lists of a washing machine proccesing

Answers

Answer 1

Here are the basic steps involved in a typical washing machine process: Sorting, pre-treating, loading, adding detergent, selecting the cycle, setting the water temperature, Starting the wash cycle, sinsing, spin cycle, unloading and cleaning the machine.

More about the processes:

Sorting: Separate clothes by color, fabric type, and level of dirtiness.Pre-treating: Apply stain remover or other pre-treatment to heavily soiled or stained areas of the clothing.Loading: Place the clothes in the washing machine, making sure not to overload it.Adding detergent: Measure and add the appropriate amount of laundry detergent based on the size of the load and the level of soiling.Selecting the cycle: Choose the appropriate wash cycle based on the type of fabric and level of soiling.Setting the water temperature: Select the appropriate water temperature for the wash cycle and the type of fabric.Starting the wash cycle: Start the washing machine and allow it to complete the wash cycle.Rinsing: The washing machine will automatically rinse the clothes to remove any remaining detergent and dirt.Spin cycle: The washing machine will spin the clothes to remove excess water before moving on to the next step.Unloading: Remove the clothes from the washing machine and transfer them to the dryer or hang them to dry.Cleaning the machine: After completing the wash cycle, clean the washing machine with a mild detergent to prevent buildup of mold and mildew.

To know more about machines, visit:

https://brainly.com/question/2555822

#SPJ9


Related Questions

Please help!!!
Choose 4 of the rhetorical devices and write your own example of each.

Answers

We can choose four rhetorical devices and write an example for each by relying on our knowledge of their definitions, as seen below:

Metaphor example: Life is a journey.Hyperbole example: I've warned you a billion times!Irony example: You're a genius, aren't you?Imagery example: The soft, cotton-like touch of the cat's little paw...

What is a rhetorical device?

A rhetorical device is any technique employed by an author or a speaker with the purpose of persuading his or her audience. Rhetorical devices help make images more vivid and evoke emotions.

Now, let's define the devices we have mentioned above:

Metaphor is a device that compares two things that are not identical, and sometimes not even similar, but have something in common.Hyperbole is a figure of speech that uses exaggeration to emphasize a point or create an effect.Irony is a literary device that uses words to convey a meaning that is opposite to their literal or expected meaning.Imagery refers to the use of vivid and descriptive language to create mental images or sensory experiences in the reader's mind.

Learn more about rhetorical devices here:

https://brainly.com/question/518481

#SPJ1

What is the topic of the song "People Got to be Free" by the Rascals?

Answers

Explanation:

The topic of the song "People Got to be Free" by the Rascals is about the civil rights movement and the desire for equality and freedom for all people regardless of race.

Describe the physical setting of the boarded windows. Which words or descriptions contribute to the emotional setting or mood? What is the mood that results from the author’s use of description?

Answers

"only a few miles away from what is now the great city of Cincinnati, lay an immense and almost unbroken forest." is the main idea of boarded window.

What is the main idea of The Boarded Window?

In the short story "The Boarded Window," the theme of isolation and its psychological effects are explored. The plot centres on a man named Murlock who is abandoned after losing his wife and child in a rural area of Ohio. Murlock's psychological state of isolation and despondency is reflected in the boarded-up cabin's physical environment. To evoke tension and a sense of dread, the author uses vivid descriptions. In the end, the narrative implies that people's need for connection and company is crucial to their mental health and wellbeing and that, in the absence of it, they may succumb to darkness and despair.

To Know more about Boarded Window Visit:

brainly.com/question/20337537

#SPJ1

I WILL GIVE BRAINLIEST!!!!! Citing evidence from the text, describe how the author contrasts Blanca’s point of view from that of her brother

Answers

In "The House of the Spirits," the author contrasts Blanca's point of view from that of her brother Jaime by highlighting their differing attitudes towards politics and social issues. For example, Blanca becomes deeply involved in the socialist movement, whereas Jaime is more interested in pursuing a career in medicine. One example of the contrast between Blanca's point of view and her brother Jaime's can be found in Chapter 6, when Blanca tells her mother, "I can't stand the way the poor are treated," to which Jaime responds, "One has to be practical. There will always be poor people." This exchange illustrates Blanca's empathy for the struggles of the working class, while Jaime maintains a more detached and pragmatic perspective.

What other example shows the contrast between Bianca's point of view and that of her brothers in "The House of the Spirits," ?

In   "The House of the Spirits,"  Another example that describe how the author contrasts Blanca’s point of view from that of her brother can be found in Chapter 7, when Blanca becomes involved in the socialist movement and Jaime tells her, "I think it's all nonsense...Don't waste your time on politics." Again, this highlights Blanca's interest in social and political issues, while Jaime remains more focused on his personal ambitions.

Find more useful exercises on the book "The House of the Spirits,";

https://brainly.com/question/30637841

#SPJ1

Where does it state in the giver the laws?

Answers

In the book "The Giver" by Lois Lowry, the laws that govern the society are not listed or described in a single place. Instead, they are referenced throughout the book in various ways.

What is the law?

For example, early in the book, the narrator, Jonas, mentions that "precision of language" is one of the most important rules of the community, meaning that people must be very careful with their words and avoid using imprecise or unclear language. Later on, when Jonas is selected to become the Receiver of Memory, he learns about many other rules and customs that are part of the community's way of life, such as the strict control of emotions and the prohibition on choosing one's own job or spouse.

Overall, the laws and rules of the community are not presented in a straightforward manner in the book, but are instead woven into the fabric of the story and revealed gradually as the plot unfolds.

Learn more about laws at:

https://brainly.com/question/820417

#SPJ1

What do you think of Langston Hughes' response to the instructor's instructions to "Go home and write a page tonight" and their claim that "that page….will be true"? ls it easy to be "true" or "real" when expressing yourself? What struggles might you have? (ACE the
question)

Answers

Answer:

give me a second

Explanation:

this is a tricky one

Explain in your own words as to why creating a portfolio that includes evidence of your skills and abilities important?

Answers

Explanation:

Creating a portfolio that includes evidence of your skills and abilities is important because it allows you to showcase your accomplishments and talents to potential employers, clients, or collaborators. It can provide a tangible demonstration of your capabilities and can help you stand out among other candidates or competitors. A portfolio can also serve as a tool for self-reflection and personal growth, as it can help you identify your strengths and areas for improvement. Additionally, creating a portfolio can help you stay organized and focused on your goals, as you are able to track your progress and achievements over time. Overall, having a portfolio can be a valuable asset in building your professional reputation and advancing your career.

In “Hope Survives in Search for Katrina’s Missing”, what happened to Earnest Graps

Answers

His family is currently looking for him while he remains missing. Hope Survives in Search for Katrina’s Missing did the author consider.

What were the missing persons searches and Hope survives related to?

Hope Survives as Katrina's Lost Are Looked For On the Gulf Coast, families are still looking for loved ones a year later. After months of uncertainty, Dorothy Graps received good news when she was reunited with a son who was still alive.

What, in the opinion of a survivor of the disaster, was the one positive aspect of reporting on Hurricane Katrina?

It might take days or possibly weeks before the bodies of New Orleans' deadly victims were found. The reader response right away was the one encouraging thing about documenting this tragedy.

To know more about Survives in Search for Katrina’s visit :-

https://brainly.com/question/6752861

#SPJ1

Which strategy will best help Sadie understand her reading of August's character? O Sadie can make a mental picture of a boy shrugging. O Sadie can ask herself, "What will happen next?" OSadie can make a mental picture of a boy with a Scarred face and long hair. O Sadie can ask herself, "Where did l lost track?

Answers

Sadie can make a mental picture of a boy with a Scarred face and long hair. Thus, option C is correct.

What are Normal People by Sally Rooney?

Sally Rooney's novel Normal People seems to be about Marianne but instead Connell and their on-again, off-again acquaintance and romance. They are two youths who are attracted to one another and who occasionally drift apart while always coming back together over the course of their lifetimes.

Sadie would be a Trinity College pupil. She assists in managing the school's publishing house, supports Connell's composing, and has even persuaded him to allow her to print one of his works at one juncture.

Therefore, option C is correct.

Learn more about Normal People by Sally Rooney, here:

https://brainly.com/question/21139952

#SPJ9

Task 2: Recommendations to Enhance Operations
Reflect on the tour and interview. Then, create a list of recommendations to enhance the restaurant’s operations. Include the reasons for your recommendations. You should have three or more items on your list. The list should include at least one item related to nutrition, one related to safety, and one related to sanitation.

Answers

I have the following suggestions to improve the restaurant's operations based on my tour and interview:

Add more information about nutrition: The restaurant was willing to accommodate dietary restrictions, but they could do more to inform customers about the nutritional content of their menu items.Boost ventilation in the kitchen: During my visit, I noticed that the kitchen was hot, stuffy, and had a distinct cooking.Conduct regular inspections of food safety: A regular audit by a third-party organization would help to ensure that all guidelines and procedures are consistently followed, despite the restaurant's strong commitment to food safety and sanitation.What was the Suggestions to improve the Restaurant's operations?

In general, the restaurant would benefit from these suggestions in terms of operational improvement and customer satisfaction. Regular food safety audits would reassure customers and assist in preventing health risks, and improving nutrition information would assist customers in making informed choices. Additionally, improving ventilation would enhance the dining experience

To know more about Customer Satisfaction, https://brainly.com/question/15298944

#SPJ1

In paragraphs 3 and 4, how does Tannen explain women's tenden- cies to use "covert" communication strategies? Write down at least two reasons that the author provides .

Answers

Answer:

Tannen explains women's tendencies to use "covert" communication strategies in paragraphs 3 and 4 by providing two reasons:

One reason is that women often feel that they lack power in their interactions with men, so they try to use language to get what they want. Women may feel that they are not taken seriously or that their ideas are dismissed, so they use language to convey their intentions more subtly. Tannen argues that this is a way for women to exert some control in their interactions with men, even when they are not in positions of authority.Another reason that Tannen provides is that women often have different goals than men when it comes to communication. Tannen argues that men often view communication as a way to establish dominance or to achieve a specific goal, while women view communication as a way to build and maintain relationships. Women may use more indirect language or nonverbal cues in order to convey their emotions or to build connections with others. This difference in communication goals can lead to misunderstandings and frustration between men and women.

use: Supposing, I'd rather,It's time, i should have,if only:
1.___________you'd run out of money. Then what would you have done? 2.___________called first to check you would be in. 3.___________you didn't open the window. I'm feeling realy cold. 4.___________I'd given myself more time to prepare for the exam 5. ___________you did some housework. It's always me that does it​

Answers

Answer:

supposing,I should have, it's time,i'd rather,if only

Find the word „environment“ in paragraph 6 of „Gaming Communities“. Use context clues in the surrounding sentences, as well as the sentence in which the word appears, to determine the word’s meaning. Write your definition here and identify the clues that helped you figure out it’s meaning.

Answers

The game environment is a dimension that brings together the goals, subjects, and theoretical components of the game as a whole to create an interactive flow of action.

What is an environment?

All living and non-living objects that occur naturally, or in this example, without the use of artificial means, are included in the natural environment or natural world. The phrase is most frequently used with reference to Earth or certain regions of it.

On the other hand, a game engine or game environment is a specific development environment for making video games. The features one offers depend on the kind and level of control the underlying framework permits.

Therefore, a "environment" is generally used for making video games in "Gaming Communities".

To learn more on environment, click here:

https://brainly.com/question/30821114

#SPJ1

(The Outsiders) Ponyboy ends the novel with the same sentence that starts it. Why? Now that you have finished the entire book, what meaning do you see in this phrase? How has its significance changed from what it meant on page 1? Use specific evidence from the text to support your analysis.

Answers

Ponyboy is aware that he'll never be entirely smart or strong. He cannot give up his morals in order to grow into a seasoned crook or a less seasoned greaser to keep his innocence.

What three words best define a Ponyboy?

Like his brother Sodapop, he is characterized as brilliant, impetuous, and attractive. Ponyboy Curtis is a member of the greasers, a gang. They are depicted as being in stark contrast to the affluent Socs. During the difficulties he encounters in the book, he is described as sensitive, innocent, and resilient.

His nickname is Ponyboy; why?

There isn't an explanation for Ponyboy's parents' choice of name there In Outsiders book or movie. He claims that his father was "original" and that it appears on his birth certificate.

To know more about Ponyboy visit:

https://brainly.com/question/30611006

#SPJ1

Those under 18 (juveniles) should not receive life sentences.
Session 5 — How has your answer changed/strengthened in Just Mercy.

Answers

Explanation:

After reading Bryan Stevenson's book "Just Mercy," my answer regarding whether juveniles should receive life sentences has strengthened. Stevenson's work highlights the injustice and cruelty that often occurs within the criminal justice system, particularly when it comes to juvenile offenders.

One of the most striking examples in the book is the story of Trina Garnett, who was sentenced to life without parole at just 14 years old. Stevenson argues that this kind of sentencing is not only cruel but also unconstitutional, as it violates the Eighth Amendment's prohibition on cruel and unusual punishment.

Stevenson also highlights the impact that incarceration can have on juveniles, both in terms of their physical and emotional development. He argues that imprisoning juveniles for life essentially robs them of the opportunity to grow and change, denying them a chance at rehabilitation and redemption.

Furthermore, Stevenson shows that juveniles often end up in the criminal justice system as a result of circumstances beyond their control, such as poverty, abuse, and neglect. Punishing them with life sentences only serves to perpetuate the cycle of violence and poverty, rather than addressing the root causes of their criminal behavior.

Overall, after reading "Just Mercy," I am even more convinced that juveniles should not receive life sentences. Not only is it cruel and unconstitutional, but it also fails to address the underlying issues that contribute to juvenile delinquency. Instead, we should focus on restorative justice practices that prioritize rehabilitation and support for young people who have experienced trauma and adversity.

A____is a list of words or topics that relate to the narrowed topic or question and a_______is a graphic organizer that shows the relationships among ideas. Possibly answers 1.rough draft 2.cluster diagram 3.pre-write 4.formal outline 5. Jot list

Answers

A cluster diagram is a graphic organizer that displays the connections between concepts, and a jot list is a list of words or subjects that are related to the topic or query that has been narrowed.

What does a list of words or subjects that are connected to the focused issue or query look like?

With relation to your main diagram or study issue, keywords are certain words or phrases. They are employed in brainstorming to select search terms for discovering research or condensing a diagram .

is a visual organizer that demonstrates how ideas relate to one another?

The connections between the main idea and other information are displayed on a concept map. Concepts or ideas are diagram as circles or boxes, and arrows are used to connect them to related concepts.

To know more about diagram visit:-

https://brainly.com/question/30646789

#SPJ1

In the story nothing up my sleeve, the missing sleeve represents
A
B the narrator's need for warmth.
C
D
the narrator's lost love.
Annabeth's car.
a new, unique style.

Answers

The narrator's need for warmth. Therefore, option (B) is correct answer.

What does the  missing sleeve represents?

In the story "Nothing Up My Sleeve," the narrator, who is a magician, performs a trick where he removes his jacket and makes it disappear, leaving only one sleeve behind. The missing sleeve represents the narrator's need for warmth as he is homeless and living on the streets.

The narrator uses his skills as a magician to survive, but he is still vulnerable to the harsh realities of life on the streets, including the cold weather.

Learn more about nothing up my sleeve, here:

https://brainly.com/question/28265640

#SPJ1

 What was the rhetorical situation of Churchhill‘s speech?

Answers

Churchill's speech has two purposes: to convince the United States to join the war as Britain's ally and to uphold the idea that Britain must never submit to Germany or even engage in peace discussions.

What was the speech about?

Churchill's speeches were delivered during the critical period of World War II when Britain was facing the threat of invasion from Nazi Germany. Churchill became the Prime Minister of Britain in 1940, and his speeches were a crucial element of the country's war effort.

One of Churchill's most famous speeches was the "We Shall Fight on the Beaches" speech, which he delivered on June 4, 1940, following the evacuation of British troops from Dunkirk. The speech was delivered to the House of Commons and broadcast to the nation via radio.

The rhetorical situation of Churchill's speech was one of crisis, urgency, and the need for decisive action. Churchill was addressing the British people at a time when their country was under threat, and he needed to inspire and motivate them to continue the fight against Germany. The speech was also directed towards the international community, to show that Britain was determined to resist Nazi aggression and that they were not alone in their struggle.

Overall, Churchill's speeches were designed to rally the British people and to create a sense of national unity in the face of a grave and uncertain threat. He used his rhetorical skills to inspire and motivate his audience, and his speeches remain powerful examples of effective public speaking.

Learn more about Churchill on'

https://brainly.com/question/25495942

#SPJ1

How did the images make you feel and why?​

Answers

The image gives off a feeling of concern for the farmers because the pickers are only one color why is there no other colored people ?

Explain the rules for comparative and superlative

Answers

Comparative and superlative are forms of adjectives that are used to compare two or more things.

Comparative adjectives are used to compare two things, while superlative adjectives are used to compare three or more things. The rules for forming comparative adjectives usually involve adding "-er" to the end of the adjective or adding the word "more" before the adjective. For example, "taller" or "more intelligent." Superlative adjectives typically involve adding "-est" to the end of the adjective or adding the word "most" before the adjective. For example, "tallest" or "most intelligent." However, there are some irregular comparative and superlative forms, such as "good," which becomes "better" in comparative and "best" in superlative.

For such more question on Comparative

https://brainly.com/question/24796657

#SPJ4

What does the excerpt hint about Mr. Brocketung, character?

Answers

It is possible you may have misspelled the name. Mr. Brocklehurst is an important character in Charlotte Bronte's novel "Jane Eyre." He is the treasurer and manager of Lowood Institution, the school where Jane Eyre is sent to receive an education.

What his Mr. Brocklehurst's character?

Mr. Brocklehurst is portrayed as a cruel, hypocritical, and self-righteous man who exercises his power over the students in the school.

Mr. Brocklehurst is characterized as a strict Calvinist who believes in the doctrine of predestination. He imposes his strict religious beliefs on the students, requiring them to wear plain and uncomfortable clothes, eat meager meals, and live in harsh conditions. He also punishes the students harshly for minor offenses.

Overall, Mr. Brocklehurst's character serves as a representation of the oppressive and hypocritical nature of Victorian society, particularly its treatment of women and children.

To find out more about Jane Eyre, visit:

https://brainly.com/question/26106897

#SPJ9

SIMPLE PRESENT TENSE

Answers

Aman watches movies every day.

According to the article "Rebel with a Cause," what are the main reasons why
teenagers rebel?

Answers

The article claims that while the fundamental causes of teenage rebellion vary with age, they typically revolve around concerns with the child's identity and independence. Typically, it exhibits the trait of non-conformity rebellion, which means refusing to act as everyone else does, or non-compliance rebellion, which means disobeying orders.

Early adolescence (9–13) rebellion is about claiming the child's newly discovered "adultness" and letting go of the earlier child's identity.

In later years (13–15), rebellion typically involves standing out from the crowd and the youngster attempting to carve out a unique identity.

In later years (15–18), rebellion is typically a way for a young adult to fully cut ties with parents and establish himself or herself as an autonomous adult. For only children, who were slower to depart from their parents, it frequently

What were the circumstances at the time when the song If I had A hammer was released?

Answers

The song "If I Had a Hammer" was written during the era of the Civil Rights Movement in the United States.

At the time of the release, the USA was undergoing significant social and political change. The Civil Rights Movement was gaining popularity, with activists fighting for equal rights for African Americans and an end to racial segregation. The song's message of social unity and justice were felt in the hearts and resonated with many people who were fighting for these causes

is un friendly a common noun or proper

Answers

Answer: it is an adjective not a noun

Answer: Unfriendly is an adjective

Explanation:

As the sports perfect of your school, write a speech you will deliver to the newly admitted students on the benefits of participating in sporting activities

Answers

The process of composing a statement that will be read aloud to an audience is called speech writing.

Dear new students: Welcome! I want to emphasize the advantages of engaging in athletics as the sports prefect. Exercise improves self-esteem, reduces tension, and keeps you fit. Being a team player allows you to socialize and meet new people while also improving your leadership and communication skills.

Sports can be entertaining and produce priceless experiences. A fantastic method to remain active, challenge yourself, and pick up new skills is to join a squad. I urge you to think about joining an athletics squad to take advantage of these advantages and more.

Learn more about speech writing:

https://brainly.com/question/25273694

#SPJ4

Identify three social changes that are associated with the development towards adulthood​

Answers

The social changes associated with development towards adulthood include increased independence, greater responsibility, and changing relationships with family, friends, and romantic partners.

What are Social Changes?

Social changes refer to changes in the way people interact, behave, and organize themselves in society. These changes can occur at the individual, group, or societal level, and can be caused by a variety of factors, including technology, economics, politics, and culture.

Here are three social changes associated with the development towards adulthood:

Increased independence: As individuals move towards adulthood, they often gain greater independence from their parents and other caregivers. This can involve making decisions about education, career, relationships, and other aspects of life.Greater responsibility: Along with increased independence comes greater responsibility, both in terms of personal choices and societal expectations. Adults are typically expected to contribute to society, such as through work, paying taxes, and volunteering.Changing relationships: As individuals move towards adulthood, their relationships with family, friends, and romantic partners often change. They may form new relationships, develop deeper connections with existing ones, and in some cases, move away from relationships that are no longer healthy or fulfilling.

Learn more about social changes on:

https://brainly.com/question/13391889

#SPJ1

When they contact Mr. Pignati, Lorraine calls herself "Miss Truman" and
John calls himself "Mr. Wandermeyer." Why might these names be
ironic-that is, having a meaning that Lorraine and John do not realize?

Answers

These names may be ironic because:

"Miss Truman" may refer to former U.S. President Harry S. Truman's daughter, Margaret Truman. Margaret was a singer, author, and actress, and her parents were often criticized for using their political influence to further her career.

"Mr. Wandermeyer" may be a play on the German word "wander" which means "to travel." This is ironic because John is a troubled teenager who is not going anywhere in life, and he seems to be wandering aimlessly without a clear sense of direction or purpose.

What is the ironic names about?

In the novel "The Pigman" by Paul Zindel, Lorraine and John use false names when they first contact Mr. Pignati, a lonely old man who they meet while on a prank phone call. Lorraine calls herself "Miss Truman" and John calls himself "Mr. Wandermeyer."

Therefore, It is possible that Lorraine and John chose these names randomly and did not intend any deeper meaning or irony behind them. However, given the themes of the novel and the characters' struggles with identity and self-discovery, it is possible that the author included these names as subtle hints about the characters' inner conflicts and desires.

Learn more about irony from

https://brainly.com/question/26138104

#SPJ1

find the percent of the number. explain your method 20% of 50

Answers

The percent of 20 to 50 is 40%. We only need to multiply 20 by 2 to determine the solution using the shortcut.

The % technique can be found in what way?

By dividing the value by the entire value and multiplying the resulting number by 100, we can calculate the percentage.

In what sense does the % approach apply?

No salary or allowance restrictions apply to the % approach. You can utilize it as a result if the employee's pay exceeds the cap for their salary bracket or if they have more than ten allowances. Due to the additional computations required, this strategy is more difficult than the salary bracket method.

To know more about percent visit :-

https://brainly.com/question/28840349

#SPJ1

Read the sentence.

The people who live farther down this road have no telephone.

Which has an error in usage? If the sentence has no errors, choose No mistakes.

have no telephone.

The people who live

farther down this road

No mistakes.

Answers

It's time to go through some typical grammar errors that undermine our authority. Not usually enjoyable, yet a chore that must be done.

What is the sentence that is grammatically correct?

A sentence must have a singular or plural subject and verb in order to be grammatically correct. In other words, the verb tense and subject must match. A plural verb should accompany a plural subject (and vice versa).

Which phrase or clause is incorrect?

Look at this: "I wish to express my congratulations on your exam success." In this statement, the words "for" and "congratulate" are misused. The word that follows "congratulate" is "on." Hence, Part B of the phrase contains the error. Option B is the appropriate answer as a result.

To know more about sentence visit:-

https://brainly.com/question/12521648

#SPJ1

Other Questions
Why is the Basque language not increasing anymore and is still a dying/endangered language? Help needed with the question please! Information sent to a function is a?Group of answer choicessumloop control variablecount variableparameter If a strand of DNA has a sequence TAGGATC, what would be thecomplementary sequence?CGAAGATTACCGGACGAAGTCATCCTAG ______ is the usual starting point for budgeting.Select one:a. The production budgetb. The estimated net incomec. The revenues budgetd. The cash budget Which of the following are examples of biodegradable wastes? a. Plastic and cow-dung cakes c. Cow-dung cakes and vegetable peelsb. Plastic and rubber d. Glass and the cow-dung cakes In Exercises \( 1-8, W \) is a subset of \( R^{2} \) consisting of vectors of the form \[ \mathbf{x}=\left[\begin{array}{l} x_{1} \\ x_{2} \end{array}\right] \] In each case determine whether \( W \) Please I need help. I dont understand this. Two resistors of resistances 3 and 6 are connected in parallel across a battery having voltage of 12V. Determine (a) the total circuit resistance and (b) the current flowing in the 3 resistor determine which of the following features they have in common. private vs public enterprises debate Please provide steps! You are given a primary amino acid sequence of a protein.Explain how you would predict the secondary and tertiary structuresthat the mature version of the given protein would adopt. ABC Incorporated shares are currently trading for $32 per share. The firm has 1.13 billion shares outstanding. In addition, the market value of the firms outstanding debt is $2 billion. The 10-year Treasury bond rate is 6.25%. ABC has an outstanding credit record and has earned a AAA rating from the major credit-rating agencies. The current interest rate on AAA corporate bonds is 6.45%. The historical risk premium over the risk-free rate of return is 5.5%. The firms is estimated to be 1.1, and its marginal tax rate, including federal, state, and local taxes, is 40%.a. What is the cost of equity?b. What is the after-tax cost of debt?c. What is the WACC? Fill in the blank with the French word that best completes the sentence.La sur de mon pre est________.ma surma tantema fillema cousine Question:What is the importance of being educated? Cite and explain the things thhat Filipinos consider to be educated.Note:(I would really appreciate it if it was a simple answer. But if not, it's fine. :) ) What is illustrated by the following line from the second inaugural address: "seeking to destroy it without warseeking to dissolve the union"?a. Allusion b. Didacticismc. Dramaticd. Irony e. Parallelism a ballon contains 7.36 g of oxygen gas, how many oxygen molecules are in the balloon Calculate the interest earned when $46 230 is invested for 9 years at 7.8% p.a., with interest compounded twice a year. Scientists use a technique to abort the formation of seeds in the plant during its early stages. This type of procedure could be: a. Stimulative Parthenocarpy b. Vegetative Parthenocarpy c. Stenosperm