Learning by doing suggests that: Multiple Choice greater experience increases production costs. greater experience increases efficiency. diminishing marginal productivity occurs more rapidly.

Answers

Answer 1

Answer:

greater experience increases efficiency.

Explanation:

In Business management, Learning by doing suggests that greater experience increases efficiency.

Learning by doing can be defined as the process which involves different individuals making use or an application of their experiences, especially the experiences they acquired by actively engaging in the production, tasks or projects.

Additionally, when significant externalities are actively associated with learning by doing, the level or quantity and quality of production will become sufficiently great and result in an increased returns to scale as more sales and profit would be made by the organization.

It is a good concept and strategy which helps organizations to break even and to meet their goals, aim and objectives.


Related Questions

A(n) _____ gives managers access to large amounts of data and the processing power to convert the data into high-quality information quickly and efficiently.

Answers

Answer:

decision support system.

Explanation:

A decision support system can be defined as a technological program used by organizations to assist in decision making.

This system works by analyzing essential data for decision making, such as sales reports, revenues, operations and projections, and after the analysis, it gathers the most important information, which will help a manager to find relevant standards and make an important decision of more quickly and effectively.

This system guarantees the analysis of a high volume of information and synthesizes it in a flexible and easy way, allowing the analysis of data from graphs, for example, which facilitates decision making. Because it is an intelligent computer system, it can be developed to deliver better performance and assist in organizational decision making.

On January 1, 2021, the Highlands Company began construction on a new manufacturing facility for its own use. The building was completed in 2022. The company borrowed $2,200,000 at 8% on January 1 to help finance the construction. In addition to the construction loan, Highlands had the following debt outstanding throughout 2021:

$9,000,000, 10% bonds
$6,000,000, 8% long-term note

Construction expenditures incurred during 2021 were as follows:

January 1 $900,000
March 31 1,500,000
June 30 1,160,000
September 30 900,000
December 31 700,000

Required:
Calculate the amount of interest capitalized for 2016 using the specific interest method.

Answers

Answer:

$255,960

Explanation:

Weighted average expenses:

January 1, $900,000  x 12/12 = $900,000March 31, $1,500,000  x 9/12 = $1,125,000June 30, $1,160,000  x 6/12 = $580,000September 30, $900,000  x 3/12 = $225,000December 31, $700,000 x 0/12 = $0total $2,830,000

average interest rate for general debt = ($9,000,000 x 10%) + ($6,000,000 x 8%) = $1,380,000

$1,380,000/$15,000,000 = 9.2%

interest expense:

specific debt = $2,200,000 x 9% = $198,000

general debt = $630,000 x 9.2% = $57,960

total capitalized interest = $255,960

Construction Exp

Jan 900,000 1 900,000

Mar 1,500,000 0.75 1,125,000

June 1,160,000 0.5 580,000

Sept 900,000 0.25 225,000

Dec 700,000 0 -

5,160,000 2,830,000

Weighted avg

900,000

480,000

1,380,000

interest on difference interest on construction

9.20% 8.0%

630,000 2,200,000

57,960 176,000.0

Amount capitalized 233,960.0

During the Great Recession, the U.S. budget deficit worsened as tax collections fell and payments to the poor rose. In other words, the deficit worsened as a result of _________ in the federal budget.

Answers

The answer is automatic stabilizers

To: HR Department
From: Jill Best, Manager
Re: Lost Performance Appraisal Form
Six weeks ago when our offices were being remodeled, one of the janitors accidentally threw away a small stack of papers. Included in the stack was a performance appraisal form which I had just completed on one of my subordinates, Karen Whitmore. I know you need this form, but it is gone, What should I do?

Answers

Answer with its Explanation:

The performance Appraisal form are very important when we are interested in appraising the performance of employees. It not only helps to keep the employees motivated but also helps to highlights the underperforming employees. The corrective action plan to motivate the underperforming employees can then be formulated. It also helps in deciding which employee will be valuable asset for the company and thus must be promoted.

The corrective action would be that the manager must try to reassess the performance of the employees and submit his findings in the form of Performance Appraisal Form. The manager must also have backup of his findings and that he can mail the performance appraisal form by an email.

Which of the following determine(s) the level of real interest rates? I) The supply of savings by households and business firms II) The demand for investment funds III) The government's net supply and/or demand for funds

Answers

Answer:

I II & III - All of the above.

Explanation:

Real interest rate is an interest rate that shows actual cost of funds to a borrower having taken into consideration the effects of inflation while also reflecting actual gain to the lender. It shows how purchasing power has value on interest paid on a loan.

With regards to the above, determinants of real interest rates are; the supply of savings by household and business firms, the demand for investment funds and the government's net supply/and or demand for funds.

Nissan’s all-electric car, the Leaf, has a base price of $32,780 in the United States, but it is eligible for a $7500 federal tax credit. A consulting engineering company wants to evaluate the purchase or lease of one of the vehicles for use by its employees traveling to job sites in the local area. The cost for leasing the vehicle will be $4200 per year (payable at the end of each year) after an initialization charge of $2500 paid now. If the company purchases the vehicle, it will also purchase a home charging station for $2200 that will be partially offset by a 50% tax credit. If the company expects to be able to sell the car and charging station for 40% of the base price of the car alone at the end of 3 years, should the company purchase or lease the car? Use an interest rate of 10% per year and annual worth analysis.

Answers

Answer:

Nissan's all-electric car, the Leaf

PV cost of Leaf Purchase =   $16,529

PV cost of Leasing =             $12,944.78

The company should lease the car.

Explanation:

a) Costs incurred to purchase the Leaf:

Base price                    $32,780

less Federal tax credit ($7,500)

Charging station             2,200

less 50% tax credit         (1,100)

Cash paid                  $26,380

Sales value after 3 yrs (9,851) ( $26,380 - 40% of base discounted to PV)

Net PV Investment    $16,529

b) Calculation of Discounted Present Values of Payments under Leasing, using online financial calculator:

PV (Present Value) $12,944.78

N (Number of Periods) 3.000

I/Y (Interest Rate) 10.000%

PMT (Periodic Payment)   $4,200.00

Starting Investment $2,500.00

Total Principal $15,100.00

Total Interest $2,129.50

c) The purchase of the Leaf would involve a present value cost of $26,380 after deducting all the savings from tax.  The 40% sales value of the car at the end of 3 years = $13,112 ($32,780 x 40%).  When this sales value is discounted to PV of $9,851, the PV of the car investments becomes $16,529 ($26,380 - $9,851).  On the other hand, leasing will cost in PV the sum of $12,944.78

.

"An economy is based on three sectorsdashagriculture​, ​manufacturing, and services. For each unit of​ output, agriculture requires inputs of 0.20 unit from​ agriculture, 0.40 unit from​ manufacturing, and 0.20 unit from services. For each unit of​ output, manufacturing requires inputs of 0.30 unit from​ agriculture, 0.20 unit from​ manufacturing, and 0.20 unit from services. For each unit of​ output, services requires 0.20 unit from​ agriculture, 0.30 unit from​ manufacturing, and 0.30 unit from services. Determine the production levels needed to satisfy a final demand of 0 units for​ agriculture, 40 units for​ manufacturing, and 0 units for services. The production level needed from the agricultural sector is 40.00 units."

Answers

Answer:

Required Production to fullfil a Demand for 40 industry units

Agriculture 54.4

Industry 83.2

Services 51.2

Explanation:

Input Agricuilture Industrial Service

Agriculture 0.2           0.3 0.2

Industrial 0.4           0.2 0.3

Service         0.2           0.2 0.3

We require X input to generate a demand of 0 agriculture 40 industry and 0 services

The previous matrix will be the input we solve for the output

Output Agricuilture Industrial Service

Agriculture 0.8            -0.7 -0.8

Industrial -0.6             0.8 -0.7

Service        -0.8            -0.8 0.7

We now reverse the matrix using excel:

Output Agricuilture Industrial Service

Agriculture 2           1.36 0.96

Industrial 1           2.08       0.88

Service         1           1.28 2.08

Now we multiply this by our desired outcome of

0

40

0

Agriculture 54.4

Industry 83.2

Services 51.2

Chester has negotiated a new labor contract for the next round that will affect the cost for their product Camp. Labor costs will go from $3.79 to $4.39 per unit. Assume all period and other variable costs remain the same. If Chester were to absorb the new labor costs without passing them on in the form of higher prices, how many units of product Camp would need to be sold next round to break even on the product?

Answers

Complete Question:

Chester has been selling widgets for $10, total variable costs are $4.40 and fixed costs are $100,000.

Chester has negotiated a new labor contract for the next round that will affect the cost for their product Cid. Labor costs will go from $2.79 to $3.39 per unit. Assume all period and other variable costs remain the same.

If Chester were to absorb the new labor costs without passing them on in the form of higher prices, how many units of product Cid would need to be sold next round to break even on the product?

Answer:

Chester

Break-even point = Fixed costs/Contribution margin per unit

= $100,000 / $5

= 20,000 units

Explanation:

a) Data and Calculations:

Selling price = $10

Old variable cost = $4.40

Additional variable cost = $0.60

New variable costs = $5 ($4.40 + $0.60)

Contribution per unit = Selling price minus variable cost per unit

= $5 ($10 - $5)

Fixed costs = $100,000

b) Chester's Break-even point (in units) is the number of units of a product  Camp that Chester requires to sell in order to recover her fixed costs.  The information provided by break-even analysis guides Chester in making decisions for the production of Camps and its marketing.  Without identifying the units of Camp to be produced and sold in order to remain in business, all things being equal, Chester might short-produce or short-sell Camps and run the business unprofitably.

When units produced are greater than units sold under variable costing, fixed overhead is an expense and results in___________(lower, higher) net income than under absorption costing.

Answers

Answer: lower

Explanation:

Variable costing is a method used in accounting whereby the manufacturing overhead will be incurred at the particular period when the product is produced.

In the absorption costing method, the indirect expenses which are the overheads and the direct costs are taken into consideration.

The variable costing helps to solve the issue regarding absorption costing which allows for an increase in income as there is am increase in production.

On the first day of the fiscal year, a company issues a $2,600,000, 7%, 6-year bond that pays semiannual interest of $91,000 ($2,600,000 × 7% × ½), receiving cash of $2,477,994. Journalize the first interest payment and the amortization of the related bond discount. Round to the nearest dollar. If an amount box does not require an entry, leave it blank.

Answers

Answer:

Dr interest expense( 10,167.17+91,000)     $ 101,167.17  

Cr cash                                                                             $91,000.00

Cr discount on bonds payable                                        $ 10,167.17

Explanation:

The discount on bond issuance is the difference between the cash proceeds received and the face value of the bonds.

discount on bonds payable=$2,600,000-$2,477,994=$122,006.00  

amortization of discount=discount/number of semiannual interest payable

in 6 years,12 semiannual coupons are payable

amortization of discount=$122,006.00 /12=$10,167.17  

Currently Baldwin is paying a dividend of $19.69 (per share). If this dividend were raised by $3.64, given its current stock price what would be the Dividend Yield?

Answers

Answer:

$23.33

Explanation:

Calculation for the Dividend yield for Baldwin

Using this formula

Dividend yield = Dividend per share + Increase in Dividend

Let plug in the formula

Dividend yield = $19.69+$3.64

Dividend yield =$23.22

Therefore the Dividend yield will be $23.22

Which of the following statements is false about Activity-based management?
A. While useful, activity-based management and Activity-Based Costing information is not always cost efficient to obtain
B. The information needed for activity-based management is a direct byproduct of Activity-Based Costing
C. Activity-based management is an activity that is similar to Activity-Based Costing but requires a very different set of information
D. Activity-based management is designed to help management know which activities add the most value to goods and services

Answers

Answer:

C. Activity-based management is an activity that is similar to Activity-Based Costing but requires a very different set of information

Explanation:

Activity based management is the process by which a business identifies activities that contributes more to profitability of the business. These activities are retained.

While activities whose cost does not justify the profit they generate are discarded.

Activity based costing is used to allocate cost of a product based on level of activity of a particular process.

Activity based management uses information from activity based costing to identify processes that contribute more to profitability.

So the statement - Activity-based management is an activity that is similar to Activity-Based Costing but requires a very different set of information. - Is false

Activity-based management (ABM) is a way of identifying and assessing activities that a firm conducts, as well as doing a value chain analysis or a re-engineering exercise to enhance strategic and operational decisions in an organization, utilizing activity-based costing.

So, option C is correct as this is the only false statement about activity based management.

The other options are incorrect as:

Option A is incorrect as yes activity-based management and activity-based costing are not always cost-efficient.

Option B is incorrect as yes activity-based management and activity-based costing have many similarities but they need different information.

Option D is incorrect as yes activity-based management analysis every good and services provided by company and help organization know which of them add more value to organization.

Thus every statement is correct only statement C is untrue.

For more information about activity-based management refer to the link:

https://brainly.com/question/17192507

Intel® Retail Edge...
Zoom
TD Ameritrade Login
Oasis Nextgen
Bethel University M...
Login - CAS - Centr...
JUU
P 9–3: Dürnstein Schnapps
Durnstein Schnapps produces three types of schnapps from locally grown Austrian pears, plums, and cherries. Schnapps is a
clear, colorless beverage distilled from fermented fruit that normally contains about 40 percent alcohol. The pear and plum
schnapps are produced using an identical process whereby the pears, and plums are fermented and then distilled. The cherry
schnapps employs a similar production process but requires more direct labor to produce the unique and highly prized Durnstein
Cherry Schnapps. Each variety of schnapps (pears, plums, and cherries) is produced in batches of 500 liters and then bottled.
Durnstein Schnapps uses an absorption costing system to assign overhead to its three products for inventory costing. A
single, predetermined, plantwide overhead rate is computed using a flexible manufacturing overhead budget. Variable
manufacturing overhead is budgeted to be €16.00 per direct labor hour and fixed manufacturing overhead is budgeted to be €
845,000 for the year. The following table summarizes budgeted and operating data for the last fiscal year.
Pear Plum Cherry
Actual batches
520 370 210
Budgeted number of batches 500 400 200
Actual direct hours per batch 17 15 34
Budgeted direct labor hours per
18 18 35
batch
Durnstein Schnaps incurred actual manufacturing overhead last year of € 1,250,500.
Required:
a. Calculate Durnstein Schnapp's plantwide overhead rate for last year.
b. One batch of plum schnapps used 20 direct labor hours. How much manufacturing overhead was absorbed by this one
batch?
c. How much over/underabsorbed overhead did Dürnstein Schnapps have last year?
Page 429
d. Recommend discuss how Durnstein Schnapps is likely to account for the over/underabsorbed overhead you
calculated in part(c).​

Answers

Answer:

Dürnstein Schnapps

a. Durnstein Schnapp's Plantwide Overhead Rate for last year:

= Budgeted overhead/total budgeted direct labour hours

= €  1,216,200/23,200

= €52.42

b. Manufacturing overhead absorbed by one batch of plum schnapps using 20 direct labor hours

= Overhead rate * direct labor hours

= €52.42 * 20

= €1,048.40

c. Determination of over/underabsored overhead last year:

= Total budgeted manufacturing overhead minus actual manufacturing overhead

= €  1,216,200 - € 1,250,500

= € 34,500 under absorbed

d. Durnstein Schnapps will adjust the cost of goods sold and the ending inventory in order to account for the underabsored overhead in part (c).

The purpose is to reflect eh true absorption cost of products and ending inventory.

Explanation:

Data and Calculations:

Variable manufacturing overhead (budgeted) = €16.00 per direct labor

Fixed manufacturing overhead (budgeted) = € 845,000 for the year

Budgeted and operating data for the last fiscal year:

                                                    Pear            Plum            Cherry

Actual batches                             520              370               210

Budgeted number of batches   500              400               200

Actual direct hours per batch       17                 15                  34

Budgeted direct labor hours per  18                 18                   35

batch

Total budgeted direct labor hours

  (500*18)   (400*18)   (200*35)   9,000         7,200          7,000    23,200

Total actual direct labor hours

 (520 * 17)  (370 * 15) ( 210 * 34) 8,840          5,550         7,140      21,530

Durnstein Schnaps incurred actual manufacturing overhead last year of € 1,250,500.

Budgeted manufacturing last year = Budgeted direct labor hours * Variable manufacturing overhead per direct labour hour + Budgeted fixed manufacturing overhead

= 23,200 x  €16.00 + €  845,00

= €371,200 + €845,00

= €  1,216,200

b) Absorption costing is a method that Durnstein Schnapps can use to calculate the costs of its variety of schnapps by including direct and indirect costs.  It is not like marginal or variable costing method that uses only the variable elements of production costs in arriving at the costs of Durnstein schnapps.  The absorption costing method tries to capture all production costs and absorb them into the costs of the pear, plums, and cherries schnapps in order to determine their appropriate prices.  Variable costing method does not treat overhead production costs as product costs, but as period costs.

Tobitzu TV produces wall mounts for flat panel television sets. The forecasted income statement for 2015 is as follows:

TOBITZU TV Budgeted Income Statement For the Year 2015

Sales ($49 per unit) $4,900,000
Cost of good sold ($32 per unit) (3,200,000)
Gross profit 1,700,000
Selling expenses ($4 per unit) (400,000)
Net income $1,300,000

Additional Information:
a. Of the production costs and selling expenses, $600,000 and $100,000, respectively, are fixed.
b. Tobitzu TV received a special order from a hospital supply company offering to buy 12,000 wall mounts for $30. If it accepts the order, there will be no additional selling expenses, and there is currently sufficient excess capacity to fill the order. The company's sales manager argues for rejecting the order because "we are not in the business of paying $32 to make a product to sell for $30."

Required:
Calculate the net benefit (cost) of accepting the special order.

Answers

Answer:

$48,000 net benefit

Explanation:

For computing the net benefit or net cost for accepting the special order first we need to find out the variable cost of goods sold per unit which is shown below:

The  variable cost of goods sold is

= total cost of goods sold - fixed production costs

= $3,200,000 - $600,000

= $2,600,000.

Now

Total units produced is

= Total revenue ÷ selling price per unit

= $4900000 ÷ 49

= 1,00,000 units.

So, variable cost of goods sold per unit is

= $2,600,000 ÷ 1,00,000

= $26 per unit.

Therefore the net benefit or cost arises is

= (Revenue generated from the special order) - (variable cost of goods sold)

= (12,000 × $30) - (12,000 × $26)

= $48,000 net benefit

a food worker is frying donuts in the deep fyer what is the food worker requied to wear to keep food safe

Answers

Answer:

Gloves and a hair net

Explanation:

Simone founded her company using $200,000 of her own money, issuing herself 200,000 shares of stock. An angel investor bought an additional 100,000 shares for $150,000. She now sells another 500,000 shares of stock to a venture capitalist for $1.5 million. What is the post-money valuation of the company

Answers

Answer:

2,400,000

Explanation:

The computation of post-money valuation of the company is shown below:-

post-money valuation of the company is

= Total shares outstanding × Price per share

= (200,000 + 100,000 + 500,000) × (1,500,000 ÷ 500,000)

= 800,000 × 3

= 2,400,000

Therefore we have applied the above formula by considering all the elements given in the question

Assume the MPC is 0.8. Assuming only the multiplier effect matters, a decrease in government purchases of $100 billion will shift the aggregate demand curve to the:__________
a. left by $180 billion.
b. left by $500 billion.
c. right by $180 billion.
d. right by $400 billion.

Answers

Answer:

b. left by $500 billion.

Explanation:

Given marginal propensity to consume, MPC = 0.8

Marginal propensity to consume + Marginal  propensity to save = 1

MPC + MPS = 1

0.8 + MPS = 1

MPS = 1-0.8

MPS = 0.2

Now, the government multiplier = 1/MPS

The government multiplier = 1 / 0.2 = 5

Total fall in aggregate demand = Government multiplier × Government purchases

= 5 ×100

= $500

Since there is a fall in spending so the aggregate demand curve will shift leftwards.

Therefore, the correct option is b. left by $500 billion.

Assume a competitive firm faces a market price of $70, a cost curve of
C = 0.003q3 + 50q + 750
and a marginal cost of:
Mc= 0.009q2 + 50.
The firm's profit maximizing output level is______units and the per unit profit at this output level is $______.
This firm will_____in the short run The firm will realize______. In the long-run, if circumstances do not change, this firm will_____.

Answers

Answer and Explanation:

The computation of Output level is shown below:-

The equilibrium condition of competitive firms will be

P = MC

70 = 0.009q^2 + 50

0.009q^2 = 70 - 50

0.009q^2 = 20

q^2 = 20 ÷ 0.009

q^2 = 2,222.222222

So,

q = 47.14045208

or

= 47.14

The computation of profit per unit is shown below:-

Total profit = Total sales - Total cost

= ($70 × 47.14) - (0.003q^3 + 50q + 750)

= $3299.8  - {0.003 (47.14)^3 + 50 × 47.14 + 500}

= -$121.460639032

or

= -$121.46

Profit per unit = Total profit ÷ Output

= -$121.46 ÷ 47.14

= -$2.58

The computation of Produce or shutdown is shown below:-

Total variable cost (TVC) = 0.003q^3 + 50q

= 0.003 (47.14)^3 + 50 × 47.14

= 2671.260639

or

= 2,671.26

AVC = Total cost ÷ Output

= 2,671.26 ÷ 47.14

= 56.66652524

or

= 56.67

Here, $70 which is the market price is higher than AVC that is 56.67, so the company will produce

The firm will realize an economic loss in the long run. If the situation will not modify, this firm will shut down.

In the short term, the company can deliver as its marginal income exceeds the marginal cost. Yet in the long run, the company would suffer an economic loss because the average income per unit is smaller than the average expense per unit. But it would suffer a loss in the long run, but then would prefer to shut down.

"What will be the results if two monopolistic competitors both launch successful advertising campaigns targeting its competitors consumers in order to draw them away from the other firm

Answers

Answer: a. These two competitor firms will negate each other's efforts.

Explanation:

The advertising campaigns that both monopolistic competitors was said to be successful which means that they were both able to draw their competitor's customers away from the other firm.

The net effect of this would be that both of them negated each other's efforts because when Firm A gained some of Firm B's customers it also lost some of its customers to Firm B which is evidently also what happened to Firm B.

Viserion, Inc., is trying to determine its cost of debt. The firm has a debt issue outstanding with 23 years to maturity that is quoted at 103 percent of face value. The issue makes semiannual payments and has an embedded cost of 6 percent annually. a. What is the company’s pretax cost of debt? (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) b. If the tax rate is 21 percent, what is the aftertax cost of debt? (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.)

Answers

Answer:

Viserion, Inc.

Cost of debt:

Premium on Debt = 3% (103 - 100%)

Amortization of the premium = 3%/23 = 0.13%

Interest cost = 6%

Cost of debt (pretax) = 6% - 0.13% = 5.87%

Explanation:

The cost of debt is the difference between the interest expense in percentage that Viserion, Inc. pays annually and the premium on the debt that must be amortized over the life of the debt.  Since Viserion, Inc. pays 6% annually or 3% semiannually on the debt and amortizes 0.13% of the debt premium, the amortization rate is taken away from the annual interest to get the cost of debts in percentage terms.

Mario transferred real estate with an adjusted basis of $140,000 for similar real estate with a fair market value of $160,000. The exchange qualified as a like-kind exchange. The realized gain on the exchange was $

Answers

Answer:

$20,000

Explanation:

Calculation for th e realized gain on the exchange

Using this formula

Realized gain=Fair market value - Adjusted basis

Let plug in the formula

Realized gain=$160,000-$140,0000

Realized gain=$20,000

Therefore the realized gain on the exchange was $ 20,000

Which one of the following categories provides a common approach and frame of reference for conducting project management activities within an organization?

a. Business alignment
b. Resource integration
c. Technical support
d. Practice management

Answers

Answer:

The correct answer is the option A: Business alignment.

Explanation:

To begin with, the concept known as "Business Alignment" refers to the process by which the managers of a company tend to use the information technology in order to obtain certain business objectives inside the organization that are the goals that they looked for. In addition, this process sometimes tend to focus more on the financial improvement of the company as well as its marketplace competitiveness. Therefore that this type of term gives a good approach and frame of reference for the managers who are looking for conduct project management activities inside the company.

g Delta of a call option is 0.85. How many units of the underlying stock should you hold to hedge a short position in 100 call option contracts

Answers

Answer: a.85,000

Explanation:

When using Delta to determine how many units of the underlying stock one should hold to hedge a short position, the following formula is used;

= Delta * No. of positions

= 0.85 * ( 100 * 100)

= 8,500

8,500 units of the underlying stock should be held to hedge a short position in 100 call option contracts with a contract multiplier of 100.

Pooler Corporation is working on its direct labor budget for the next two months. Each unit of output requires 0.15 direct labor-hours. The direct labor rate is $7.00 per direct labor-hour. The production budget calls for producing 6,500 units in April and 6,200 units in May. If the direct labor work force is fully adjusted to the total direct labor-hours needed each month, what would be the total combined direct labor cost for the two months?

Answers

Answer:

$13,335

Explanation:

Required production in units for April and May are 6,500 units and 6,200 units respectively.

Direct labor hours needed is 0.15 for both months.

Total direct labor hours needed for each month would be;

April

= 6,500 units × 0.15

= 975

May

=6,200 units × 0.15

= 930

Direct labor rate per hour for each months is $7

Total direct labor cost for April would be;

= $7 × 975

= $6,825

Total direct labor cost for May would be;

= $7 × 930

= $6,510

Therefore, total direct labor cost for both months April and May would be;

= $6,825 + $6,510

= $13,335

On June 15, 2021, Sanderson Construction entered into a long-term construction contract to build a baseball stadium in Washington, D.C., for $220 million. The expected completion date is April 1, 2023, just in time for the 2023 baseball season. Costs incurred and estimated costs to complete at year-end for the life of the contract are as follows ($ in millions):
2021 2022 2023
Costs incurred during the year $40 $80 $50
Estimated costs to complete as of December 31 120 60
Required:
1. Compute the revenue and gross profit will Sanderson report in its 2021, 2022, and 2023 income statements related to this contract assuming Sanderson recognizes revenue over time according to percentage of completion. 2. Compute the revenue and gross profit will Sanderson report in its 2021, 2022, and 2023 income statements related to this contract assuming this project does not qualify for revenue recognition over time
3. Suppose the estimated costs to complete at the end of 2022 are $80 million instead of $60 million. Compute the amount of revenue and gross profit or loss to be recognized in 2022 assuming Sanderson recognizes revenue over time according to percentage of completion.

Answers

Answer:

1.

2021 Gross profit/loss $15

2022 Gross profit/loss $12

2023 Gross profit/loss $23

2.

2021 Revenue recognized  $0

2022 Revenue recognized $0

2023 Revenue recognized $220

2021 Gross profit/loss $0

2022 Gross profit/loss $0

2023 Gross profit/loss $50

3.Gross profit /loss ($3)

Explanation:

1. Computation of thr Gross Profit recognize over time assuming percentage of completion method

Using PERCENTAGE OF COMPLETION

Using this formula

Choose numerator ÷ Choose denominator = % complete to date

Actual costs to date÷ Estimated total costs= %  

2021 $40 ÷ $160=25.00%

(40+120)  

2022 $120(40+80) ÷$180(40+80+60) = 66.67%    

2023 170  170  =100.00%

(40+80+50)    

2021

To date - Recognized in prior years = Recognized in 2018

Construction revenue $55(220*25%) $0 $55

 

Less: Construction expense $40 $0 $40

Gross profit (loss) $15 $0 $15

2022

To date - Recognized in prior years = Recognized in 2019

Construction revenue $147(220*66.66%) $55 $92

Less: Construction expense $120(40+80) $40 $80

Gross profit (loss) $27 $15 $12

2023

To date - Recognized in prior years = Recognized in 2020

Construction revenue $220 $147 $73

 

Less: Construction expense $170(40+80+50) $120 $50

 

Gross profit (loss) $50 $27 $23

2. Calculation for the Statement showing revenue and gross profit assuming this project does not qualify for revenue recognition over time. ( $ in Million)

Year Revenue recognized Gross Profit (Loss) recognized

2021 $0  $0

2022 $0  $0

2023 $220 $50(220-170)

3  Computation of the Revenue and gross profit or loss to be recognized in 2022 (using the percentage of completion )

Percentages of completion

Choose numerator ÷ Choose denominator = % complete to date

Actual costs to date ÷Estimated total costs=%  

2022 $120(40+80) ÷ $200(40+80+80) = 60.00%  

2022

To date Recognized in prior years Recognized in 2019

Construction revenue $132(220*60) $55 $77

 

Less:Construction expense $120(40+80) $40 $80

Gross profit (loss) $12     $15 ($3)

Ultimate Corporation uses a standard cost system for the production of its water ski radios. The direct labor standard for each radio is 0.9 hours. The standard direct labor cost per hour is $7.20. During the month of August, Zanny's water ski radio production used 6,600 direct labor-hours at a total direct labor cost of $48,708. This resulted in the production of 6,900 water ski radios for August. What is Zanny's labor rate variance for August?
a. $2,808 Unfavorable
b. $1,188 Unfavorable
c. $972 Favorable
d. $2,160 Favorable

Answers

Answer:

Direct labor rate variance= $594 unfavorable

Explanation:

Giving the following information:

The standard direct labor cost per hour is $7.20.

During August, Zanny's water ski radio production used 6,600 direct labor-hours at a total direct labor cost of $48,708.

To calculate the direct labor rate variance, we need to use the following formula:

Direct labor rate variance= (Standard Rate - Actual Rate)*Actual Quantity

Actual rate= 48,078/6,600= $7.29

Direct labor rate variance= (7.20 - 7.29)*6,600

Direct labor rate variance= $594 unfavorable

Excellent Printers has contracts to complete weekly supplements required by forty-six customers. For the year 2018, manufacturing overhead cost estimates total $840,000 for an annual production capacity of 12 million pages.
For 2018 Excellent Printers has decided to evaluate the use of additional cost pools. After analyzing manufacturing overhead costs, it was determined that number of design changes, setups, and inspections are the primary manufacturing overhead cost drivers. The following information was gathered during the analysis:
Cost pool Manufacturing overhead costs Activity level
Design changes $ 120,000 300 design changes
Setups 640,000 5,000 setups
Inspections 80,000 8,000 inspections
Total manufacturing overhead costs $840,000
During 2018, two customers, Money Managers and Hospital Systems, are expected to use the following printing services:
Activity Money Managers Hospital Systems
Pages 60,000 76,000
Design changes 10 0
Setups 20 10
Inspections 30 38
When costs are assigned using the single cost driver, number of pages printed, then:__________.
A. Money Managers will likely seek to do business with competitors
B. Money Managers is grossly under billed for the job, while other jobs will be unfairly over billed
C. Excellent Printers will want to retain this highly profitable customer
D. Money Managers is unfairly over billed for its use of printing resources

Answers

Answer:

B. Money Managers is grossly under billed for the job, while other jobs will be unfairly over billed

Explanation:

The single overhead rate would be $ 0.07 per page

Overhead Rate = $ 840,000/ 12 million pages = 0.07 per page.

The other rates  are

design changes  rate = $ 120,000/300= $ 400 per design

Inspections rate = $ 80,000/8000= $ 10 per inspection

Setups  rate = $ 640,000/5000= $ 128 per setup  

Money managers will be under billed for the job as the overhead rates for other costs are higher than the single overhead rate which is $ 0.07 per page.

And if other overhead rates are used other jobs will be over billed.

Using a single overhead rate for 60,000 pages for Money Managers would mean 60,000 * $ 0.07 = $ 4200

Where as if the same job is billed using other overhead rates it would cost

Money Managers   $ 6860 = $ 4000 + $ 2560 + $ 300

Design = $400 * 10 = $ 4000

Setups = $ 128 * 20 = $ 2560

Inspections $ 10 * 30 = $ 300

So it is under billed and other jobs over billed.

You have just recieved notification that you have won the $2 million first prize in the centennial lottery. However, the prize will be awarded on your 100th birthday, 76 years from now.

Requried:
What is the present value of your windfall if the appropriate discount rate is 8%?

Answers

Answer:

$5,765.35

Explanation:

Preparation of the present value of your windfall if the appropriate discount rate is 8%

To find the present value we are going to use this formula

PV = FV / (1 + r)^t

Where,

FV=$2,000,000

r=8%

t=76

Let plug in the formula

PV = 2,000,000 / (1 + .08)^⁷⁶

PV = $2,000,000 / (1.98)^⁷⁶

PV=$2,000,000/346.90

PV=$5,765.35

Therefore the present value will be $5,765.35

The following data relate to factory overhead cost for the production of 10,000 computers:
Actual: Variable factory overhead $262,000
Fixed factory overhead 90,000
Standard: 14,000 hrs. at $25 350,000
If productive capacity of 100% was 15,000 hours and the total factory overhead cost budgeted at the level of 14,000 standard hours was $356,000, determine the variable factory overhead controllable variance, fixed factory overhead volume variance, and total factory overhead cost variance. The fixed factory overhead rate was $6.00 per hour.

Answers

Answer:

1.-4,000 Favorable

2.6,000 Unfavorable

3.$2,000 Unfavorable

Explanation:

1.Preparation to determine variable factory overhead Controllable variance

Using this formula

Variable factory overhead Controllable variance=Standard hours * rate- Fixed factory overhead rate

Let plug in the formula

Variable factory overhead Controllable variance=14,000 * 25.00- 6.00= 266,000

Variable factory overhead Controllable variance = 262,000- 266,000

Variable factory overhead Controllable variance= -4,000 Favorable

2. Preparation to determine fixed factory overhead volume variance .

First step is to deduct Productive capacity hours from total factory overhead cost standard hours

15,000 hours -14,000 hours =1,000 hrs

Second step is to find the fixed factory overhead volume variance

Using this formula

Fixed factory overhead volume variance=Un-used Numbers of hrs*Fixed factory overhead rate

Let plug in the formula

Fixed factory overhead volume variance=1,000 hrs*$6.00

Fixed factory overhead volume variance= 6,000 Unfavorable

3. Preparation to Determine total factory overhead cost variance

Variable Factory Overhead Controllable Variance $4,000 Favorable

Fixed Factory Overhead Volume Variance $6,000 Unfavorable

Factory Overhead Cost Variance$2,000 Unfavorable

A stock has an expected return of 11.85 percent, its beta is 1.24, and the expected return on the market is 10.2 percent. What must the risk-free rate be? (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.)

Answers

Answer:

The risk free rate is 3.325%

Explanation:

The required rate of return or cost of equity of a stock can be calculated using the CAPM. The CAPM estimates the required rate of return of a stock based on three factors- risk free rate, stock's beta and the market risk premium. The equation of required rate of return under CAPM is,

r = rRF + Beta * (rM - rRF)

Where,

rRF is the risk free raterM is the return on market(rM - rRF) gives us the risk premium of market

We already have the values for r, Beta and rM. Plugging in these values in the formula, we calculate the rRF to be,

Let rRF be x.

0.1185 = x + 1.24 * (0.102 - x)

0.1185 = x + 0.12648 - 1.24x

1.24x - x  =  0.12648 - 0.1185

0.24x = 0.00798

x = 0.00798/0.24

x = 0.03325 or 3.325%

Other Questions
What the answer to the question If a circle has a diameter with endpoints of (-3, 0) and (5, 4) then the equation of the circle is? Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code. B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein. C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein. D) Both B and C are possible outcomes. g A spontaneous process is one in which: A. releases a large amount of heat B. may happen (is possible) C. will rapidly approach equilibrium D. will happen quickly Based on the function F(x) = x^4 - 3x^3+ x^2 +2 and the graph of G(X) below,which of the following statements is true? The goal of a statement of purpose is: 62(1+2) isn't that should be 1 , cause in the calculator it said 9 but the order is the parenthisis/brakets first ?? so it should be like 2 times 3 then 66 which gives 1 . Which of the following pitches is a non-chord tone for the I chord in G major? - G - B - A - D When a negative amount is in the base period and a positive amount is in the analysis period (or vice versa), a meaningful percent change cannot be calculated.A. TrueB. False A cookie recipe requires 3 teaspoons of baking soda for 36 cookies. If the baker would like to make 480 cookies, how much baking soda will be required? a13.33 teaspoons b12 teaspoons c40 teaspoons d108 teaspoons The flesh of infants may be used asgloves and summer boots Swift objects to eating girls as old as 14because they would serve better asbreeders, and because people wouldobject that it is "a little bordering oncruelty"Although there are many suffering"aged, diseased," or injured people,nothing needs to be gone for thembecause they are already dying "as fastas can be reasonably expected"Poor Irish tenants, who have already soldtheir crops and cattle to pay the rent,will now be able to pay by selling theirchildren Jerry solved the system of equations. x minus 3 y = 1. 7 x + 2 y = 7. As the first step, he decided to solve for y in the second equation because it had the smallest number as a coefficient. Max told him that there was a more efficient way. What reason can Max give for his statement? The variable x in the first equation has a coefficient of one so there will be fewer steps to the solution. The variable x in the second equation has a coefficient of 7 so it will be easy to divide 7 by 7. The variable y in the second equation has a coefficient of 2 so it will be easy to divide the entire equation by 2. The variable x in the second equation has the largest coefficient. When dividing by 7, the solution will be a smaller number. Probability of landing on even # on a spinner; probability of rolling an odd # on a die The amount of flow through a solenoid valve in an automobile's pollution-control system is an important characteristic. An experiment was carried out to study how flow rate depended on three factors: armature length, spring load, and bobbin depth. Four different levels (low, fair, moderate, and high) of each factor were chosen, and a single observation on flow was made for each combination of levels.A) The resulting data set consisted of how many observations?B) Is this an enumerative or analytic study? Explain. Simplify each expression. 6mn3 -mn2 + 3mn3 +15mn2?? Read the following excerpt. The journalist spent a year researching the foreign government's sanctions. Finally, it was time to synthesize all of the relevant information that he had learned. His editor asked him to write a comprehensive article for the first piece in the series that was sure to win awards, inform the public, and elicit significant change in foreign policy. Using the context, the word "elicit" meansdeclarecausecriticizeend y=tan(x-30) period and amplitude which platonic solid has eight faces that are equilateral triangles? A, dodecahedron, B, octahedro, C, tetrahedron, D, icosahedron Families USA, a monthly magazine that discusses issues related to health and health costs, survey 19 of its subscribers. It found that the annual health insurance premiums for a family with coverage through an employer averaged $10,800. The standard deviation of the sample was $1095. A. Based on the sample information, develop a 99% confidence interval for the population mean yearly premiumB. How large a sample is needed to find the population mean within $225 at 90% confidence? (Round up your answer to the next whole number.) how to see the answer