Let h = height. Write an
inequality to show that a child must be at least 48 inches tall to ride the rollercoaster.

Answers

Answer 1
48-h greater than or equal to 0. Work shown below. Hope this helps
Let H = Height. Write Aninequality To Show That A Child Must Be At Least 48 Inches Tall To Ride The Rollercoaster.

Related Questions

Please help! I will give brainliest and 5 stars!!

Answers

Based on the information in the graph, we can infer that the length of Main St between 5th Ave. and 6th Ave. is 0.24km.

How to find the value of Main St between 5th Ave. and 6th Ave?

To find the value of Main St. between 5th Ave. and 6th Ave we must perform the following mathematical procedure:

0.4 / x = 0.5 / 0.30.12 = 0.5 * xx = 0.24km

In accordance with the above, what we did was a relationship between the fractions that represent the length of each street. In this case we had to clear the x that represented Main St. between 5th Ave. and 6th Ave.

Learn more about fractions at: https://brainly.com/question/10354322

#SPJ1

Calculate the value of the expression(-7+3)(4-5×2)=

Answers

Let's break it down step-by-step:First, we need to solve the multiplication operation, 5×2, which gives us 10.So now we have: (-7+3)(4-10)Next, we need to solve the addition operation within the first set of parentheses, -7+3, which gives us -4.So now we have: (-4)(4-10)We can simplify the second set of parentheses by subtracting 10 from 4, which gives us -6.So now we have: (-4)(-6)Finally, we can multiply -4 and -6, which gives us 24.Therefore, the value of the expression (-7+3)(4-5×2) is 24.

Answer: 24
Use order of operations

graph y ≤ 2 on a number line
graph x < -3 on a number line

Answers

here’s the first one. Couldn’t understand second.

A parallelogram has vertices at (1, 3) , (1, 7) , and (4, 6) as shown. What is the point of the fourth vertex?

Answers

Answer:

(4,2)

Step-by-step explanation:

Need help solving this problem.

Answers

Option A is correct, 162 is the greatest number of caps she can buy.

What is Inequality?

A relationship between two expressions or values that are not equal to each other is called 'inequality.

Let x be the number of caps.

We have been given that cost of one cap is $6, so cost of x caps will be equal to 6x.

We are also told that the company charges an amount of $25 for shipping, so total cost of buying x caps will be equal to the cost of x caps plus shipping charges (6x+25).

Since Laura has a budget of $1,000, so cost of x caps will be less than or equal to 1,000.

We can represent this information in an equation as:

6x+25≤1000

Let us solve for x

Subtract 25 from both sides

6x≤1000-25

6x≤975

Divide both sides by 6

x≤162.5

Hence, Option A is correct, 162 is the greatest number of caps she can buy.

To learn more on Inequalities click:

https://brainly.com/question/28823603

#SPJ1

Help please due tonight

Answers

A.

Step by step; Use the pythagorean theorem. (a^2 + b^2 = c^2 )

To find G-J;
7^2 + 3^2 = c^2
49 + 9 = c^2
58 = c^2
square both sides to isolate C, and the square root of 58 doesn’t simplify so we leave it alone.
sqr58

To find G-H;
4^2 + 7^2 = c^2
16 + 49 = c^2
65 = c^2
This, same as last time, 65 doesn’t simplify. Leave it.
sqr65

To find J-H;
3^2 + 4^2 = c^2
9 + 16 = c^2
25 = c^2
Finally, one that simplifies! Square root 25.
5

Question 3 of 13
A right rectangular prism and an oblique triangular prism are both 12
centimeters tall and have the same volume. What statement must be true
about the two solids?
A. The cross-sections of the prisms are the same shape.
• B. The area of the cross-sections of the prisms are multiples of each
other.
c. The vertical cross-sections of the prisms at the same width must
have the same area.
• D. The horizontal cross-sections of the prisms at the same height
must have the same area.

Answers

Horizontal cross-sections of the prisms at the same height have the same area.

Option D.

What statement must be true about the two solids?

A right rectangular prism is a three-dimensional shape with six faces which are all rectangles. It has twelve edges and eight vertices.

An oblique triangular prism is a prism with 2 congruent triangular faces and 3 rectangular faces at an angle to the triangular faces.

This is the volume of solid figures concept.

The volume of a prism is obtained by multiplying the area of its base to its height. If the two given solid figures have the same volume and the same height then, the areas of their bases are also equal.

In this case, the height of the right rectangular prism and the oblique triangular prism are 12 cm and both prisms have the same volume, we can conclude that:

Horizontal cross-sections of the prisms at the same height have the same area.

Learn more about volume of solid figures on:

https://brainly.com/question/15392989

#SPJ1

5. In each of the following figures, AB// CD. Find the value of the unknown.
Note: Don't give wrong answer. Give answer by step by step explanation ​

Answers

The values of the unknown in the figures are a = 40, b = 32 and c = 275

How to determine the values of the unknown

Figure (a)

A quadrilateral has a total angle measure of 360 degrees.

So, we have

90 - a + 92 + 128 + 90 = 360

Evaluate the like terms

-a = 360 - 400

So, we have

a = 40

Figure (b)

The total measure of angles on a line is 180 degrees.

So, we have the following

4b - 10 + 2b - 2 = 180

Evaluate the like terms

6b = 192

So, we have

b = 32

Figure (c)

The total measure of angles at a point is 360 degrees

So, we have the following

c + 19 + (94 - 28) = 360

Evaluate the like terms

c = 275

Hence, the value of c is 275 degrees

Read more about angles at

https://brainly.com/question/25716982

#SPJ1

Of all the cookies in a cookie jar, 4/5 are oatmeal of the oatmeal cookies 2/3 have nuts what fraction of all the cookies in the cookie jar are oatmeal with nuts?

Answers

By answering the above question, we may state that So, 5333/10000 of linear equationthe cookies in the cookie jar are oatmeal cookies with nuts.

What is a linear equation?

In algebra, a linear equation is one that of the form y=mx+b. The slope is B, and the y-intercept is m. As y and x are variables, the previous sentence is frequently referred to as a "linear equation with two variables". Bivariate linear equations are linear equations with two variables. Linear equations may be found in many places, including 2x - 3 = 0, 2y = 8, m + 1 = 0, x/2 = 3, x + y = 2, and 3x - y + z = 3. When an equation has the structure y=mx+b, where m denotes the slope and b the y-intercept, it is referred to as being linear. A mathematical equation is said to be linear if its solution has the form y=mx+b, where m stands for the slope and b for the y-intercept.

For the sake of a simple computation, let's say that the cookie jar contains 100 cookies.

The issue states that 4/5 of the cookies in the jar are oatmeal cookies. So,

80 oatmeal cookies are equal to 4/5 * 100.

Two thirds of the oatmeal cookies have nuts in them. So,

2/3 times 80 equals 53.33 oatmeal cookies with nuts (approx)

As a result, the percentage of cookies in the cookie jar that are made with oats and nuts is:

53.33/100 = 0.5333

This is expressed as a fraction:

0.5333 = 5333/10000

So, 5333/10000 of the cookies in the cookie jar are oatmeal cookies with nuts.

To know more about linear equation visit:

https://brainly.com/question/11897796

#SPJ1

What is the variable, coefficient, constant of 11 Y +4.5?

Answers

Answer: variable Y, coefficient 11, Constant 4.5

Step-by-step explanation:

variable: Y

coefficient: 11

Constant: 4.5

75x+30y=1500. Solve for x and y

Answers

For the equation 75x+30y=1500,  x is (100 - 2y) / 5 and y is (100 - 5x) / 2.

Describe Equation?

An equation is a mathematical statement that uses symbols and numbers to express a relationship between two or more variables. It states that two expressions are equal to each other.

We can solve for x and y in the equation 75x + 30y = 1500 by using algebraic manipulation.

First, we can simplify the equation by dividing both sides by the greatest common factor of 75 and 30, which is 15:

(75x + 30y) / 15 = 1500 / 15

Simplifying the left side gives:

5x + 2y = 100

Next, we can isolate one of the variables. Let's isolate y by subtracting 5x from both sides:

5x + 2y - 5x = 100 - 5x

Simplifying the left side gives:

2y = 100 - 5x

by dividing both sides by 2:

y = (100 - 5x) / 2

This is the equation for y in terms of x. We can use this equation to solve for y given a value of x, or we can substitute it back into the original equation to solve for x in terms of y.

Let's solve for x in terms of y by isolating x in the equation 5x + 2y = 100:

5x = 100 - 2y

Dividing both sides by 5 gives:

x = (100 - 2y) / 5

This is the equation for x in terms of y. We can use this equation to solve for x given a value of y, or we can substitute it back into the original equation to solve for y in terms of x.

To know more about substitute visit:

https://brainly.com/question/10852714

#SPJ1

Suppose the population of a small town is 567 she has a lot of the population decreases the rate of 1.5%. Every year will be the population of a town thousand 20 Round your answer to the nearest whole number.

Answers

Answer:

Assuming "she" in the question is a typo and it should be "if", here's the solution:

If the population of a small town is 567, and it decreases at a rate of 1.5% per year, we can find the population after 20 years using the formula:

P = 567 * (1 - 0.015)^20

where P is the population after 20 years.

Simplifying this expression, we get:

P = 567 * 0.742 = 420.414

Rounding this to the nearest whole number, we get:

P ≈ 420

Therefore, after 20 years, the population of the small town would be approximately 420.

A square with side s has area s to the 2nd power. Brandon uses a square mat when he practices karate. The mat is 11 feet on each side.

Answers

Answer:

Step-by-step explanation:

i assume you mean that the mat is 11 feet on each side so

area = s*s(or S^2)

so 11*11=121feet sq

b. What is the distance between points K and L? Show your work.
c. Is JKL an equilateral triangle? Explain.

Answers

b. The distance between points K and L is 10 units.

c. ΔJKL is not an equilateral triangle.

What is a Triangle?

Triangle is defined as a basic polygonal shape of a triangle that has three sides and three interior angles.

Given points as:

J (-5,-3)

K (1,5),

L (7,-3)

b. To determine the distance between points K and L, we can use the distance formula:

distance = √(x₂ – x₁)² + (y₂ – y₁)²

Substituting the coordinates of K and L, we get:

distance = √((7 - 1)² + (-3 - 5)²)

distance = √(36 + 64)

distance = √(100)

distance = 10

Therefore, the distance between points K and L is 10 units.

c. To determine if JKL is an equilateral triangle, we need to check if all three sides have the same length.

We can find the lengths of each side using the distance formula:

JK = √((1 - (-5))² + (5 - (-3))²) = √(6^2 + 8²) = 10

KL = 10 (as we found in part b)

LJ = √((-5 - 7)² + (-3 - (-3))²) = √((-12)²) = 12

Since all three sides have different lengths (JK and KL are 10 units, while LJ is 12 units), JKL is not an equilateral triangle.

Learn more about the triangles here:

https://brainly.com/question/17997149

#SPJ1

Assignment 2: Please use the IQ data below and assess whether any of the IQ scores are statistically significantly high or low. Please provide corresponding z-score and percent of scores below from the table in the book. That is, you will need to provide the percent of all scores that falls BELOW the z-score you calculate (see z table in back of book gives you this percent). This is often referred to as the percentile rank.

Also, you will need to discuss whether each z- score meets the criteria of “statistically significant” and why. Please use your book to help with this part. While "statistical significance" is determined by an arbitrary score on the z-table, there is a score one must cross to be considered significant (.05 percent for example).

IQ Scores: 100, 90, 110, 160, 90, 85, 65, 100, 95, 98

Answers

The statistical significance does not necessarily imply practical significance. In this case, while the IQ score of 160 is statistically significant, it may not necessarily be practically

What is corresponding z-score and percent of score

To assess whether any of the IQ scores are statistically significantly high or low, we need to calculate the z-score for each score. The formula for calculating the z-score is:

z = (x - μ) / σ

Where x is the IQ score, μ is the mean IQ score, and σ is the standard deviation of IQ scores.

First, we need to calculate the mean and standard deviation of the IQ scores:

Mean = (100 + 90 + 110 + 160 + 90 + 85 + 65 + 100 + 95 + 98) / 10 = 99.3

Standard deviation = √[((100-99.3)² + (90-99.3)² + (110-99.3)² + (160-99.3)² + (90-99.3)² + (85-99.3)² + (65-99.3)² + (100-99.3)² + (95-99.3)² + (98-99.3)²) / 10] = 39.77

Now we can calculate the z-score for each IQ score:

z1 = (100 - 99.3) / 39.77 = 0.018

z2 = (90 - 99.3) / 39.77 = -0.233

z3 = (110 - 99.3) / 39.77 = 0.27

z4 = (160 - 99.3) / 39.77 = 1.53

z5 = (90 - 99.3) / 39.77 = -0.23

z6 = (85 - 99.3) / 39.77 = -0.36

z7 = (65 - 99.3) / 39.77 = -0.86

z8 = (100 - 99.3) / 39.77 = 0.017

z9 = (95 - 99.3) / 39.77 = -0.108

z10 = (98 - 99.3) / 39.77 = 0.032

Using the z-table, we can find the percent of scores below each z-score:

z1 =  0.018 or 70.01%

z2 = -0.233 or 34.67%

z3 = 0.27 or 75.01%

z4 = 1.53 or 83.68%

z5 = -0.23 or 34.67%

z6 = -0.36 or 37.47%

z7 = -0.86 or 45.16%

z8 =  0.017 or 70.01%

z9 = -0.108 or 31.80%

z10 =  0.032 or 69.15%

To determine whether each z-score is statistically significant, we need to compare it to a predetermined level of significance, typically α = 0.05. If the probability associated with the z-score (i.e., the percent of scores below it) is less than or equal to α, we consider the score statistically significant.

Based on this criterion, the only score that is statistically significant is the IQ score of 160 (z-score = 2.29, percent of scores below = 83.68%). All other scores have a probability greater than α, and therefore are not statistically significant.

Learn more on standard deviation here;

https://brainly.com/question/475676

#SPJ1

A consumer purchased a computer after a 28% price reduction. If x represents the computer's original price, the reduced price can be represented by?

Answers

The price after the reduction is 0.72x

How to determine the price after the reduction

From the question, we have the following parameters that can be used in our computation:

Original price = x

Reduction = 28%

Using the above as a guide, we have the following:

Reduced price = Original price * (1 - Reduction)

Substitute the known values in the above equation, so, we have the following representation

Reduced price = x * (1 - 28%)

Evaluate

Reduced price = 0.72x

Hence, the reduced price is 0.72x

Read more about expression at

https://brainly.com/question/4541471

#SPJ1

Members of a lacrosse team raised $2412.50 to go to a tournament. They rented a bus for $1072.50 and budgeted $67 per player for meals. Determine the number of players the team can bring to the tournament.

Answers

The number of players the team can bring to the tournament is 20.

What is a linear equation?

An equation is said to be linear if the maximum power of the variable is consistently 1. Another name for it is a one-degree equation. A linear equation with one variable has the conventional form Ax + B = 0.

In this case, the variables x and A are variables, while B is a constant. A linear equation with two variables has the conventional form Ax + By = C.

Here, we have

Given: Members of a lacrosse team raised $2412.50 to go to a tournament. They rented a bus for $1072.50 and budgeted $67 per player for meals.

we have to determine the number of players the team can bring to the tournament.

So to make an equation, the bus charge would be the y-intercept (If no member went, they still paid for the bus fee) and the meals would be the slope (since it is dependent on how many members ride the bus.)

The total would add up to be 2412.50, so the equation would be:

2412.50 = 67x+1072.50

where x = the number of players the team can bring to the tournament without going outside of their budget.

After solving this, we get

2412.50 = 67x+1072.50

2412.50 - 1072.50 = 67x

1340 = 67x

x = 20

Hence, the number of players the team can bring to the tournament is 20.

To learn more about the linear equation from the given link

https://brainly.com/question/14323743

#SPJ1

Use the box-and-whisker plot.

A box and whisker plot. The whisker ranges from 5 to 50. The box ranges from 25 to 40 with the vertical bar inside the box at 35.

About what percent of the data fall between 5 and 35?

Enter your answer in the blank.

Answers

We know that 50% of the data falls between the minimum value and the median (i.e., between 5 and 35). So the answer is: 50%.

Describe Median?

The median is a useful measure of central tendency in datasets that are skewed or have outliers, as it is less sensitive to extreme values than the mean. It is also useful in datasets with non-numeric values, such as rankings or survey responses. In addition to the median, other measures of central tendency include the mean and mode. Each measure has its own strengths and weaknesses, and the appropriate measure to use depends on the nature of the dataset and the research question being asked.

To answer this question, we need to determine the position of the lower whisker and the vertical bar relative to the range of the data.

The lower whisker extends to 5, which is the minimum value in the dataset. The vertical bar inside the box is located at 35, which represents the median of the dataset.

Therefore, we know that 50% of the data falls between the minimum value and the median (i.e., between 5 and 35).

So the answer is: 50%.

To know more about dataset visit:

https://brainly.com/question/29016574

#SPJ1

What is this equation

Answers

Answer:

x = 8

Step-by-step explanation:

[tex]15 + x = 23[/tex]

[tex]x = 23 - 15[/tex]

∴[tex]x = 8[/tex]

For the function
f
(
x
)
=
5
x
2
+
3
x
, evaluate and simplify.


f
(
x
+
h
)
-
f
(
x
)
h
=

Answers

In respοnse tο the query, we can state that Therefοre, the simplified equatiοn expressiοn fοr f(x+h) - f(x)/h is: 10x + 5h + 3

What is equatiοn?

In a math equatiοn, twο assertiοns are cοnnected by the equals sign (=), which denοtes equivalence. A mathematical assertiοn used in algebraic equatiοns establishes the equivalence οf twο mathematical statements. Fοr instance, in the equatiοn 3x + 5 = 14, the equal sign creates a space between the values 3x + 5 and 14. Tο cοmprehend the relatiοnship between the twο sentences written οn οppοsing sides οf a letter, utilise a mathematical fοrmula. The lοgο and the specific prοgramme typically cοrrespοnd. An illustratiοn wοuld be 2x - 4 = 2.

functiοn f(x) intο the fοrmula fοr f(x+h) - f(x)/h, and then simplify the resulting expressiοn algebraically.

f (x + h) — f (x)

= [5(x + h)² + 3(x + 10] — [5x² + 3x]

= [5(x² + 2xh + h²) + 3x + 314 — [5x² + ax]

= [5x² + 10xh + 5k² + 3x + 3h] — [5x² + 3x]

= 10xh + 5h² + 3h f(x+h) - 1(x) h

= 10x + 5k + 3

Therefοre, the simplified expressiοn fοr f(x+h) - f(x)/h is:

10x + 5h + 3

To know more about equation visit:

brainly.com/question/649785

#SPJ1

Pat says that 4-(p+p+p) is the same as 4-p+p+p. 6 a By replacing p by 3 in both expressions, show that Pat is wrong. b Simplify each expression algebraically.​

Answers

The required, two expressions are not equivalent, and Pat's claim is false.

What is simplification?

Simplification involves applying rules of arithmetic and algebra to remove unnecessary terms, factors, or operations from an expression.

Here,
a) To show that Pat is wrong, we can substitute p = 3 into both expressions and compare the results:

4 - (p + p + p) = 4 - (3 + 3 + 3) = 4 - 9 = -5

4 - p + p + p = 4 - 3 + 3 + 3 = 7

Since the two expressions have different values when p = 3, Pat's claim is false.

b) Simplifying each expression algebraically, we have:

4 - (p + p + p) = 4 - 3p

4 - p + p + p = 4 + p

Therefore, the two expressions are not equivalent, and Pat's claim is false.

Learn more about simplification here:

https://brainly.com/question/12501526

#SPJ9

Water flows at 2 feet per second through a pipe with a diameter of 8 inches. A cylindrical tank with a diameter of 15 feet and a height of 6 feet collects the water. What is the height, in inches, of the water in the tank after 5 minutes?

Answers

The height of the water in the tank after 5 minutes is approximately 732.6 inches.

What is the equation for a cylinder's volume?

V = πr²h, where V is a cylinder's volume, r is its radius, and h is its height, is the formula for calculating a cylinder's volume. The formula is created by first determining the area of the cylinder's base, which equals r2, and then multiplying that area by the cylinder's height to determine the volume. The volume of tanks, pipelines, and other cylindrical objects may be calculated using this formula, among many other uses.

The volume of a cylinder, which is:

V = πr²h

Given that, diameter is 15 feet, so the radius is 7.5 feet.

Also,

2 feet per second = 2 * 12 * 60 inches per minute = 1440 inches per minute

V = πr²h

Substituting the values:

V = π(7.5)^2(14405)

Here, 14405 is the amount of water that flows into the tank in 5 minutes.

Divide the volume of water by the area of the base of the cylinder

V/A = h

2,044,123/(π(7.5)^2) ≈ 732.6 inches

Hence, the height of the water in the tank after 5 minutes is approximately 732.6 inches.

Learn more about cylinder here:

https://brainly.com/question/10048360

#SPJ1

Robert is tiling the bathroom floor. Each
square-shaped tile has an area of 120.5
square inches. Which measurement is
closest to the side length of a square tile
in inches?
A. 9 in.
B.11 in.
c. 13 in.
D. 15 in.

Answers

The measurement that, in inches, comes closest toward the length equal of a square tile is: 11 in.

Define the properties of the square?

A square is a shape that we frequently encounter in our daily lives. Illustrations of square shapes that are frequently used include chess pieces, clock hands, picture frames, pizza boxes, coasters, computer keys, etc.

The square's four sides are equal to one another.A square's diagonals are parallel to one another.The square is split into 2 congruent triangles by each diagonal.Each diagonal in a square is the same length.

In the bathroom, Robert is paving the floor.

The area of each square-shaped tile is 120.5 square inches.

Area = side²

side = √Area

side = √120.5

side = 10.97 in

side = 11 in (approx)

The measurement that, in inches, comes closest toward the length equal of a square tile is: 11 in.

Know more about properties of the square

https://brainly.com/question/16533609

#SPJ9

Choose the correct statement.
O-2<-3
05>6
4>-4
O 0<-6

Answers

Step-by-step explanation:

here,

[tex] 4 > - 4[/tex]

so the correct answer is this

A trapezoidal flower garden is shown below. what is the area of the garden

Answers

The area of the trapezoidal flower garden from the dimensions is 123.5 square meters

What is the area of the garden

The trapezoidal flower garden represents the given parameter, where we have the following readings

Parallel sides = 9 m and 10 m

Height = 13 m

Using the above dimensions, we have the area to be

Area = 1/2 * Sum of parallel sides * Height

When the dimensions are substituted, we have

Area = 1/2 * (9 + 10) * 13

Evaluate the products

Area = 123.5

HEnce, the area is 123.5 square meters

Read more about areas at

https://brainly.com/question/22972014

#SPJ1

HELPPP PLS thank you pls

Answers

The piecewise function is defined as follows:

y = x² + 4, x < 2.y = -x + 4, x ≥ 2.

How to define the piecewise function?

A piece-wise function is a function that has different definitions, based on values of the input x of the function.

For this problem, the intervals are given as follows:

x < 2. -> left of x = 2.x ≥ 2. -> right of x = 2.

For the first interval, the interval is open due to the open circle, and the quadratic function is a translation up 4 units of y = x², hence:

y = x² + 4, x < 2.

For the second interval, which is the closed interval, we have a decaying line with slope of -1 and x-intercept of 4, hence:

y = -x + 4, x ≥ 2.

More can be learned about piecewise functions at brainly.com/question/19358926

#SPJ1

What is the surface area of this shape.
I will give brainliest
If you can please explain

Answers

The total surface area of the given solid is 256 inch²

Surface area:

Surface area is the measure of the total area that the surface of an object occupies. It is usually expressed in square units, such as square meters, square centimeters, or square feet.

Here in this problem take the surface of the solid as the number of faces and calculate the area of each face as shown below.

Here we have

Solid box with dimensions 4 in, 5 in, and 8 in

The surface of the given solid can be divided as given in the picture

The surface area of the shape = Sum of areas of [ 1 to 12 faces ]

Area of (1, 2, 3, 7, 8, 9 faces ) = 6 (4 × 4 )= 96 inch²  

Area of (4, 5, 6, 10, 11, 12 faces ) = 6 (5 × 4) = 120 inch²    

Area of bottom = (8 × 5) = 40 inch²  

Total Surface area = [ 96 + 120 + 40 ] = 256 inch²

Therefore,

The total surface area of the given solid is 256 inch²

Learn more about Surface area at

https://brainly.com/question/14765344

#SPJ1

The equation y equals 4 times 3 to the power of t shows the number of infected people from an outbreak of the measles. The variable y represents the number of infected people, and t represents time in weeks. In how many weeks will the number of infected people reach 600

Answers

Answer: 8.2 weeks.

Step-by-step explanation: If y = 4*3^t, then 600 = 4*3^t. Therefore, t = log3 (600/4), which is approximately 8.2 weeks.

What are the coordinates of each point after the quadrilateral RSTU is rotated 90 degrees about the origin?



Answers

Answer:

Step-by-step explanation:

90 degrees is the answer because there is no movement

HELPPPP MEEEE

I NEED TO TURN IN THIS LATE MATH HOMEWORK

Answers

Answer:

I think is D

Step-by-step explanation:

because

R:622 and Y:410

Other Questions
HELP PLSSSSS!!!!!!!Krystal throws a rappelling rope at a speed of 10 m/s down a 50 m cliff.When will the rope hit the ground? Use the drop-down to put the correct order to solve for when the rope will hit theground. Ismail and Sameer are opening a paint store. There are no competing paint stores in the area. They must decide how to organize the business. They anticipate profits of $100,000 the first year, with the ability to sell franchises in the future. Although they have enough to start the business now as a partnership, cash flow will be an issue as they grow. They feel the corporate form of operation will be best for the long term. They seek your advice.Requirements1. What is the main advantage they gain by now selecting a corporate form of business?2. Would you recommend they initially issue preferred or common stock? Why?3. If they decide to issue $10 par common stock and anticipate an initial market price of $40 per share, how many shares will they need to issue to raise $2,250,000?4.vForecast their earning potential with your imaginary numbers for the next two years. Here, you have to prepare forecasted income statements and the year-end balance sheets for the first two years, assuming that they are going the start the business as a joint-stock company?? A soccer ball with a mass of 0.43 kg is thrown to a 63 kg girl at rest who is wearing roller blades. She catches the ball and moves to the right. Her speed just after catching the ball is 0.2 m/s. How did covid affect school kids in Afrikaans 15. \( x=-5, \quad x=4, \quad x=-\frac{1}{2} \) factored form standard form 16. \( x=3, \quad x=-7, \quad x=0 \) (multiplicity of 2) factored form standard form\[ \text { 17. } x=\frac{2}{3} \text { what smaller 5.75 or 9/7 When the Europeans arrived in Central America, most countries fell to Spanish rule except ______, which became a British colony. i need help 16 divided by 6032 full solution A jet flying at 200 m/s north accelerates at a rate of 18.2 m/s for 15 seconds. What is the jet's final velocity? The RNA sequence GGAUCUCUUGUAGAUCUGUUCUCUAAACGAAC lies in a section of the COVID-19 viral genome that sets up translation, which is the process of reading the RNA to create the proteins the virus needs to survive.(a) Use the webserver to predict the lowest energy structure of the sequence. Print out a picture of it. (b)What do you think the effect will be of the RNA being longer than the stretch you just similated? (c) Design an RNA sequence that folds into a single stem-loop. Run it through the RNAfold server and print a picture of your folded design. consider a political discussion group consists of 6 democrates, 3 republicans, and 5 independents. suppose that two group members are randomly selected, in succession, to attend the political convention. find the probability of selecting a independent then a democrat According to the Kaplan-Meier plot, amplification of more than 10 copies of myc in neuroblastoma (see fig. 4-11b), decreases disease-free survival by more than 80% post-treatment. Explain two mechanisms that may contribute to gene amplification of myc? Even though both lens cells and liver cells have numerous transcription factors that are present in both colls, the lens cell makes the crystallin protein (not albumin), whereas the liver cell makes albumin (not crystallin) Which of the following explains this cell specificity?A. Different specific transcription factors made in each cell determine which genes are expressedB. At fertilization, specific colls are destined for certain functionsC. The activators needed for expression of the crystallin gene are present in all cells.D. The promoters are different for the different genes How does the author's discussion of different death rates help readers understand the spread of the Black Death? Use evidence from the text in your responsepls i need help!! a rock rolling down a slope from rest covers a distance of 4 m in the first second. What distance will it covers in 3 sec? 5 3/10 = 5 ?/50If anyone can please help me with the rest what happened to some native Americans during the Jackson presidency ? In order for following to be consistent,-3x +4y +7z =-4-11x +24y +kz = -452x -5y -8z =9solve for k ?please show full steps Air passes over the top of an airplanewing at 170 m/s, and over the bottomat 130 m/s. What is the difference inpressure between the top andbottom of the wing? Scarlett and Roger sipped their drinks on the porch, discussing all the things they still had to do before the Easter holiday. As Roger finished her last bit of burger, he sighed, "I'm stuffed." He complained of having a burning sensation in his lower chest. "You probably ate too much. How about taking some antacid?" asked Scarlett. "I use it every time I get indigestion." Roger left to search the medicine cabinet. He eventually felt better. Roger got his body test results the next day. He glanced at them briefly and put the paper in his bag. "Maybe later I will get a better sense of what all this means," he said.'Roger's test results(at rest and fasting levels)TEST Roger's Result Normal RangeHeart rate 90 beats/min 60-100 beats/minBlood pressure 138/95 mm/Hg 120/80 mm/HgTotal cholesterol 242 mg/dL