Please answer this question

Please Answer This Question

Answers

Answer 1

Answer:

10

Explanation:

can you help me Complete the following sentence: After we explained why we needed her in the play, she and joined our rehearsal A quaffed B. acquiesced C vengeance D. wreaked


Related Questions

HELP PLEASE Trying to learn how to do this
I can't figure it out for my students anyone knows
(LOL)
sorry if it is blurry

Answers

Answer:

Im sorry I cant help you but i just have to say something...

Explanation:

All though I cant see all of your face I can tell your very pretty and I wish you best of luck for your students. Have a good day/night!

A cylindrical tube of length 27.75 cm and radius 2.00 cm is filled with argon gas. The empty tube weighs 188.25 g. The tube filled with argon weighs 188.87 g. Calculate the density. formula =

Answers

Answer:

Explanation:

that should help

Density is mass per unit of volume. The density of argon is 1.778 × 10⁻³ gm/cm³.

How are the density, volume, and mass of a substance related?

Suppose that a finite amount of substance is there having its properties as:

mass of substance = m kgdensity of substance = d kg/m³the volume of that substance = v m³

Then, they are related as:

d = m/v

The volume of the tube = π × r² × h

                                = π × (2cm)² × 27.75 cm

                                = 348.716 cm³

Mass of Argon = Mass when tube is filled - Mass when tube is empty

                        = 188.87 g - 188.25 g

                        = 0.62 g

Now, the density of the gas can be written as,

Density = Mass / Volume

            = 0.62g / 348.716 cm³

            = 1.778 × 10⁻³ gm/cm³

Hence, the density of argon is 1.778 × 10⁻³ gm/cm³.

Learn more about mass, volume, and density relations here:

https://brainly.com/question/952755

#SPJ2

Is it First or Second law Newtons law? Fill in the blanks
A soccer ball accelerates faster than a bowling ball when the same amount of force is applied. _____________

A hockey puck keeps gliding across the ice ____________

A picture hanging on the wall does not move. _____________

Pushing a car versus a bike. _______________

A driver not wearing a seatbelt abruptly stops and he gets thrown forward in the car _________________

Answers

Answer:

1. Second Law

2. First Law

3. First Law

4. Second Law

3. First law

1. first
2. second
3. second
4. first
5. second

PLEASE HELP IM ACTUALLY SHAKING IM REALLY LATE
Tim and Christie poured coffee from the same pot into two cups. Christie poured milk into her cup then she added 5 teaspoons of sugar and stirred it for five seconds. Tim on the other hand put 5 teaspoons of sugar into his cup and stirred it for five seconds, and then he added milk. Christie noticed that her sugar did not dissolve completely.

What is the Independent Variable in this experiment?

What is the Dependent Variable in this experiment?

What are some of the Constants in this experiment?

Answers

The independent variable - the order of when they pour the milk (Christie poured milk first then sugar and Tim did the opposite)

The dependent variable - whether the sugar dissolves or not

The constants - 5 teaspoons of sugar, 5 second stir, same coffee

repeat after me

MEGALOVANIA

Answers

Answer:

MEGALOVANIA

MEGALOVANIA

Explanation:

hehe :))

Answer:

MEGALOVANIA :)

Explanation:

.................

Compare the sound of thunder to the sound of a fire alarm at school. How are the wavelengths, frequencies, and amplitudes similar or different?

Answers

Answer:

The fire alarm is a higher pitch than thunder.

Explanation:

The fire alarm is a higher pitch so the wavelengths are going to be closer and the amplitude is going to be taller, and the thunder is a lower pitch, so the wavelengths are going to be farther and the amplitude is going to be smaller.

The wavelengths, frequencies, and amplitudes are different for the sound of thunder as compared to the sound of a fire alarm.

Characteristics of sound:

The sound of thunder is low pitched sound, whereas the sound of a fire alarm is a high-pitched sound.

The pitch of a sound depends on the frequency of the sound, a higher frequency has a higher pitch. Whereas loudness depends on the amplitude of the sound.

For a low-pitched sound, the slope of the wave on the amplitude and time plot is flatter which means that the wavelength of the sound is larger and the frequency is smaller.

For a high-pitched sound, the slope of the wave on the amplitude and time plot is sharper which means that the wavelength of the sound is smaller and the frequency is larger.

Learn more about pitch:

https://brainly.com/question/27128408?referrer=searchResults

Volcanos are a geologic phenomenon that occurs at tectonic plate boundaries.Which provides the best evidence for the theory that faults and volcanoes are results of tectonic plate interactions?
a. Faults on tectonic plates are in constant motion, but volcanoes may not erupt for many
years
b. Tectonic plates that have many faults do not usually have volcanoes.
a. Faults and volcanoes existed long before there were tectonic plates.
b. Faults and volcanoes are often found at tectonic plate boundaries.

Answers

The answer is faults and volcanoes are often found at plate boundaries

pls help :)
Word Bank: brain, instincts, interpreted, organs, reflexes, spinal cord, senses


The central nervous system includes the _______ and _______.




Signals from _______ and the body's _______ are received by the brain and the spinal cord.




Once signals are processed and _______ by the central nervous system, a response is sent back to the body.




A central nervous system is also responsible for programming _______ and _______.

Answers

Answer:

Explanation:

1. brain, senses

2. instincts, senses

3. interpreted

4. reflexes, organs

The central nervous system includes the brain and spinal cord.

Signals from senses and the body's organs are received by the brain and the spinal cord.

Once signals are processed and interpreted by the central nervous system, a response is sent back to the body.

A central nervous system is also responsible for programming reflexes and instincts.

(I think that's good)

plzzz someone help me!!!!.
The picture below shows an experiment to find out the highest frequencies which students can hear. When the teacher turns the dial the frequency from the loudspeaker increases. the students put their hands down when they can no longer hear the sound.


Some students put their hands up while others have put their hands down. What conclusion can you draw from this observation?


The teacher suspects that some of the students are not giving honest responses, they are keeping their hands up even when they can no longer hear the sound. How could he check if he is right? *

Answers

Answer: Different hearing abilities.

Explanation:

From the observation, it can be concluded that different students have different hearing abilities. Some students put their hands up later, indicating that they can hear higher frequencies, while others put their hands down earlier, indicating that they can only hear lower frequencies.

To check if the teacher's suspicion about some students not giving honest responses is correct, he could randomly select some students and ask them to identify a few frequencies. He could also use different methods to test their hearing abilities, such as using headphones or playing the sound at different volumes to see if they can still hear it. Additionally, the teacher could repeat the experiment on different days to check if the same students are consistently putting their hands up even when they cannot hear the sound.

Why can even a small injury to the cornea have a effect on vision

Answers

Answer:

It also plays a key role in vision. As light enters your eye, it gets refracted, or bent, by the cornea's curved edge. This helps determine how well your eye can focus on objects close-up and far away. If your cornea is damaged by disease, infection, or an injury, the resulting scars can affect your vision.

2+2 can someone plz tell me the pros and cons of ending life right here and now?
Brainliest if ur on my friends list!

Answers

2+2=4, thx for the pts

Answer:

4

Explanation:

Well the cons are if you end your life rn then like you are kinda afk from life.. I dunno I'm a gamer so like if you die then there is no coming back u know.... ooooooooooooff I dunno what to say

And the pros are just don't do it, actual help is hard to find but like if you were to try and start over you could possibly also don't do that to who ever has to clean up the bloody mess. Coroners don't like getting hung bodies down and janitors don't like cleaning up blood. :) Find someone who loves you more than you do for yourself that will help a lot. Find a thing you like doing it helps too. Disappear for a day or two.

Please answer this!!! My science homework is going to be due in a few minutes!
I really need help!!!
If we looked at weather balloon data taken at 12:00 noon instead of 12:00 midnight, what do you think we would see in that data?

And

If we gathered temperature data by moving closer to the ground, what do you think we would see in that data?

Answers

Answer:

the data could be wrong

Explanation:

what features of stars are plotted on the Hertzsprung-Russell diagram? density and mass B. physical structure and composition apparent magnitude and luminosity brightness and surface temperature

Answers

Answer:

its luminosity (brightness) and temperature

Explanation:

it’s lumosity the answer

When training to increase physical fitness, adaptation occurs....

A. gradually and progressively
B. short and fast
C. long and short
D.quick and easy

Answers

i believe A.. training never gives instant results and is never a quick or short process !
Probably A it's not going to be easy or quick nor is it going to be short

How do ocean currents affect tempature?

Answers

Answer:

Ocean currents act as conveyer belts of warm and cold water, sending heat toward the polar regions and helping tropical areas cool off, thus influencing both weather and climate. The ocean doesn't just store solar radiation; it also helps to distribute heat around the globe

Explanation:

The first one

What is chronology?
A. Events before 1066
B. The correct order of events overtime
C. A collection of historical writings
D. None of the above

Answers

Answer:

The correct order of events over time

Answer:Its B

Explanation:Can I please have brainliest

Were the continents once joined together as a supercontinent? Give 3 pieces of evidence to support Alfred Wegeners Theory of Continental Drift.

Answers

Yes! Fossils, The outlines of the continents and geological features .

If you use the same force to push a motorcycle as you would to push a bike, which one will have more acceleration and why? Explain using Newton’s Second Law

Answers

Answer:

the bike would because it has  less mass.

Explanation:

im learning newtons laws in class right now so that should be right

The motorcycle right? Because it is experiencing more acceleration by going way faster rather than going too slow?

What causes a seismic wave?
sudden breaking of rock as it releases potential energy

very loud sound waves from the atmosphere entering the ground

growing pressure on rocks from the weight of material above them

energy transferred into Earth from the Sun as electromagnetic waves

Answers

The answer is B-very loud sound waves from the atmosphere entering the ground.
Very loud sound waves from the atmosphere entering the ground

help me ASAP! don’t give me the sample response!

Answers

Answer:

do it your self

Explanation:

tehehehe

why might this cloud formation be termed the “Pillars of Creation"?
A. Stars are being born here.
B. Black holes are forming here.
C. Supernovas are exploding here.
D. White dwarfs are cooling and growing dimmer here.

Answers

Answer:

I think the answer might be A

Explanation:

because if its called Pillars creation then something important might be being born maybe

A




Agree on that person

Why are concave lenses, rather than convex lenses, used to treat nearsightedness?

Answers

Concave Lenses Are for the Nearsighted, Convex for the Farsighted. Concave lenses are used in eyeglasses that correct nearsightedness. Because the distance between the eye's lens and retina in nearsighted people is longer than it should be, such people are unable to make out distant objects clearly.

PLEASEEEEEE HELLPPPP

Answers

Answer: one of them is more lighter to move  and the other one is more heavy to move. hope this helps

pleease help im crying im failing

Answers

The North Pole is tilted 23. degrees toward the sun

Answer:

The north pole is tilted 23 degree

What do you think is the primary cause of all-weather patterns, sun, humidity, or air pressure? Support your answer.

Answers

Answer:

Temperature is simply a measure of energy present. The heating and cooling of the atmosphere cause currents as cold air moves towards warmer air.

Explanation:

The most basic thing to understand is that warm air wants to rise while cold air wants to sink. Hot air contains fewer molecules per cubic meter while cold air contains more, hence the warm air will rise up over colder air. The most common example of this is the existence of a hot or cold front. These fronts are simply boundaries between hot and cold air.

when forklift moves a crate, it performs _______.

Answers

Motion of the forklift

Answer:

GPE

Explanation:

What is an electron shell? How many electrons fit in the first, second, fourth
And subsequent shell?

Its due tonight so take your time I guess.

Answers

Answer:

An electron shell is the outside part of an atom around the atomic nucleus. It is a group of atomic orbitals with the same value of the principal quantum number n. Electron shells have one or more electron subshells, or sublevels.

Explanation:

The first shell can hold up to two electrons, the second shell can hold up to eight (2 + 6), The 4th shell can hold up to 32 electrons.

I don't know the last one though

An electron shell is what surrounds the nucleus of the atoms. The nucleus contains protons and neutrons and is the heaviest part of the atom. Electrons closer to the nucleus will have not have as much energy as the electrons in the outer shells. The first shell can only have two electrons. The second can have 8, of the eight that is broken into sub shells there can be 2 s electrons and six p electrons. The fourth shell or what is also called the valance shell has four subgroups that are s,p,d, and f and all together can have a maximum of 32 electrons. A subsequent shell or sub shell is each electron shell broken into groups. These groups make it so when writing out how many electrons are in atoms you can distinguish how many there are. Along with this, there is a process on how to write these out. The order would be 1s,2s,2p,3s,3p, 4d, 3d, 4p, and so on.
Other Questions
Do violence and alcohol have anything to do with each other? If so, what do they have in common? If they don't have anything in common, tell me why? (SAT Prep) Find the value of x. He math team does practice drills that each last hour. In February the team did practice drills for a total of 24 hours. How many practice drills did the math team do in feburary PLEASE ANSWER FAST!!!!Explain why the U.S. decided to change its goal from protecting western settlements to attacking Native Americans and forcing them onto reservations. i just asked my best friend if she talk ab me behind my back bc i kinda have trust issues and i dont get what she means by this.... do yall have any idea? Write and solve an equation to determine the value of x in the figure. a. 3x 84; 252 b. 3x 84; 28 c. 3x 84; 84 d. 3x 84; 81 Find the value of x. Plsssssss Help!!!!Look at the map. How might the Gupta empire have been able to flourish through trade? Identify geographic features to support your answer. transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC Hey can somebody get this for me been stuck for five min Select the correct answer from the drop-down menu.What is implied by the underlined section in the passage?Caesar's statement to Brutus implies that imagine being in spanish course on edmentum its pretty hard not gonna kap features of liberalism theory A square has side lengths as shown in the picture and a perimeter of 54.8 centimeters. Write an equation to find the measure of each side length. On January 1, Year 1, a contractor began work on a $3.2 million construction contract that is expected to be completed in 3 years. The contractor concludes that it is appropriate to recognize revenue over time using the input method based on costs incurred (cost-to-cost method). At the inception date, the estimated cost of construction was $2.4 million. The following data relate to the actual and expected construction costs: Year 1 Year 2 Year 3 Costs incurred $720,000 $1,170,000 $1,110,000 Expected future costs $1,680,000 $810,000 $0 For this long-term construction contract, the contractor needs to calculate the estimated dollar values of the revenue and gross profit (loss) to be recognized each year. Complete the contractor's long-term construction contract using the information above. Write the appropriate amounts in the associated cells. Indicate losses by using a leading minus (-) sign. Round all amounts to the nearest dollar. If no entry is necessary, enter a zero (0). Revenue Gross profit (loss) Year 1Year 2 Need help with english class Your teacher has given you two mineral samples. He has told you thatthey have the same crystal structure and hardness.Which other observation would suggest that they are MOST LIKELY thesame mineral?They have the same color.They have the same shape.They have the same size.They have the same mass. 6. To what modern day American event might the medieval tournaments be compared? Une correctamente la pregunta con la respuesta.1. Con quin hablabas? 2. Qu haca tu hermano? 3. Que hacan tus padres? 4. Con quin hablabais? Hablaba con mi hermano. Hablbamos con el estudiante nuevo.Jugaba el ftbol.Caminaban por la playa. A factory uses a special kind of lubricant to maintain its two milling machines. Weekly lubricant usage for each machine is an independent random variable (zero correlation). The first machine has a mean usage of 50.6 gallons and standard deviation of 12 gallons. The second machine has a mean usage of 64.4 gallons and standard deviation of 16 gallons.Suppose that at the beginning of the week, the factory has a total of 135 gallons of lubricant in stock. The factory will not receive any replenishment of lubricant from its supplier until the end of the week. Assume that the total lubricant usage (of the two machines combined) follows a normal distribution. What is the probability that the factory will run out of lubricant before the next replenishment arrives?