Ms. Fisher is a 68-year-old woman with the classic symptoms of gallbladder disease. She is diagnosed with gallstones and is scheduled for surgery in 2 weeks . She asks you about the cause of gallstones and why she would develop them. How would you respond to her?

Answers

Answer 1

Answer: I will respond as this;

Gall stones develop from the chemical makeup imbalance of the bile inside the gall bladder which can increase in the levels of cholesterol, and cholesterol levels is increase, the excess form into stones.

Mrs Fisher can develop gall stones because she is 40 years and above and she is a female. Age and sex are the risk factors of gall stones

Explanation:

Gallstones are solid particles that are developed from bike cholesterol or bilrubin build up.

It Is caused by can increase in the levels of cholesterol, and cholesterol levels is increase, the excess form into stones.

Symptoms include .

The most common symptom is pain in the right upper part of the abdomen.

nausea and vomiting,

fever,

indigestion, belching, bloating,

intolerance for fatty or greasy foods, and

jaundice (yellowing

Mrs Fisher can develop gall stones because she is 40 years and above and she is a female. Age and sex are the risk factors of gall stones.

Women that had have children also are at risk of having gall stones.

The most effective treatment is surgical removal of the gallbladder, or cholecystectomy


Related Questions

Polaris is ______. (choose the three correct answers). called the north star. no choices fit this sentence always directly over the north pole. a star that is often the brightest start in Ursa Minor.

Answers

Answer:

called the north star, always directly over the north pole and a star that is often the brightest start in Ursa minor..

Explanation:

Polaris commonly the North Star or Pole Star and is the brightest star in the constellation of Ursa Minor. It is very close to the north celestial pole, making it the current northern pole star.

hope this answer correct (^^) ....

In the process of urine formation:_____.
a. first filtrate is formed, then tubular fluid, then urine.
b. tubular fluid is formed, then filtrate, then urine.

Answers

Answer:

b i think is your answer

Explanation:

Describe the events by which depolarization of a smooth muscle cell results in contraction and explain why smooth muscle contractions are slow and sustained.

Answers

Answer:

The depolarization of the smooth muscle cell membranes triggers the potential for contraction action, since the endoplasmic reticulum releases calcium in the intraplasmic zone, causing myosin and actin to unite, generating a sweeping movement and bringing the z lines of the sarcomero.

Smooth muscle contractions are more sustained over time by the distribution and type of muscle fiber, as they are more tapered.

Explanation:

The smooth muscle is that muscle that controls non-voluntary contractions, that is, controlled by the somatic nervous system, and is not related to locomotion but rather to involuntary movements such as intestinal motility, vascular contraction, etc.

The sliding of myosin and actin filaments over one another causes smooth muscle contraction. The hydrolysis of ATP provides the energy for.

Smooth muscle cell:

Smooth muscle lacks the calcium-binding protein troponin, which is found in cardiac and skeletal muscle. Smooth muscle fibers, unlike skeletal muscle fibers, usually contract slowly and synchronously. The electrical connection of smooth muscle by gap junctions causes the smooth muscle fibers to synchronize.

When the communication from the motor neuron stops, the sarcolemma and T-tubules repolarize, and the voltage-gated calcium receptors in the sarcoplasmic reticulum shut. Ca++ ions are subsequently returned to the sarcoplasmic reticulum, causing tropomyosin to re-cover the actin strands' binding sites. When a muscle runs out of ATP and becomes exhausted, it might also stop contracting.

Find our more information about 'Smooth muscle cell'.

https://brainly.com/question/24029616?referrer=searchResults

what is a protron needed for

Answers

Answer:

Function in the atom

Explanation:

The protons inside an atom's nucleus help bind the nucleus together. They also attract the negatively charged electrons, and keep them in orbit around the nucleus. The number of protons in an atom's nucleus determines which chemical element it is.

describe how a cell acquires the O2 the cell needs for its metabolic processes and how a cell gets rid of the CO2 that is doesn't need and can actually be harmful to the cell?

Answers

Answer:

Cells absorb oxygen and release CO2 via the bloodstream. Please find below detailed explanation

Explanation:

Oxygen and carbondioxide (CO2) are the major gaseous substances involved in celluar respiration. Aerobic celluar respiration, which is the process by which cells obtain energy, requires oxygen to occur. The oxygen initially gets breathed in as a constituent of air, which later passes through air sacs and gets attached to hemoglobin in red blood cells. Hemoglobin transports oxygen throughout the cells of the body.

After the process of celluar respiration is done, carbondioxide (CO2) is released back into the bloodstream, which carries it to the lungs. The CO2 is released when we breathe out.

CH 7 What will be the effect if a
toxin make a pore ( o ) in the
inner membrane of the
mitochondria​

Answers

Answer:

Mitochondria is known as the powerhouse of the cell as it provides energy to the cell for performing different functions.

If a toxin causes pore in the inner membrane of the mitochondria and  increases the permeability of the mitochondrial membranes. The permeability of mitochondrial membranes leads to mitochondrial swelling and causes cell death through necrosis and apoptosis.

Where does the Krebs cycle take place?

Answers

Answer:

takes place in the matrix mitochondria in cells it is also known as the Krebs cycle or the TCA cycle this process is essential part aerobic respiration

Explanation:

Answer:

takes place in the matrix mitochondria in cells it is also known as the Krebs cycle or the TCA cycle this process is essential part aerobic respiration

Explanation:

What are the different alleles available for the cross shown in this Punnett square? a and a A and a A and A

Answers

Answer:

A and a

Explanation:

Answer:

b

Explanation:

Identify the parts of the sun labeled A,B,C,D, and E

Answers

Answer:

Part A: Core of the Sun

Part B: The radioactive zone

Part C: The convective zone

Part D: The photosphere

Part E: Corona      <---   :D

Explanation:

If I am wrong, I am sorry because I am only a middle schooler and I searched it up and only read some articles. I hope this helps!

During osmosis Group of answer choices pure solvent and a solution both diffuse at the same time through a membrane.

Answers

During osmosis A) pure solvent diffuses through a membrane but solutes do not. B) pure solutes diffuse through a membrane but solvent does not. C) pure solvent and a solution both diffuse at the same time through a membrane. D) gases diffuse through a membrane into a solution and build up pressure.

Answer:

Explanation:A.

The net movements of solvent from the region of higher water potential (solvent) to a region of lower water potential(solute) through  a semipermeable membrane is called osmosis. It is a peocess where the solute dissolved in the solvent and the resulting solution pass the selective permeable membrane,A selective permeable is  the type which allows water,gases, and  non polar molecules to pass through, but restrict polar and other large molecules  through its walls.

Generally during osmosis,the water molecules and solute molecules interacts.These interaction ,due to dipole dipole effects of the water molecules, reduced the pressure of water on the solute in solution .Consequently, the water molecule of the pure water (the  solvent )exerts more pressure on the weaker solution i,e higher water potential

Hence,this pressure forces water molecules across the semi permeable membrane,from higher water potential to lower water potential.It is the major biological process of plants and animals.

in which process is oxygen absorbed by an organism

Answers

Answer:

the process of breathing (inhalation)

Answer:

Respiration

Explanation:

Ap ex

The muscle that originates on the sacrum and transverse process of each vertebra and inserts on the spinous process of the third or fourth more superior vertebra is the ________ muscle.

Answers

Answer:

The muscle that originates on the sacrum and transverse process of each vertebra and inserts on the spinous process of the third or fourth more superior vertebra is the Longissimus muscle

Explanation:

The Longissimus is a group made of three muscles: longissimus capitis, longissimus cervicis and longissimus thoracis. It has the length of the vertebral column.

It is placed in the back, and as the statement says, it originates on the sacrum and transverse of each vertebra. Each of them originates at the transverse elements and insert in the costal ones.

the white wallaby in this image has a mutition thatgives it a white colorng. how could this coloring affect its survival in its environment

Answers

Answer:

When changes happen in an environment. Many things can and will happen. If there was a gene mutation for the color of beetles, then that would affect their survival because the old color could have helped them hide and be camouflage. (however you spell it) If that is changed it could make them more out in the open, so predators could get them easier. Which would result in less beetles and more predators. Some examples are like the white wallaby, because of its environment it changes color to blend in and survive.

Explanation:

Posted on Brainly before.

When environmental changes occur. Many things are possible and will occur. The survival of beetles would be impacted if there was a gene mutation that changed their color because their previous color may have helped them blend in.

What white wallaby has a mutation that gives it a coloring?

The population of white wallabies will become more vulnerable to predators as a result of a mutation that alters their color pattern, and as a result.

There will be a modest drop in the overall number of white wallabies in the environment. In other words, the mutation decreases their chances of surviving.

The young, known as joeys, are nurtured in a pouch by all wallabies, which are marsupials. Their tails, which are not prehensile or grasping like those of kangaroos, are long, strong, and useful for balance.

Long jumps can be made by wallabies using their robust hind legs. The feet of rock wallabies are uniquely adapted to help them grip the rocky environment in which they inhabit.

Therefore, As its name implies, Nail-tail Wallabies have a pointy growth at the end of their tails.

Learn more about wallaby here:

https://brainly.com/question/6779278

#SPJ2

You go to the circus and see the tiger show. When the trainer cracks his whip, the tiger jumps through the hoop. This is an example of

a. operant conditioning with a positive reenforcement

b. operant conditioning with negative reenforcement

c. operant conditioning with punishment

d. none of the above​

Answers

Answer:

C

Explanation:

the trainer has already threatened and hit the tiger before.

thus, when he cracks the whip, the tiger is afraid and will "volunteeringly" jump through the hoop.

the defination of operant conditioning with punishment is any change in a human or animal's surroundings which, occurring after a given behavior or response, reduces the likelihood of that behavior occurring again in the future.

Which of the following sources would be most likely to have reliable data

Answers

What are the options we are working with?

Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC
A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code.
B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein.
C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein.
D) Both B and C are possible outcomes.

Answers

Answer:

Option A

Explanation:

DNA sequence: GTCACCGGTCTATACATAAGC.

If the bases of codon 5 under a mutation of C to T, the outcome would be?

Bases of the sense codon 5 is TAC, since codons of the sense strand is the same as that of the mRNA except with the replacement of uracil in place of thymine. This codon TAC codes for tyrosine.

If a mutation occurs changing C to T, then the bases would be TAT coding also for tyrosine too due to the nature of redundancy of the genetic code. Thus, there would be no change to the protein sequence although a change would occur in the DNA sequence.

Redundancy of the genetic code indicate that more than one codon can code for an amino acid as there are 64 codons and 20 amino acids.

Which correctly describes malignant tumors?

Answers

Answer:

Malignant means that the tumor is made of cancer cells, and it can invade nearby tissues. Some cancer cells can move into the bloodstream or lymph nodes, where they can spread to other tissues within the body—this is called metastasis.

Malignant tumors is a cancer cells
Cancer cells are cells which when it divides it divides more than the needed cell as it causes didorder

Briefly explain what was done in the experiment where pigeons could choose which button to peck in the Skinner box. How does this relate to self-control?

Answers

In this experiment, Skinner placed a pigeon inside a box that contained a button that when pressed released water or food. This pigeon went through periods of deprivation of water and food, but over time, he realized that when he pecked the button he had access to these two elements. Skinner called this behavior operant behavior, which is the behavior that occurs controlled by its consequences.

Although Skinner did not specifically study self-control, with this experiment, we can make a connection between operant behavior and self-control, since both are behaviors shown as a way to change the environment in which they are inserted, but this change also affects them.

explain why a father with blood group AB cannot donate for a child with blood group O when he marries a woman with blood group O​

Answers

The odds are astronomical for a father with AB(IV) to have an O(I) child. The only possible way for this phenomenon to occur is if there was a nondisjunction in the ovogenesis for the 9th chromosome and the father also had a nondisjunction for the same chromosome(A sperm cell with no 9th chromosome fertilized an ovum with two 9 chromosomes).

A person with AB cannot donate to a person with O because the receiver has antibodies(alpha and beta) that bind to the antigens on the AB blood cells, causing death.

Which type of organism developed first?

Answers

al

answer: algae

explanation: because the were the first ones to adapt with water and land...

how many lactobacillyus present in 1 lire of curd packet

Answers

A genus of gram-positive, microaerophilic, rod-shaped bacteria occurring widely in nature. Its species are also part of the many normal flora of the mouth, intestinal tract, and vagina of many mammals, including humans. Pathogenicity from this genus is rare.

hope it helps

Shelly, an eight-year-old child from a low-income family, is displaying symptoms such as growth failure, diarrhea, and pneumonia. Which of the following is Shelly most likely suffering from?
a. Iron deficiency
b. Folate deficiency
c. Iodine deficiency
d. Vitamin A deficiency
e. Zinc deficiency

Answers

Answer:

The correct answer is e.

Explanation:

Zinc is an essential intracellular trace element most abundant in the human body, which participates in important structural and catalytic regulatory functions, it is an integral part of many tissues, being essential for the synthesis of biomolecules such as DNA and proteins, as well as for degradation of the same. The deficiencies of any nutrient may be due to a decrease in its intake, an increase in the body's needs and therefore, its requirements, or a decrease in the bioavailability of the nutrient due to the way in which it is found in food. Zinc deficiency causes multisystemic, sometimes fatal, manifestations if not detected and corrected early. Symptoms of severe zinc deficiency are slowing or disruption of growth and development, delayed sexual maturation, characteristic skin rashes, chronic and severe diarrhea, impaired immune system, poor wound healing, loss of appetite, decreased sensitivity to the touch, night blindness, inflammation, opacity of the corneas and behavioral problems.

In 1998, paleoanthropologist Rick Potts published an article in The Yearbook of Physical Anthropology, a peer-reviewed journal. The article was titled “Environmental Hypotheses of Hominin Evolution.” In his paper, Potts claimed that great variations in environmental conditions over time were responsible for the adaptability of humans and the success of our species. Which would most likely be found in his paper?

Answers

This question is incomplete because the options are missing; here is the missing section:

Which would most likely be found in his paper?

A. A review of modern human anatomical structure.

B. Evidence of changing environmental conditions, with references.

C. The reasons competing hypotheses are wrong.

D. His opinion of what will happen to the survival of the human race.

The answer to this question is B. Evidence of changing environmental conditions, with references.

Explanation:

In texts such as scientific articles, the central point is expressed by the main claim or hypothesis as this is supported and explained through evidence in the articles. This means Potts article focuses on the environmental changes and how these contributed to the human species adaptability.

Due to this, it is expected the article explains the changes in environmental conditions, and the connection of these to adaptability. Moreover, because this is a scientific article all ideas should be supported with evidence collected by the author including references to other reliable sources. Thus, "evidence of changing environmental conditions, with references" is expected to be found in this article.

Answer: B

Explanation: I took the test :)

Assume that white color is dominant over yellow color in squash. If pollen from the anthers of a heterozygous white-fruited plant is placed on the pistil of a yellow-fruited plant, show using ratios the genotypes and phenotypes you would expect the seeds from this cross to produce. 1. Genotypes 1/2 Ww 1/2 Ww 1:1 ratio | Phenotypes All white 1:0 ratico
2. Genotypes 1/2 wW 1/2 ww 1:1 ratio | Phenotypes 1/2 white 1/2 yellow 1:1 ratio
3. Genotypes- 3/4 Ww 1/4 ww 1:1 ratio | Phenotypes 3/4 white 1/4 yellow- 1:1 ratio
4. Genotypes-1/2 ww 1/2 ww = 1:1 ratio l Phenotypes-1/2 white 1/2 yellow-1:1 ratio

Answers

Answer:

2. Genotypes 1/2 Ww 1/2 ww 1:1 ratio | Phenotypes 1/2 white 1/2 yellow 1:1 ratio

Explanation:

This question involves a single gene coding for fruit color in squash. The allele for white color (W) is dominant over the allele for yellow color (w).

If a heterozygous white-fruited plant (Ww) is crossed with a yellow-fruited plant (ww), the following gamete combinations will be produced by each parent:

Ww- W and w

ww- w and w

Using these gametes in a punnet square (see attached image), offsprings with genotypes: Ww and ww will be produced in the ratio 1:1

(1/2) Ww will be phenotypically white-fruited

(1/2) ww will be phenotypically yellow-fruited

Hence, the seed offsprings of this cross will possess:

Genotypes 1/2 Ww, 1/2 ww in 1:1 ratio

Phenotypes 1/2 white, 1/2 yellow in 1:1 ratio

HELP ASAP DUE NOW PLSSS HELP 10 points and brainlist Which arrows show matter moving from a producer to an omnivore? Select all that apply.

Answers

Answer:

my best guess is number answer 2 and answer 4

because crows love to eat desert woodrats and for the last one i watched it in national geo, its like a cycle grass hopper died by a mouse dies by a rattle snake.

Cilia in cells along the trachea ad nasal passage secrete blank which traps dirt and particles from the air

Answers

Answer:

Yes it secretes blank to trap and particles from the air

Which of the following answers correctly lists the four main types of macromolecules?

A.
DNA, RNA, triglycerides, water

B.
Monosaccharides, water, DNA, triglycerides

C.
Water, oxygen gas, ammonia, carbon

D.
Carbohydrates, lipids, proteins, nucleic acids

Answers

Answer:

D. carbohydrates, lipids, proteins, and nucleic acids

[tex]hope \: it \: helps[/tex]

Answer:

D

Explanation:

They are the main types of macromolecules

A Maximum-Minimum thermometer has two stems which record the highest and lowest temperatures during a period of time. A small metallic piece in each stem indicates the temperature. A. 55o C, 35o C, 45o C B. 45o C, 25o C, 35o C C. 55o C, 25o C, 35o C D. 45o C, 25o C, 30o C 4. M

Answers

Answer:

The correct option is A: 55° C, 35° C, 45° C

Explanation:

The Six's thermometer is a device to record maximum and minimum values of temperature within a given period of time. It is a glass tube in a U shaped manner that contains mercury, which is dependent on the expansion of alcohol in order to register a maximum reading. It is made use of for the purpose of meteorology, horticulture etc.

The metallic piece in each stem indicates the temperature of 45°C, 25°C, 35°C. That is option B.

A maximum-minimum thermometer is an instrument used to measure both the minimum and maximum temperature of a given area for a period of time.

The maximum-minimum thermometer is used in the following fields:

Horticulture: This is useful in the sustainable production of cultivated food and ornamental plants as temperature of the area in use needs to be monitored.

Meteorology: This is useful in this field to monitor the temperature of different locations.

The range for a maximum-minimum thermometer is -30°C to 50°C.

Therefore, the metallic piece in each stem will indicate the temperature of 45°C, 25°C, 35°C which is within the range.

Learn more about thermometers here:

https://brainly.com/question/25034625

A teenager throws a 7.26 kg rock into a lake, trying to make a big splash. If the rock is travelling at a speed of 7.5 m/s, how much kinetic energy does the rock have?

Answers

Explanation:

K.E = 1/2mv²

1/2 x 7.26 x 7.5²= 204.19j

Why do hurricanes lose strength once they reach the land?
O A. Hurricanes can't replenish their water from the ground.
B. Hurricanes gain strength from the warmth of the ocean water.
C. Hurricanes lose strength when they reach a warm front on land.
D. Friction with the ground stops hurricane spinning.

Answers

Answer: b

Explanation: cause hurricanes gain strength from water

Hurricanes lose strength once they reach the land because hurricanes gain strength from the warmth of the ocean water. The correct answer is option B.

A hurricane is a large, rotating storm that forms over tropical or subtropical waters. Hurricanes are characterized by strong winds, heavy rain, and storm surges, which can cause significant damage and loss of life.

Hurricanes gain strength from the warmth of the ocean water. This is why hurricanes tend to lose strength once they reach land. When a hurricane is over the ocean, it draws its energy from the warm water, which causes the air to rise and creates a low-pressure area. This low-pressure area then draws in more warm, moist air from the surrounding area, which fuels the hurricane and causes it to intensify.

Once a hurricane moves over land, it loses its source of warm water and can no longer draw in the moisture it needs to maintain its strength. This causes the hurricane to gradually weaken and dissipate.

Since, hurricanes gain strength from the warmth of the ocean water, it loses its source of warm water and eventually its strength. Option B is the correct answer.

Learn more about hurricanes here:

https://brainly.com/question/33034641

#SPJ6

Other Questions
Select all that apply. From this lesson, what are the positive effects of globalization? You can learn other languages faster. You can learn about foreign art and music. You can preserve your country's traditional ways of life. You can learn how students in other countries live. ASAP!! Please help me. I will not accept nonsense answers, but will mark as BRAINLIEST if you answer is correctly with solutions. The research of Dr. John Holland, creator of the Holland Code, shows that people tend to be satisfied in careers that are compatible with their personality type, and people are less satisfied when such a match isn't there.a) trueb) false La familia de GracielaLook at the family tree and write how each person is related to Graciela. Follow the model. Then use your imagination to describe them, using at least six of these words. Select the correct answer. Consider matrices A, B, and C: 3. An important condition of the armistice that ended World War I wasO the continuation of the treaty between Russia and Germany.O the immediate demobilization of Allied troops.the return of German land west of the Rhine River.the German surrender of its weapons and most of its navy. Question 41 pointsSave AnswerA solution is prepared at 25C that is initially 0.42 M in an "X" base, a weak base with Kb=7.4X10^-4, and 0.42 M in conjugate acid "HX". Calculate the pH of thesolution. Round your answer to 2 decimal places.(Hint: pkw=pka + pkb)A Moving to another question will save this response.< Question 4 of 12> Please explain why the United States lost the Vietnam War, thank you! :) It would be extremely helpful if you just gave me 3 reasons that I can elaborate on since I need this for an essay! thank you!! In which chapter would a reader find information on seeking support? Fear and Its Effects Free from Fear Just Say "No!" to Fear Seeking Support ASAP!! Please help me. I will not accept nonsense answers, but will mark as BRAINLIEST if you answer is correctly with solutions. Find the value of a A.130 B.86 C.58 D.65 Buyline is an e-commerce Web site. It has come up with a promotional offer where buyers get a 60 percent discount on refrigerators if a minimum of 100 buyers agree to buy the product within 24 hours of the offer being announced. In this case, it is evident that BuyLine is a _____. method for making decisions in steps 3) If a ball launched at an angle of 10.0 degrees above horizontal from an initial height of 1.50 meters has a final horizontal displacement of 3.00 meters, what is its launch velocity The reason Air-Omnibus was not celebrating despite selling more aircrafts than Crow-Wing in 2003 was because of the Multiple Choice increasing regulations. rising value of the euro. profits being static. lower value of the euro. rising value of the dollar. If the average American sleeps 8 hours a night, with a standard deviation of 1 hour, and I plan on gathering a sample of 12 college students to compare to this population, find the following: mu = sigma = mu_x bar = sigma_x bar = 4= t/2.5,what is t? Math question, need help Russell Retail Group begins the year with inventory of $45,000 and ends the year with inventory of $35,000. During the year, the company has four purchases for the following amounts.Purchase on February 17 $200,000Purchase on May 6 120,000Purchase on September 8 150,000Purchase on December 4 400,000Calculate cost of goods sold for the year. An adult has one serving (500 mL) of this drink. About what fraction of the recommended daily intake of sugar is this?