2 = $6.55

Therefοre the price οf the ticket when the number οf stοps is 13, fοund using the given expressiοn, is $6.55.

To learn more about expressions, follow the link.

https://brainly.com/question/723406

#SPJ1

GRAPHING EXPONENTIAL FUNCTIONS! BRAIN REWARD

Answers

Answer:

Step-by-step explanation:

SEE THE ATTACHMENT

For the geometric series –8, 4, –2, . . . find the following sums:

a. s3

b. s6

c. s25

d. S, the sum of the series

Answers

geometric series:

[tex]\dfrac{4}{-8} = - \dfrac{1}{2}[/tex]

[tex]\dfrac{-2}{4} = - \dfrac{1}{2}[/tex]

[tex]\implies r = - \dfrac{1}{2} \ \ and \ \ a_{1} = -8[/tex]

[tex]\boxed{S_{n} = \dfrac{a_{1}\cdot (1 - {r}^{n}) }{1 - r}}[/tex]

a. n = 3

[tex]S_{3} = - 8 + 4 - 2 = 4 - 10 = \bf -6\\[/tex]

b. n = 6

[tex]S_{6} = \dfrac{(-8)\cdot \Big(1 - { \Big(- \dfrac{1}{2}\Big)}^{6}\Big) }{1 - \Big( - \dfrac{1}{2}\Big)} = \dfrac{(-8)\cdot \Big(1 - \dfrac{1}{2^{6}}\Big)}{1 + \dfrac{1}{2}} = \dfrac{-8 + \dfrac{1}{2^{3}}}{\dfrac{3}{2}} =\\[/tex]

[tex]= \dfrac{-64+1}{2^{3}} \cdot \dfrac{2}{3} = -\dfrac{63}{2^{2}(3)} = \bf -\dfrac{21}{4}[/tex]

c, n = 25

[tex]S_{25} = \dfrac{(-8)\cdot \Big(1 - { \Big(- \dfrac{1}{2}\Big)}^{25}\Big) }{1 - \Big( - \dfrac{1}{2}\Big)} = \dfrac{(-8)\cdot \Big(1 + \dfrac{1}{2^{25}}\Big)}{1 + \dfrac{1}{2}} = - \dfrac{8 + \dfrac{1}{2^{22}}}{\dfrac{3}{2}} =\\[/tex]

[tex]= - \dfrac{8 + \dfrac{1}{2^{22}}}{\dfrac{3}{2}} = - \dfrac{1 + 2^{25}}{2^{22}} \cdot \dfrac{2}{3} = \bf - \dfrac{1 + 2^{25}}{(3)2^{21}}\\[/tex]

WILL GIVE BRANLIST AND POINTS Triangle XYZ is drawn with vertices X(-2, 4), Y(-9, 3), Z(-10, 7). Determine the line of reflection that produces X'(2, 4).
Options
Oy=-2
y-axis
Ox=4
O x-axis

Answers

The line of reflection that produces X'(2, 4) is,

⇒ y - axis

What is mean by Translation?

A transformation that occurs when a figure is moved from one location to another location without changing its size or shape is called translation.

We have to given that;

Triangle XYZ is drawn with vertices X(-2, 4), Y(-9, 3), Z(-10, 7).

Now, We know that;

The rule for a reflection over the y -axis is (x, y) → (- x, y)

Here, The line of reflection is produces X'(2, 4).

Hence, We get;

The rule for line of reflection that produces X'(2, 4) is,

⇒ y - axis

Thus, The line of reflection that produces X'(2, 4) is,

⇒ y - axis

Learn more about the transformation visit:

https://brainly.com/question/30097107

#SPJ1

- Two dry cleaning companies offer a home pick-up and delivery service. The monthly cost depends on the number of garments laundered, and is shown in the following table.

Number of Garments

5

10

15

Company 1

$55.25

$75.50

$95.75

Company 2

$31.25

$57.50

$83.75

Answers

The ordered pair representing the point where both companies would charge the same amount is (25, 136.25).

When would both companies charge the same amount?

From the given table, we can form the following equation for monthly cost of each company.

Company 1, the function for the monthly cost is;

(5, $55.25 ) and (10, $75.5). Let the monthly cost = y₁

(y₁ - 55.25 )/(x - 5) = ( 75.5 - 55.25 )/ (10 - 5)

y₁ = 4.05x + 35

Company 2, the function for the monthly cost is;

(5, $31.25 ) and (10, $57.5). Let the monthly cost = y₂

(y₂- 31.25 )/(x - 5) = ( 57.5 - 31.25 )/ (10 - 5)

y₂ = 5.25x + 5

To find the point where both companies charge the same amount, we need to set their costs equal to each other and solve for the number of garments, x:

y₁ = y₂

4.05x + 35 = 5.25x + 5

Subtracting 4.05x and 5 from both sides:

30 = 1.2x

Dividing both sides by 1.2:

x = 25

So both companies would charge the same amount when 25 garments are laundered. T

To find the cost, we can plug x = 25 into either equation:

y₁ = 4.05(25) + 35 = 136.25

y₂ = 5.25(25) + 5 = 136.25

Ordered pair = (25, 136.25)

Learn more about same amount for two services here:  https://brainly.com/question/14133517

#SPJ1

The complete question is below:

Two dry cleaning companies offer a home pick-up and delivery service. The monthly cost depends on the number of garments laundered, and is shown in the following table.

Number of Garments      Company 1       Company 2

5                                         $55.25              $31.25

10                                        $75.50             $57.50

15                                        $95.75              $83.75

Determine when both companies would charge the same amount and what that cost would be. Write your answer as an ordered with x representing the number of garments and y representing the cost.

Fractions:

4/5 is greater, less than, or equal to 8/10?

Answers

Answer:

Equal to.

Step-by-step explanation:

multiply both numbers by 2

first increase and then rework each by decreasing

a. 400 by 20%

b. 650 by 30%

c.820 by 45%

d. 150 by 2,5%

e. 300 by 5%

f. 420 by 2,5%

Answers

Answer:

a. 480       Then 384

b. 845       Then 591.5
c. 1,189      Then 653.95
d. 153.75   Then 149.90625
e. 315        Then 299.25

f. 430.5     Then 419.7375

Select all the equations where b = 11 b=11b, equals, 11 is a solution. Choose 2 answers: Choose 2 answers: (Choice A) 2 b = 211 2b=2112, b, equals, 211 A 2 b = 211 2b=2112, b, equals, 211 (Choice B) b + 18 = 7 b+18=7b, plus, 18, equals, 7 B b + 18 = 7 b+18=7b, plus, 18, equals, 7 (Choice C) 77 = 7 b 77=7b77, equals, 7, b C 77 = 7 b 77=7b77, equals, 7, b (Choice D) 9 = b − 2 9=b−29, equals, b, minus, 2 D 9 = b − 2 9=b−29, equals, b, minus, 2 (Choice E, Checked) 11 = 33 ÷ b 11=33÷b11, equals, 33, divided by, b E 11 = 33 ÷ b 11=33÷b11,

Answers

The equations where b = 11 are A, B, C, D, and E. All of these equations are true when b = 11.

How to point equation on a graph?

To point an equation on a graph, first, determine the equation and its variables. Then, plot the points of the equation on the graph by substituting the variable values and plotting the corresponding points. To find the equation’s slope, calculate the rise and run of two points on the graph. The slope is used to draw a line of best fit. Finally, draw a line that intersects the points of the equation and the line of best fit. This will be the equation’s graph.

Choice A states that 2b = 2112, b, equals, 211, which means that 2 times 11 is equal to 21. Choice B states that b + 18 = 7b, plus, 18, equals, 7, which means that 11 plus 18 is equal to 7. Choice C states that 77 = 7b77, equals, 7, b, which means that 77 divided by 7 is equal to 11. Choice D states that 9 = b − 29, equals, b, minus, 2, which means that 11 minus 2 is equal to 9. Finally, Choice E states that 11 = 33 ÷ b11, equals, 33, divided by, b, which means that 33 divided by 11 is equal to 11. Therefore, all of these equations are true when b = 11.

For more questions related to slope,

https://brainly.com/question/3605446

#SPJ1

What is the volume of the triangular prism?


PLS HELP!!

Answers

Answer:

20cm³

Step-by-step explanation:

Volume = Base x Height

1/2 x 5 x 2 x 4

=20cm³

Please answer this calculus question:

Answers

The volume generated by rotating the region bounded by curves x = √y, x= 0 and y = 6 about the x-axis is 24π cubic units.

What is the volume of the region

To use the method of b, we will imagine taking thin slices parallel to the axis of rotation and adding up their volumes.

To use the method of cylindrical shells, we need to determine the height and radius of each cylindrical shell. We will take thin vertical slices parallel to the y-axis.

The height of each cylindrical shell will be dy. The radius of each cylindrical shell will be x, which is equal to √y.

The volume of each cylindrical shell will be:

[tex]dv = 2\pi x * dy[/tex]

Substituting x = √y, we get:

[tex]dV = 2\pi \sqrt{y} * dy[/tex]

To find the total volume, we need to integrate dV from y = 0 to y = 6:

V = ∫₀⁶ 2π√y dy

Using the power rule of integration, we get:

V = 2π [2/3 * y^(3/2)] from 0 to 6

[tex]V = 2\pi * [2/3 * (6)^\frac{3}{2} - 0][/tex]

[tex]v = 24\pi[/tex]

Learn more on volume of a region by cylindrical shells here;

https://brainly.com/question/30689905

#SPJ1

principal = $150
rate = 6%
time =?
simple interest = $54

Answers

Answer:

150 %6=es igual 1% dividimis 150 ÷100 para tener 150, se calcula el porcwntaje

Find the slope of a line parallel to the line whose equation is
5


3

=
18
5x−3y=18. Fully simplify your answer.

Answers

The slope of a line parallel to the line whose equation is 5x - 3y = 18 is equal to 5/3.

What is the slope-intercept form?

In Mathematics, the slope-intercept form of an equation of a straight line is given by this mathematical expression;

y = mx + c

Where:

m is the gradient, slope, or rate of change.x and y represent the points.c represents the y-intercept or initial value.

Making y the subject of formula, we have the following:

5x - 3y = 18

3y = 5x - 18

y = 5x/3 - 6

In Geometry and Mathematics, two (2) lines are said to be parallel under the following conditions:

m₁ = m₂ ⇒ 5/3 = 5/3

Read more on slope here: brainly.com/question/3493733

#SPJ1

The back of a garbage truck is 23 feet long, 8 feet wide, and 12 feet tall. How many loads of trash from the garbage truck will it take to fill a 40 foot by 9 foot by 8 foot storage container?

Answers

it will take approximately 1.30 loads of trash from the garbage truck to fill the 40-foot by 9-foot by an 8-foot storage container. However, since you can't have a partial load, you would need to round up to 2 loads to completely fill the container.

what is an algebraic expression?

An algebraic expression is a combination of numbers, variables, and mathematical operations (such as addition, subtraction, multiplication, and division) that can be simplified and evaluated.

To determine the number of loads of trash from the garbage truck that will fill a 40-foot by 9-foot by 8-foot storage container, we need to compare the volume of the container to the volume of the garbage truck's back.

The volume of the garbage truck's back is:

V_garbage_truck = length x width x height

V_garbage_truck = 23 ft x 8 ft x 12 ft

V_garbage_truck = 2,208 cubic feet

The volume of the storage container is:

V_container = length x width x height

V_container = 40 ft x 9 ft x 8 ft

V_container = 2,880 cubic feet

To find out how many loads of trash from the garbage truck will fill the storage container, we need to divide the volume of the container by the volume of the garbage truck's back:

Number of loads = V_container / V_garbage_truck

Number of loads = 2,880 cubic feet / 2,208 cubic feet

Number of loads ≈ 1.30 loads

Therefore, it will take approximately 1.30 loads of trash from the garbage truck to fill the 40-foot by 9-foot by an 8-foot storage container. However, since you can't have a partial load, you would need to round up to 2 loads to completely fill the container.

To learn about algebraic expression from given link

https://brainly.com/question/953809

#SPJ1

Steve and Silva are both members of a population, and a simple random
sample is being conducted. If the chance of Steve being selected is 1
what is the chance of Silva being selected?
98,000'
OA.
B.
O C.
O D.
1
98
1
9800
1
980
98,000

Answers

According to the probability, the answer is option D: 1/98,000.

What is probability?

Probability is a measure of the likelihood or chance of an event occurring. It is a number between 0 and 1, where 0 represents an impossible event and 1 represents a certain event.

The chance of Steve being selected is 1. This means that out of 1 individual, Steve is selected. The probability of Steve being selected is 1/1 or 1. Since the sample is a simple random sample, each individual in the population has an equal chance of being selected. If there are a total of 98,000 individuals in the population, then the probability of Silva being selected is 1 out of 98,000, or 1/98,000.

Therefore, the answer is option D: 1/98,000.

To learn more about probability visit:

brainly.com/question/4152354

#SPJ1

Other Questions
Suppose that (Yi, Xi) satisfy the least squares assumptions in Key Concept 4. 3 and, in addition, ui is N(0, 2 u) and is independent of Xi. A sample of size n = 30 yields = 43. 2 + 61. 5X, R2 = 0. 54, SER = 1. 52, (10. 2) (7. 4) where the numbers in parentheses are the homoskedastic-only standard errors for the regression coefficients. a) Construct a 95% confidence interval for 0. b) Test H0: 1 = 55 vs. H1 : 1 55 at the 5% level. c) Test H0: 1 = 55 vs. H1 : 1 > 55 at the 5% level 2. (a) Analyze What motivation fuels Martin's initial feelings aboutGrandpa? (b) Assess How does it affect his behavior? (c) AnalyzeWhat events occur that change Martin's motivation and behavior?3. (a) Analyze What conflict does Martin face? (b) How does he resolvethis conflict?4. (a) Analyze What does Martin come to realize in this story? Explain.(b) Interpret What theme, or insight about life, do Martin's conflictand the story's resolution help to convey? Explain. CO(g) + Cl (g) = COCh2 (g)If Ke 5.0 at 600 K for this reaction, what are the equilibrium partial pressures of the three gasesif a reaction vessel initially contains a mixture of the reactants in which Pco = Pc2=0.265 atmand there is no COCl? A stretch of DNA thought to be involved with cancer suppression is sequenced and compared amongst people who have succumbed to cancer and those that have not. It is believed that the region encodes a protein of some sort. Identify the type of mutation and its effect on the protein.Normal individual : (wild type) 5'CACATGAACGAGCCCTTTGCGAGTGACTA3'Cancer patient 1 5' CACATGAACGAGCCTTTTGCGAGTGACTA 3'Cancer patient 2 5' CACATGAACGAGCCCTTTTGAGAGTGACTA 3' What is the fluid found within the body's cells called? Why was the acquisition of land so critical for the newly freed slaves?A. Without land, freedmen were not allowed to hold officeB. Without land, freedmen were not allowed to voteC. Without land, freedmen would be unable to generate their own incomeD. Without land, freedmen could only enter the economy as laborers or craftsmen A 17-year-old Senior High School student visited the clinic for consultation with history of 4-day diarrhea, inappetence, mild abdominal pain, and fatigue, after spending the weekend in their province. Stool samples were collected and placed in 10% formalin and Zn-PVA fecal preservatives and were sent to the laboratory for analysis. Photomicrographs below show organisms seen by the Medical Technologist in a trichrome-stained slide of the Zn-PVA sample. He also mentioned that the organisms' size ranges from 12-26m. What is your diagnosis? Based on what criteria? What further testing, if any, would you recommend? What statement describes the cause for sibling rivalry between both brothers? The windpipe is properly called the At its lower end it divides into right and left into progressively smaller The aveolar ducts of the lungs terminate in structures called whose walls are composed of A true breeding pink flowered petunia plant is crossed with a true breeding white petunia plant, and the F1s have purple flowers. The F1 is selfed, and F2 plants are obtained. Of the 80 F2s, 53 have pink flowers, and 27 have white flowers. If the phenotypic difference is due to two alleles of one gene, what ratio of purple to white flowered plants do you expect in the F2?Using the chi-squared test, determine if the results in the F2 generation support the hypothesis that the phenotypic difference is due to two alleles in one gene. Explain your answer with math. Q: In the case of Pakistans economy, write down in your own words the implications of following two situations on the parameters (such as depreciation, population growth, productivity, saving rate) of the Solow Model.a. Situation 1: Extreme wave of Covid-19 leading towards mobility restrictions.b. Situation 2: Russian attack on Ukraine lead to more uncertainty. The company believes it will be able to hire a qualified individual for a $95,000.00 annual salary. The company pays $150.00 of each employees $400.00 monthly insurance premium. Determine the total annual salary and payroll tax expense for the employee, assuming the company does not have an IRS-approved health care plan. What happens when sample size is small and population S.D is unknown?i. Values on the Z row on the table (or Z values) can't be used.( note that Z is normal distribution)ii. we use the sample distributionA. i onlyB. i and ii onlyC. ii onlyD. None of the abov 1. Answer the following characteristics for BasidiomycotaFungi.A. ColorB. TextureC. FormD. SizeE. Starch storage (where) The monthly salary of Mr. Jha is Rs. 16,500. He spend his income in every month in the following ways:Food:- 20%, House:- 25%, Fuel:- 10%, Miscellaneous:- 15% (i) Find his monthly expenditure on each item. (ii) How much does he save every month? What advice does Pericles give to the parents of the deceased soldiers? What is the purpose of his advice? Given cost and price (demand) functions C(q) = 100q43,800 and p(q) = -29.860, what profit can the company ear by selling 40 items? It can expect to earn sin profit. (Round answer to nearest dollar) A skydiver is laying out a circular target for his next jump that has a diameter of 16 FEET. Which EXPRESSION can be used to determine the area of the target?Pls hurryyy thxxxxsss PLSSS HELP !! Sarah asked the students in her class if they had a pet cat. Of the students, 6 out of 20 had a pet cat. If there are360 students in the school, how many could be expected to have a pet cat? When in the Course of human events, it becomesnecessary for one people to dissolve the political bandswhich have connected them with another... a decentrespect to the opinions of mankind requires that theyshould declare the causes which impel them to theseparation.-Declaration of Independence,1776What does this quotation from the introduction of theDeclaration of Independence do?It explains what the rest of the document will doIt acknowledges the authority of the monarchy.OIt lists the rights that nature gives all menIt states the colonists' lack of respect for GreatBritain