Please! help and tell me the answers, or help me figure out these answers for 20 points? please! And please help me. Can anybody help me?

Please! Help And Tell Me The Answers, Or Help Me Figure Out These Answers For 20 Points? Please! And
Please! Help And Tell Me The Answers, Or Help Me Figure Out These Answers For 20 Points? Please! And
Please! Help And Tell Me The Answers, Or Help Me Figure Out These Answers For 20 Points? Please! And
Please! Help And Tell Me The Answers, Or Help Me Figure Out These Answers For 20 Points? Please! And
Please! Help And Tell Me The Answers, Or Help Me Figure Out These Answers For 20 Points? Please! And

Answers

Answer 1

Answer:

1. Pattern (rule) : y = x-6

2. Pattern (rule) : y=x^2+1

3. Pattern (rule)  : y = -3x

4. Pattern (rule) : y = 2x-2

5. Pattern (rule) : y = x^2

Step-by-step explanation:

Note: question number correspond to your order of questions.

1. Pattern (rule) : y = x-6

for missing parts, see attached table.

2. Pattern (rule) : y=x^2+1

3. Pattern (rule)  : y = -3x

4. Pattern (rule) : y = 2x-2

5. Pattern (rule) : y = x^2

Please! Help And Tell Me The Answers, Or Help Me Figure Out These Answers For 20 Points? Please! And
Please! Help And Tell Me The Answers, Or Help Me Figure Out These Answers For 20 Points? Please! And
Please! Help And Tell Me The Answers, Or Help Me Figure Out These Answers For 20 Points? Please! And
Please! Help And Tell Me The Answers, Or Help Me Figure Out These Answers For 20 Points? Please! And
Please! Help And Tell Me The Answers, Or Help Me Figure Out These Answers For 20 Points? Please! And

Related Questions

The set is a basis for a subspace W. Use the Gram-Schmidt process to produce an orthogonal basis for W. Assume the vectors are in the order bold x1 and bold x2
1 7
-4 -7
0 -6
1 1
The orthogonal basis produced using the Gram-Schmidt process for W is:__________. (Use a comma to separate vectors as needed.)

Answers

Answer:

[tex]y_1 = \left[\begin{array}{ccc}1\\-4\\0\\1\end{array}\right][/tex]  ,  [tex]y_2 = \left[\begin{array}{ccc}5\\1\\-6\\-1\end{array}\right][/tex]

Step-by-step explanation:

[tex]x_1 = \left[\begin{array}{ccc}1\\-4\\0\\1\end{array}\right][/tex]    and [tex]x_2 = \left[\begin{array}{ccc}7\\-7\\-6\\1\end{array}\right][/tex]

Using Gram-Schmidt process to produce an orthogonal basis for W

[tex]y_1 = x_1 = \left[\begin{array}{ccc}1\\-4\\0\\1\end{array}\right][/tex]

Now we know X₁ , X₂ and Y₁

Lets solve for Y₂

[tex]y_2 = x_2- \frac{x_2*y_1}{y_1*y_1}y_1[/tex]

see attached for the solution of Y₂

Solve of the following equations for x: 2 − x = −3

Answers

Answer:

x=5

Step-by-step explanation:

2 − x = −3

Subtract 2 from each side

2-2 − x = −3-2

-x = -5

Multiply by -1

x = 5

a survey was done Of 600 shoppers at a grocery store to determine if they like a new flavor Of potato chip. Of the 600 shoppers, 376 of them liked the new flavor. a) What percentage of the 600 shoppers liked the new flavor? Round your answer to the nearest percent. b) If 37.5% of the. 600 shoppers stated they would buy the new flavor, how many of the 600 would buy it?

Answers

Answer:

63%

225 buyers

Step-by-step explanation:

To find the percent take the number that liked it over the total

376/600

Change to decimal form

.62666666

Change to percent by multiplying by 100

62.66666666%

The nearest percent is 63%

37.5 % would but it then multiply by the number of shoppers

37.5 % ( 600)

Change to decimal form

.375 * 600

225

Cincinnati Paint Company sells quality brands of paints through hardware stores throughout the United States. The company maintains a large sales force whose job it is to call on existing customers as well as look for new business. The national sales manager is investigating the relationship between the number of sales calls made and the miles driven by the sales representative. Also, do the sales representatives who drive the most miles and make the most calls necessarily earn the most in sales commissions? To investigate, the vice president of sales selected a sample of 25 sales representatives and determined:
%u2022 The amount earned in commissions last month (Y).
%u2022 The number of miles driven last month (X2)
%u2022 The number of sales calls made last month (X1)
($000) Calls Driven Commissions
($000) Calls Driven
22 139 2,371 38 146 3,290
13 132 2,226 44 144 3,103
33 144 2,731 29 147 2,122
38 142 3,351 38 144 2,791
23 142 2,289 37 149 3,209
47 142 3,449 14 131 2,287
29 138 3,114 34 144 2,848
38 139 3,342 25 132 2,690
41 144 2,842 27 132 2,933
32 134 2,625 25 127 2,671
20 135 2,121 43 154 2,988
13 137 2,219 34 147 2,829
47 146 3,463
Click here for the Excel Data File
Develop a regression equation including an interaction term. (Round your answers to 3 decimal places. Negative amounts should be indicated by a minus sign.)
Commissions = + Calls + Miles - X1X2
Complete the following table. (Round your answers to 3 decimal places. Negative amounts should be indicated by a minus sign.)
Predictor Coef SE Coef T P
Constant
Calls
Miles
X1X2
Compute the value of the test statistic corresponding to the interaction term. (Round your answer to 2 decimal places. Negative amount should be indicated by a minus sign.)
Value of the test statistic
Is there a significant interaction between the number of sales calls and the miles driven?

Answers

Answer:

There is no significant interaction between the number of sales calls and the miles driven.

Step-by-step explanation:

The variables are defined as follows:

Dependent (Y) = amount earned in commissions last month

Independent (X₁) = number of miles driven last month

Independent (X₂) = number of sales calls made last month

In this case we need to test whether there is a significant interaction between the number of sales calls and the miles driven.

The hypothesis can be defined as follows:

H₀: There is no significant interaction.

Hₐ: There is a significant interaction.

Assume that the significance level of the test is, α = 0.05.

Use the Data Analysis tool in Excel to form the regression equation.

For the regression equation, we need to compute the values of (X₁ × X₂).

Steps:

Go to Data - Data Analysis - Regression. A dialog box will open.Select the Y values in the "Input Y range" and values of X₁, X₂ and X₁ × X₂ in the "Input X range".Click OK.

The output of the regression analysis is attached below.

The regression equation is:

[tex]Y=-455.07+3.128\cdot X_{1}+0.143\cdot X_{2}-0.001\cdot X_{1}X_{2}[/tex]

Consider the third table in the regression output.

The test statistic corresponding to the interaction term is:

t = -1.85

The p-value for the test of the interaction term is:

p-value = 0.078.

The p-value of the test is more than the significance value.

The null hypothesis will not be rejected.

Thus, concluding that there is no significant interaction between the number of sales calls and the miles driven.

Can someone teach me on how to do these type of problems

Answers


A. 22√2

B. 11 √6/2

C. 11√6/4

D. 11 √2/4

Answers

Answer:

11[tex]\sqrt{x6/4[/tex]

Given:

The triangle on the left ( triangle 1) has a 60º, a 90º, and a side that equals 11.

So we know the triangle on the right (triangle 2) has a 45º and a 90º angle.

Triangle 2

Since triangle angles always have a sum of 180º, we can solve for the third angle of triangle 2. 180 - (45 + 90) = 45. So the third angle of triangle 2 is 45º.

This is a special type of right triangle called a 45-45-90. An image of the leg/hypotenuse is uploaded below. Meaning, if we solve for the leg that joins the two triangles, we can solve for the hypotenuse.

Triangle 1

To solve for the middle leg, we work with the information we have. So first, find the third angle. 190 - (60 + 90) = 30. This brings us to a second type of special right triangle. An image of the leg/hypotenuse is uploaded below.

Given that we have a side angle of 11, we know that is 2x due to orientation. So 2x=11 simplifies to x=5.5. We then plug that back in to find the leg that we want: 5.5[tex]\sqrt{3}[/tex] .

Triangle 2

Now that we have a side length for the second triangle we can solve. x for this triangle is 5.5[tex]\sqrt{3}[/tex] so to find the hypotenuse we plug into x[tex]\sqrt{2}[/tex]. This turns into (5.5[tex]\sqrt{3}[/tex][tex]\sqrt{2}[/tex]) which simplifies into 5.5[tex]\sqrt{6}[/tex] = 13.47

Answers

The answers are not in the correct form. By going through and finding the decimal form of each, you find out that 11[tex]\sqrt{6/4}[/tex] is equivalent to 13.47, therefore your answer.

Which equations are equivalent to Three-fourths + m = negative StartFraction 7 over 4 EndFraction? Select three options. m = StartFraction 10 over 4 EndFraction m = negative StartFraction 10 over 4 EndFraction m = negative five-halves StartFraction 11 over 4 EndFraction + m = negative one-fourth Negative five-fourths + m = negative StartFraction 15 over 4 EndFraction

Answers

Answer:

1)  m = negative StartFraction 10 over 4 EndFraction

2) m = negative five-halves

3) m = [tex]-\frac{7}{4} - \frac{3}{4}[/tex]

Step-by-step explanation:

The given equation is:

=> [tex]\frac{3}{4} +m = -\frac{7}{4}[/tex]

Subtracting 3/4 to both sides

=> m = [tex]-\frac{7}{4} - \frac{3}{4}[/tex]

=> m = [tex]\frac{-10}{4}[/tex]

=> m = [tex]-\frac{5}{2}[/tex]

Answer:

-5/2 ye

cause ya do the math

Step-by-step explanation:

Hermina cut a 10'' by 15'' piece of cardboard down the diagonal. A rectangle is 10 inches wide and 15 inches long. A diagonal cut is shown with a line labeled c. The cut divides the rectangle in half and creates two right triangles. The hypotenuse of each right triangle is the line labeled c. What is the length c of the cut, in inches?

Answers

Answer:

18.03 inches

Step-by-step explanation:

The cardboard is cut as shown below.

The line c cuts the rectangle into 2 right angled triangles.

To find the diagonal (hypotenuse), we have to apply Pythagoras Rule:

[tex]hyp^2 = opp^2 + adj^2\\\\=> c^2 = 10^2 + 15^2\\\\c^2 = 100 + 225 = 325\\\\[/tex]

=> c = 18.03" = 18.03 inches

The length of c, the diagonal, is 18.03 inches.

please answer asap. there are two pics :)

Answers

Answer:

[tex]\boxed{\sf A. \ 0.34}[/tex]

Step-by-step explanation:

The first triangle is a right triangle and it has one acute angle of 70 degrees.

We can approximate [tex]\sf \frac{WY}{WX}[/tex] from right triangle 1.

The side adjacent to 70 degrees is WY. The side or hypotenuse is WX.

The side adjacent to 70 degrees in right triangle 1 is 3.4. The side or hypotenuse is 10.

[tex]\sf \frac{3.4}{10} =0.34[/tex]

perform the division...please!​

Answers

Answer:

-7/3x + 3

Step-by-step explanation:

Answer:

(9x-7)/3x or (3-7/3x)

Step-by-step explanation:

Divide each term of numerator by denominator.

-28x^5/12x^6 +36x^6/12x^6

-7/3x +3

iv)
6x+3y=6xy
2x + 4y= 5xy​

Answers

Answer:

Ok, we have a system of equations:

6*x + 3*y = 6*x*y

2*x + 4*y = 5*x*y

First, we want to isolate one of the variables,

As we have almost the same expression (x*y) in the right side of both equations, we can see the quotient between the two equations:

(6*x + 3*y)/(2*x + 4*y) = 6/5

now we isolate one off the variables:

6*x + 3*y = (6/5)*(2*x + 4*y) =  (12/5)*x + (24/5)*y

x*(6 - 12/5) = y*(24/5  - 3)

x = y*(24/5 - 3)/(6 - 12/5) = 0.5*y

Now we can replace it in the first equation:

6*x + 3*y = 6*x*y

6*(0.5*y) + 3*y = 6*(0.5*y)*y

3*y + 3*y = 3*y^2

3*y^2 - 6*y = 0

Now we can find the solutions of that quadratic equation as:

[tex]y = \frac{6 +- \sqrt{(-6)^2 - 4*3*0} }{2*3} = \frac{6 +- 6}{6}[/tex]

So we have two solutions

y = 0

y = 2.

Suppose that we select the solution y = 0

Then, using one of the equations we can find the value of x:

2*x + 4*0 = 5*x*0

2*x = 0

x = 0

(0, 0) is a solution

if we select the other solution, y = 2.

2*x + 4*2 = 5*x*2

2*x + 8 = 10*x

8 = (10 - 2)*x = 8x

x = 1.

(1, 2) is other solution

Solve the quadratic equation 4x2 – x = 8 using the quadratic formula.

Answers

Answer:

[tex]1x=\frac{1\sqrt{129} }{8}[/tex]

Step-by-step explanation:

In between the 1 and the [tex]\sqrt{129}[/tex] goes this symbol: ±

hope this helps!

If f(x) = 2x2 + 2 and g(x) = x2 – 1, find (f – 9)(X).

Answers

Answer:

x^2 +3

Step-by-step explanation:

f(x) = 2x^2 + 2

g(x) = x2 – 1,

find (f – g)(X).

f(x) - g(x) = 2x^2 + 2 -( x^2 – 1)

Distribute the minus sign

             = 2x^2 +2 -x^2 +1

             = x^2 +3

x2+6 would be the answer

I NEED HELP!
Rectangle ABCD is drawn with diagonal AC, which has a measure of 20cm. Angle BACmeasures 30°. What is the
perimeter and area of the rectangle?

Answers

Answer:

Perimeter = 54.6 cm

Area = 173 cm²

Step-by-step explanation:

sin 30 = x/20

x = 10

cos 30 = y /20

y = 17.3

perimeter = 10 + 17.3 + 10 + 17.3 = 54.6 cm

area = 10 * 17.3 = 173 cm²

Proving the sum of the Interior Angle Measures of a Triangle is 180

Answers

Answer:

theres the screenshot of it

The solution to prove the sum of the interior angles of a triangle is 180° is

∠1 + ∠2 + ∠3 = 180°  ( angles in a straight line )

∠2 + ∠5 + ∠6 = 180°  ( interior angles of a triangle )

What is a Triangle?

A triangle is a plane figure or polygon with three sides and three angles.

A Triangle has three vertices and the sum of the interior angles add up to 180°

Let the Triangle be ΔABC , such that

∠A + ∠B + ∠C = 180°

The area of the triangle = ( 1/2 ) x Length x Base

For a right angle triangle

From the Pythagoras Theorem , The hypotenuse² = base² + height²

Given data ,

Let the triangle be represented as ABC

Now , the angles inside the triangle are ∠2 , ∠5 and ∠6

Now , the lines l₁ and l₂ are two parallel lines

From the figure ,

The measure of ∠1 = The measure of ∠5 ( alternate interior angles )

The measure of ∠3 = The measure of ∠6 ( alternate interior angles )

Now , for a straight line , the measure of angle = 180°

So , ∠1 + ∠2 + ∠3 = 180°  ( angles in a straight line ) ( angle addition )

And , the sum interior angles of a triangle is 180°

So , ∠2 + ∠5 + ∠6 = 180°  ( interior angles of a triangle ) ( substitution )

Hence , the sum of the angles inside a triangle is 180°

To learn more about triangles click :

https://brainly.com/question/16739377

#SPJ2

What is viscosity?
O A measure of the oil's quality
O An oil's resistance to flow at different temperatures
A reference to synthetic oil; all oils with viscosity are synthetic
O A new motor oil ingredient
< BACK
NEXT
>

Answers

Answer:

viscosity is the state of being thick, sticky, and semifluid in consistency, due to internal friction.

"cooling the fluid raises its viscosity"

a quantity expressing the magnitude of internal friction, as measured by the force per unit area resisting a flow in which parallel layers unit distance apart have unit speed relative to one another.

plural noun: viscosities

"silicone oils can be obtained with different viscosities"

Step-by-step explanation:

The viscosity of a fluid is a measure of its resistance to deformation at a given rate. For liquids, it corresponds to the informal concept of "thickness": for example, syrup has a higher viscosity than water. hope this helps you :)

Answer:

O An oil's resistance to flow at different temperatures

Step-by-step explanation:

Internal friction of a moving fluid .

assume that the salaries of elementary school teachers in the united states are normally distributed with a mean of

Answers

Mean of wat? And we need to see a picture of the equation

A person has a bag containing dimes and nickels. There are a total of 106 coins in the bag, and the total value of coins is $7.90. How many dimes and nickels are in the bag?

Answers

Answer:

52 dimes and 54 nickels

Step-by-step explanation: 52 dimes is $5.20 and 54 nickels is $2.70

Total coins 106 total $7.90

can I get a step by step explanation Thnx

Answers

Answer:

( 2A - kn) /k = m

Step-by-step explanation:

A = k/2(m+n)

Multiply each side by 2/k

2/k *A =2/k * k/2(m+n)

2A /k = m+n

Subtract n from each side

2A /k - n = m+n -n

2A /k - n = m

Getting a common denominator

2A/k - kn/k = m

( 2A - kn) /k = m

Answer:

Step-by-step explanation:

[tex]A=\frac{k(m+n)}{2}\\2A=k(m+n)\\\frac{2A}{k} =m+n\\\frac{2A}{k}-n=m\\2A-kn=km\\\frac{(2A-kn)}{k}=m[/tex]

what percentage of 40 is 8?

(A) 5%
(B) 20%
(C) 32%
(D) 150%​

Answers

Answer:

20%

Step-by-step explanation:

When you divide 40 by 8, you get 0.2. To convert a decimal into a percent, you multiply by 100 to get 20.

Hence,

8 is 20% of 40.

Hope this helps!!! PLZ MARK BRAINLIEST!!!

Answer:

The answer is option B.

Step-by-step explanation:

Let the percentage be x

We have

[tex] \frac{x}{100} \times 40 = 8 \\ \\ \frac{4}{10} x = 8 \\ \\ 4x = 80 \\ \\ x = \frac{80}{4} \\ \\ x = 20[/tex]

Hope this helps you

kamau is now 2 years older than Jane if James age is y now what will be the total age in 10 years​

Answers

Answer:

(2y + 22) years

Step-by-step explanation:

kamau is now 2 years older than Jane if Janes age is y now what will be the total age in 10 years​.

Answer: If Jane is y years old now and Kamau is 2 years older than Jane, therefore the age of Kamau now would be 2 + y years.

In ten years time Jane age would be y + 10 years while the age of Kamau would be y + 2 + 10 = y + 12 years.

To get their total age we just have to add their individual age. Therefore the total age in 10 years​  = Age of Kamau in ten years + age of Jane in ten years = (y + 12) + (y + 10) = y + 12 + y + 10 = y + y + 12 + 10 = 2y + 22 years

Which graphs represent functions?

Answers

i would say the answer is c. only graph d ,, think of the line test to see if a graph is a function or not

Grace Kelley earns $2,000 per week. She is married and claims 2 exemptions. What is Grace’s income tax?

Answers

Answer:

$153

Step-by-step explanation:

Since she claimed two exemptions, Grace Kelly income's tax will only be $153, and $1847 being the yearly take home.

Effective tax rate is set at 7.65%

Write an equation of the line that passes through the point (–1, 4) with slope 2. A. y+1=−2(x−4) B. y+1=2(x−4) C. y−4=2(x+1) D. y−4=−2(x+1) CHOSE ONE!

Answers

Answer:

[tex]y-4=2\,(x+1)[/tex]

which agrees with answer C in your list of possible answers.

Step-by-step explanation:

We can use the general point-slope form of a line of slope m and going through the point [tex](x_0, y_0)[/tex]:

[tex]y-y_0=m(x-x_0)[/tex]

which in our case, given the info on the slope (2) and the point (-1, 4) becomes:

[tex]y-y_0=m\,(x-x_0)\\y-4=2\,(x-(-1))\\y-4=2\,(x+1)[/tex]

The Customer Service Center in a large New York department store has determined that the amount of time spent with a customer about a complaint is normally distributed, with a mean of 8.9 minutes and a standard deviation of 2.5 minutes. What is the probability that for a randomly chosen customer with a complaint, the amount of time spent resolving the complaint will be as follows. (Round your answers to four decimal places.)

Answers

The complete question is;

The Customer Service Center in a large New York department store has determined that the amount of time spent with a customer about a complaint is normally distributed, with a mean of 8.9 minutes and a standard deviation of 2.5 minutes. What is the probability that for a randomly chosen customer with a complaint, the amount of time spent resolving the complaint will be as follows. (Round your answers to four decimal places.)

(a) less than 10 minutes

(b) longer than 5 minutes

(c) between 8 and 15 minutes

Answer:

A) P (x < 10) = 0.6700

B) P (x > 5 ) = 0.9406

C) P (8.0000 < x < 15.0000) = 0.6332

Step-by-step explanation:

A) we are given;

Mean;μ = 8.9 minutes

Standard deviation;σ = 2.5 minutes

Normal random variable;x = 10

So to find;P(x < 10) we will use the Z-score formula;

z = (x - μ)/σ

z = (10 - 8.9)/2.5 = 0.44

From z-distribution table and Z-score calculator as attached, we have;

P (x < 10) = P (z < 0.44) = 0.6700

B) similarly;

z = (x - μ)/σ =

z = (5 - 8.9)/2.5

z = -1.56

From z-distribution table and Z-score calculator as attached, we have;

P (x > 5 ) = P (z > -1.56) = 0.9406

C)between 8 and 15 minutes

For 8 minutes;

z = (8 - 8.9)/2.5 = -0.36

For 15 minutes;

z = (15 - 8.9)/2.5 = 2.44

From z-distribution table and Z-score calculator as attached, we have;

P (8.0000 < x < 15.0000) = P (-0.36 < z < 2.44) = 0.6332

The measure of minor arc JL is 60°. Circle M is shown. Line segments M J and M L are radii. Tangents J K and L K intersect at point K outside of the circle. Arc J L is 60 degrees. What is the measure of angle JKL? 110° 120° 130° 140°

Answers

Answer:

120

Step-by-step explanation:

Answer: 120

Hope that helped!(:

The oxygen consumption (in milliliter per pound per minute) for a person walking at x mph is approximated by the function f(x)=\frac{5}{3} x^{2}+\frac{5}{3} x+10 \quad(0 \leq x \leq 9)whereas the oxygen consumption for a runner at x mph is approximated by the function g(x)=11 x+10 \quad(4 \leq x \leq 9) b. At what speed is the oxygen consumption the same for a walker as it is for a runner? What is the level of oxygen consumption at that speed?

Answers

Answer: Speed = 5.6 mph

              Oxygen consumption = 71.6 mL/lb/min

Step-by-step explanation: For the oxygen consumption to be the same, functions must be equal:

f(x) = g(x)

[tex]\frac{5}{3}.x^{2} + \frac{5}{3}.x+10=11x+10[/tex]

Resolving:

[tex]\frac{5}{3}.x^{2} + \frac{5}{3}.x - 11x =0[/tex]

[tex]\frac{5}{3}x^{2} + \frac{5}{3}x - \frac{33x}{3}=0[/tex]

[tex]\frac{5}{3}x^{2} - \frac{28x}{3}=0[/tex]

[tex]\frac{x}{3}(5x - 28)=0[/tex]

[tex]\frac{x}{3} = 0[/tex]

x=0

5x - 28 = 0

[tex]x = \frac{28}{5}[/tex]

x = 5.6

The speed when the oxygen consuption is the same is 5.6 mph.

For the level of oxygen consumption:

f(5.6) = g(5.6)

g(5.6) = 11*5.6 + 10

g(5.6) = 71.6

The level of oxygen consumption is 71.6 mL/lb/min

At speed of 5.6 mph the oxygen consumption is same for a walker as it is for a runner.

The level of oxygen consumption is 71.6 milliliter per pound per minute

The oxygen consumption for a person walking at x mph is given by,

             [tex]f(x)=\frac{5}{3} x^{2} +\frac{5}{3}x+10[/tex]

The oxygen consumption for a runner at x mph is approximated given by the function,

             [tex]g(x)=11x+10[/tex]

To be oxygen consumption same for both walker and runner, both function must be equal.

             [tex]f(x)=g(x)\\\\\frac{5}{3} x^{2} +\frac{5}{3}x+10=11x+10\\\\\frac{5}{3} x^{2} +\frac{5}{3}x-11x=0\\\\x(\frac{5}{3} x-\frac{28}{3} )=0\\\\x=0,x=28/5=5.6mph[/tex]

At speed of 5.6 mph the oxygen consumption is same for a walker as it is for a runner.

The level of oxygen consumption at that speed is,

             [tex]g(5.6)=11(5.6)+10=71.6[/tex]

Learn more:

https://brainly.com/question/6237128

Help someone!! Thank you

Answers

I suppose this is saying that 20%, 25% and 55% are each a whole number of science students.  The GCD is 5%, 1/20th, so minimum 20 people total.  55% are studying biology, that's 11.

Answer: C. 11

A loudspeaker converts electrical energy into the kinetic energy of the speaker. This kinetic energy is transferred to air, and the motion of the air is the sound that people hear. An illustration of speaker with a wide arrow away from it labeled electrical energy 100 J and it splits into 3 arrows labeled sound energy 80 J, thermal energy ? J, and friction 5 J. How much thermal energy is put out by the speaker? 5 J 15 J 80 J 100 J

Answers

Answer:

15 J

Step-by-step explanation:

There is a total of 100 J of energy being used which is then converted into sound energy, thermal energy, and friction. This means the total amount must equal 100 J.

1. Set up the equation

80 + x + 5 = 100

2. Simplify

x + 85 = 100

3. Solve for x by subtracting 85 from both sides

x = 15

Answer:

The correct answer is 15J which is B.

How many real roots and how many complex roots exist for the polynomial
F(x) - X4+ x2 - 5x2 + x -- 6?
O A. 2 real roots and 2 complex roots
B. O real roots and 4 complex roots
O c. 3 real roots and 1 complex root
D. 4 real roots and 0 complex roots

Answers

Answer:

D. 4 real roots and 0 complex roots

Step-by-step explanation:

If I assume that the function you are saying is

[tex]F(x)=x^4+x^3-5x^2+x-6[/tex]

There should be up to "4 roots," there can't be more or less than 4 total solutions. First, we need to check how many sign changes are there in this function. There are 3 positive real roots. Now lets check for negative roots.

[tex]F(-x)=x^4-x^3-5x^2-x-6[/tex]

There are is only 1 negative real root. Since we basically have 4 real roots, and the max is 4. There should be 4 real roots and 0 complex roots.

Jessica’s plane and Kayla’s plane take off at the same time. Lauren’s plane leaves 1 hour earlier than Maria’s plane. Maria’s plane leaves at least 2 hours after Kayla’s plane. Each person flight last 8 hours. Maria’s flight lands at 4:45pm. What is the true statement?

Answers

Answer:

Step-by-step explanation:

From the given question, it can be concluded that Jessica and Kayla's planes took off an hour earlier than that of Lauren and at least two hours earlier than that of Maria. This implies that Maria's plane took off last among them.

Since each person's flight last 8 hours and Maria's plane lands at 4:45 pm, then Jessica and Kayla's planes land simultaneously at least at 2:45 pm. And that of Lauren lands exactly at 3:45 pm.

Other Questions
please Evaluate ( 8/3) to the 2 power A). 8/9 B). 64/9 C). 64/3 D). 55 Line CD passes through points (0, 2) and (4, 6). Which equation represents line CD? Which of the following was true when Truman met Stalin in Potsdam in 1945? A.Their two nations were already enemies The war in the Pacific was still being fought. Britain had decided not to join them. World War II had ended. Please Help asap!!! Please give explanation If the price of biscuit per packet increased from N250 to N500 and the quantity bought per week decreased from 300 to 200 packets, determine the elasticity of demand for biscuit. Please answer this correctly without making mistakes What is the slope of the line passing through the points (6,7) and (1,5) An education researcher claims that 58% of college students work year-round. In a random sample of 400 college students, 232 say they work year-round. At alphaequals0.01, is there enough evidence to reject the researcher's claim? Complete parts (a) through (e) below. It is a well-known fact that Dr. Barnes rides a skateboard, sometimes even on campus. Suppose that Dr. Barnes selects a skateboard by first picking one of two skateboard shops at random and selecting a skateboard from that shop at random. The first shop contains two "rad" skateboards and three "gnarly" skateboards, and the second shop contains four "rad" skateboards and one "gnarly" skateboard. What is the probability that Dr. Barnes picked a skateboard from the first shop if he has selected a "gnarly" skateboard? What the answer to the question If a circle has a diameter with endpoints of (-3, 0) and (5, 4) then the equation of the circle is? Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code. B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein. C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein. D) Both B and C are possible outcomes. g A spontaneous process is one in which: A. releases a large amount of heat B. may happen (is possible) C. will rapidly approach equilibrium D. will happen quickly Based on the function F(x) = x^4 - 3x^3+ x^2 +2 and the graph of G(X) below,which of the following statements is true? The goal of a statement of purpose is: 62(1+2) isn't that should be 1 , cause in the calculator it said 9 but the order is the parenthisis/brakets first ?? so it should be like 2 times 3 then 66 which gives 1 . Which of the following pitches is a non-chord tone for the I chord in G major? - G - B - A - D When a negative amount is in the base period and a positive amount is in the analysis period (or vice versa), a meaningful percent change cannot be calculated.A. TrueB. False A cookie recipe requires 3 teaspoons of baking soda for 36 cookies. If the baker would like to make 480 cookies, how much baking soda will be required? a13.33 teaspoons b12 teaspoons c40 teaspoons d108 teaspoons The flesh of infants may be used asgloves and summer boots Swift objects to eating girls as old as 14because they would serve better asbreeders, and because people wouldobject that it is "a little bordering oncruelty"Although there are many suffering"aged, diseased," or injured people,nothing needs to be gone for thembecause they are already dying "as fastas can be reasonably expected"Poor Irish tenants, who have already soldtheir crops and cattle to pay the rent,will now be able to pay by selling theirchildren