Islam is the most common religion in Central Asia. Where did Islam first come from?
A.
Africa
B.
the Middle East
C.
Europe
D.
North America

Answers

Answer 1

Answer:

B. the middle east

Explanation:

Because islam first came from a place called Mecca. Mecca is in the continent middle east

Answer 2

Answer:

The Middle East

Explanation:

The Muslim community spread through the Middle East through conquest, and the resulting growth of the Muslim state provided the ground in which the recently revealed faith could take root and flourish.


Related Questions

I need help it due today please!

Do you think there are parts of the country today that are still mad about the Civil War ?

Answers

Yes. We have ambulances and hospitals. We prize America as a land of opportunity. We begin summer with a tribute to fallen soldiers. We let technology guide how we communicate.

Yes for sure there is. there will never not be someone mad that something didn’t go there way. There are still people out there that think that hitler should have won

Worth 20 points!!!Which statements accurately describe the impact of social media in the modern world?


Choose all answers that are correct.


The country with the most social media users is China.


Social media is taking up more and more of people’s time.


The fastest growing group of users is people 55 and older.


One area not affected by social media is politics in developing countries.

Answers

Answer:

Social Media is taking up more and more of peoples time.

Explanation:

Answer:

The answers are:  

Social media is taking up more and more of people’s time.

The country with the most social media users is China.

Which of the following was the main goal of the Know-Nothing Party?
A. Abolishing slavery

B. Limiting the rights of immigrants
C. Preventing westward expansion

D. Lowering tariffs and taxes

Answers

The answer is limiting the rights of immigrants.
Hope that helps!

How did the Japanese military slowly gain power over the civilian government in Japan?

Answers

Answer: he Great Depression struck, causing the government to be blamed. Soon the militarists gained control through gained support. Their plan was to restore traditional control of the government to the military.

Explanation:

Hi can anyone help me ?

Answers

Answer:

At any one moment we are under FederalState Local Example: Getting arrested and in possession of an illegal substance, you are under the local, state, and federal laws and will be punished to the fullest extend of the law

Ray has six hours before he goes to bed on a school night. He plans to spend an hour surfing the Internet, two hours playing his favorite game, two hours watching TV, and one hour doing his homework. However, some of the math problems in his homework are extremely difficult, and it will take him more than two hours to finish them. He knows his teacher won’t give him any credit for the work unless it's completely finished, and it's important that he get a good grade in the class. Which of these options for dealing with this situation are a trade-off of Ray’s time?

Answers

Answer:

He will spend only one hour on homework and leave out what he can’t finish

He will spend one extra hour on homework and give up watching TV

He will finish his homework while he is watching TV

He will play his favorite game for one hour and do homework for two hours

He will ask his brother to help him with his homework

People often engage in a lot of things. The options for dealing with this situation are a trade-off of Ray’s time is that;

He will spend one extra hour on homework and give up watching TV

He will play his favorite game for one hour and do homework for two hours

What is a trade-off situation?

This is known as a kind of scenario where a person have and must choose between or equal two things that are said to be opposite or cannot be done at the same time.

It refers to something that one is not inspired to do or do not want but must accept it so that one can  have something that you want.

Learn more about  trade-off situation from

https://brainly.com/question/7072776

What wiped out many of the Native populations?

Answers

Answer:

Small pox. common cold, and the flu.  Give me brainliest please :D

Explanation:

They were diseases they hadnt seen before and they hadnt had an imune system strong enough

Answer: When the Europeans arrived, carrying germs which thrived in dense, semi-urban populations, the indigenous people of the Americas were effectively doomed. They had never experienced smallpox, measles or flu before, and the viruses tore through the continent, killing an estimated 90% of Native Americans.

Explanation:

Have great day!!!

In the Virginia General Assembly, what must happen directly before
voting on a bill?

Answers

Answer:

i really don't know

Explanation:

didn't learn it

true or false
the national road was was the chief access to the backcountry settlements from virginia to georgia

Answers

Answer:

true

Explanation:


What vocabulary terms means the national or central government that is
in charge of the states. *
Federal
Republic
Democracy
Popular Sovereignty

Answers

Popular sovereignty

Identify and explain-a-significant decision-made by George Washington as president that had immediate
consequences for the United States of America.

Answers

Explanation:

1. General Washington decided not to impose a battlefield strategy on his field commanders. The general consensus among historians is that Washington was a mediocre military strategist at best. However, a recent study in the Academy of Management Journal cast some doubt on that consensus.

The study found that in large, multifaceted enterprises, the biggest threat to speedy strategic decision making is “strategic imposition” from the mothership. Historians still debate whether Washington favored a “Fabian strategy” of quick attacks and even quicker retreats, or a more traditional strategy of fighting major head-to-head battles. The discrepancy comes largely from the fact that he imposed neither strategy. His young and mostly inexperienced commanders were free to employed either one. At a high level, Washington decided that the Colonies would always have a standing army in the field that was as well-trained as possible under the time and budget constraints, rather than a hodgepodge of untrained militia men roaming the countryside. Beyond that general strategic direction, and some basic tactical goals, Washington let his young leaders make their own strategic decisions in the field—capitalizing on the speed and agility advantage they had over their larger and better-trained competitors.


2. Washington decided to oversee renovations on Mount Vernon during the most tenuous year of the Revolution. Imagine leading a comically outnumbered, under-resourced, and woefully unskilled force where the majority of your teenaged army marches throughout the New England snow barefoot because you can’t afford to buy them shoes in a war that—if lost—could send you to the gallows for treason. Then in the midst of all this, staying up late at night sending letters home describing the right color of the new curtains in the living room. Historians are still puzzled as to why throughout 1776, Washington continued micromanaging his home renovations from the front lines of the most difficult, dangerous, chaotic, and important leadership position of his life. Perhaps the only thing more puzzling is how he maintained confidence and composure in spite of knowingly facing such overwhelming odds.

Modern psychology might provide a clue to this riddle. Psychologists at UCLA and NYU discovered that after making a benign decision such as where to go on vacation and then making a basic plan for executing that decision, people showed significantly higher self-esteem and optimism, while feeling less vulnerable to completely uncontrollable risks such as earthquakes. In other words, making even a small decision on something completely unrelated to your primary focus can shift you into a confident, empowered mindset.

One of Washington’s greatest assets during the American Revolution and his presidency afterward, was his ability to inspire the confidence and alignment needed to gather political and financial support from so many diverse stakeholder groups including the Continental Congress, the American public, the French government, and his own soldiers. Perhaps this peculiar, yet easily controlled side project was precisely what enabled Washington to stay in the confident, decisive mindset that his leadership role demanded.

3. Washington Decided not to make himself supreme ruler of the United States. After risking his life to lead the American Revolution—often bravely putting himself directly in the line of fire—Washington shocked the entire world by voluntarily returning all his powers to the American people and their elected representatives. It was a decision that even led his recently defeated foe, King George III, to comment that Washington was “the greatest character of his generation.” We will never know whether this decision was driven by altruism or a self-interested desire to be adored by history. What we do know is that decision aligned perfectly with the pattern of decisions Washington established throughout his lifetime. He was an exemplar of what Wharton professor Adam Grant describes as “otherish”—people who are both highly giving and highly self-interested.

Regardless of how pure Washington’s motives may or may not have been, it’s easy to imagine a bright future for a world populated by leaders who treated every decision as an opportunity to reveal the high quality of their character.

Which of the following was an example of appeasement? (7A) the British and the French glving Germany the Sudetenland in 1938 B. the conquest of Poland in 1939 C. the entry of the United States into World War II in 1941 the U.S. Neutrality Acts of 1935 and 1937​

Answers

Answer: An example of appeasement is the infamous 1938 Munich Agreement, in which Great Britain sought to avoid war with Nazi Germany and Fascist Italy by taking no action to prevent Italy's invasion of Ethiopia in 1935 or Germany's annexation of Austria in 1938.

Who has been deaf to the voice of justice

Answers

"They too have been deaf to the voice of justice and of consanguinity. We must, therefore, acquiesce in the necessity, which denounces our Separation, and hold them, as we hold the rest of mankind, Enemies in War, in Peace Friends. (44-45)"

This comes from the paragraph in the Declaration of Independence where Jefferson explains that they tried to compromise with Britain, but were repeatedly ignored. Jefferson's ideals compel him to find a good reason for breaking off of England, while still recognizing the the English are people with rights and deserve to be treated as such.  Instead of using vulgar methods, the author upholds the principles he stated just a few paragraphs ago, that they are all men are equal.

Why do you think that it was important to transport natural resources to the east and Northeast

Answers

Answer:

I think its important to transport Natural Resources to the east and northeast becauseit was needed in order to survive and to sell them to other.

Explanation:

Which of the following was eliminated in 1964 with the passage of the 24th Amendment? B. Federal Taxes A Poll Tax D. Inheritance Tax C. Property Tax​

Answers

Answer:

a poll tax

Explanation:

Poll taxes were eliminated because they’re included in Jim Crow laws making it harder for black people in the south to vote

Following World War II, the United States and the Union of Soviet Socialist Republics dominated a new world order because of powerful armed forces
A) true
B) false

Answers

I’m pretty sure this is true

Prophetstown was the capital of Tecumseh’s ________ of Native Americans.
A) army
B) brigade
C) business
D) confederacy

Answers

Answer: d confederacy

Prophetstown was the capital of Tecumseh’s confederacy of Native Americans. Thus the correct option is D.

What is Prophetstown renowned for?

Prophetstown developed into the largest Native American settlement in the Great Lakes region and played a significant role as a center for culture and religion. Prophetstown gained importance as the hub of the military and political alliance.

In the early 1800s, Tenskwatawa founded Prophetstown as a meeting place for like-minded Native Americans looking to resist the influence of Europeans.

Around Tenskwatawa's teachings, Tecumseh's confederate states developed in the early 19th century among Native Americans in the Great Lakes region of the United States.

Prophetstown is now situated close to the settlement of Battle Ground, northeast of Lafayette, where the Tippecanoe River and the Wabash River converge.

Therefore, option D is appropriate.

Learn more about Prophetstown, here:

https://brainly.com/question/11502615

#SPJ2

why is the middle East always in the news​

Answers

Answer:

"NO OTHER area in the world has so many complex conflicts. Every day in the Middle East there are airstrikes and threats of war or invasions. The region is an area of competition for global powers, such as Russia and the US. ... There are also rivalries, such as Qatar versus Saudi Arabia, that feed conflicts elsewhere."

Explanation:

Answer:

The Middle East has an illustrious past - why are we hearing so much bad news from there now? 15.12.2017. Language & culture ... “In the ancient Near East, power always meant religious power. Every ruler was considered to be ordained by

The right to a speedy trial.

Answers

Answer:

6th ammendment

Explanation:

Answer:

its actually "Habeas corpus"

Explanation:

Who was President for most of the Great Depression?​

Answers

Answer:

Franklin D.Roosevelt

Explanation:

HOPE THIS HELPED!

Answer:

Hoover's response

President Hoover and many academics believed that high wage rates would maintain a steady level of purchasing power, keeping the economy turning. In December 1929, after the beginning phases of the depression had begun, President Hoover continued to promote high wages.

Which cultural achievement is credited to the Zapotec civilization?

Answers

Answer:

They built an observatory.

Answer:

A.) they built an observatory

Explanation:

What is one way the executive branch checks the power of the judicial branch¿

Answers

Answer:One way the President checks judicial power is through his ability to appoint federal judges. Since the President is the Chief Administrator, it's his job to appoint court of appeals judges, district court judges, and Supreme Court justices.

Explanation:

The U.S. involvement in World War II led to an increase in federal spending. Which
statement gives one effect of this spending?

A. The government reduced its use of propaganda
B. the unemployment rate increased
C. the government reduced its use of rationing programs
D. The level of industrial production increased.

Answers

Answer:

c

Explanation:

The government spent more money as a result of the United States' participation in World War II, and rationing measures were less frequently used. As a result, choice (C) is the right one.

Why was World War II important?

A global struggle that lasted from 1939 to 1945 was known as World War II, often known as the Second World War and frequently abbreviated as World War II.

The vast majority of the world's nations, including all of the great powers, fought as members of two rival military coalitions: the Allies (led by the Soviet Union, United Kingdom, United States, and China) and the Axis (lead by Germany, Japan, and Italy).

The line between civilian and military resources became fuzzier as more participants contributed their economic, industrial, and scientific resources to an all-out conflict.

The only two nuclear weapons ever used in combat were delivered by aircraft, which also played a significant part in the strategic bombardment of population centers. The greatest human battle in history, by far, was World War II.

Learn more about World War II, from :

brainly.com/question/7745710

#SPj6

The passage of the Social Security Act was the first time the federal government took direct responsibility for many citizens' economic well-being
True
False
Ture or false?

Answers

True hsbsbshsbssbsbssb

SOMEONE HELP PLEASE WILL GIVE BRAINLIST IF ANSWER ALL 4 questions please

Answers

Answer:

1. A tariff is a tax or duty to be paid on a particular case of imports or exports. So b.

2. I THINK it would be d. but I could be wrong.

3. I think it would be b.

1: B

2: A

3: B

4: B

Hope this helps you :)

Why did the Kansas-Nebraska Act anger many members of the Free-Soil Party?
They did not want slavery to spread into the free states.
They were afraid the territories would vote against slavery.
They were afraid the territories would be filled with slaveholders.
They opposed the Missouri Compromise, which the act supported.

Answers

Answer:

The answer you are looking for is c

Explanation:

ΔThey were afraid the territories would be filled with slaveholders.

Answer:

The Answer Is C!

Explanation:

Have A Nice Day!

Agricultural skills, industrial crafts, language, food and celebrations are examples of-
PLS ANSWER QUICKKK

Answers

Answer: the ways immigrants influenced texas

Explanation:


Fill in the blanks: The Monroe doctrine stated that president Monroe would not allow any country from the________
Hemisphere to colonize land in the _________ Hemisphere

Answers

Answer:

southern

Explanation:

why does people feel embarrassed about their skin color

Answers

Answer:

i dont know

Explanation:

not sure

Answer:

I don't feel embarrassed of my skin color

What was happening in Spanish Florida?

Answers

Answer:

Going well actually

Explanation:

Answer:

Spanish Florida was the first major European land claim and attempted settlement in North America during the European Age of Discovery. La Florida formed part of the Captaincy General of Cuba, the Viceroyalty of New Spain, and the Spanish Empire during Spanish colonization of the Americas. While its boundaries were never clearly or formally defined, the territory was initially much larger than the present-day state of Florida, extending over much of what is now the southeastern United States, including all of present-day Florida plus portions of Georgia, Alabama, Mississippi, North Carolina, South Carolina, and Louisiana. Spain's claim to this vast area was based on several wide-ranging expeditions mounted during the 16th century. A number of missions, settlements, and small forts existed in the 16th and to a lesser extent in the 17th century; they were eventually abandoned due to pressure from the expanding English and French colonial settlements, the collapse of the native populations, and the general difficulty in becoming agriculturally or economically self-sufficient.

Explanation:

If it is present day then I do not know. please mark brainliest and I will give you a Dino Nuggie :)

Other Questions
Gary wants to buy a bike that is 30% off. The original price is $109.56. What is the amount of the discount? Loss of voluntary control over urination is calledO dialysisO incontinenceO neurogenic bladderO urgencyPrevious what is one sixth of the product of four and nine table saws you can use with __ or __ but not both at the same time HELP PLS What is the value of the x variable in the solution to the following system of equations? (1 point)4x + 2y = 6x - y = 3O-15-22 Do violence and alcohol have anything to do with each other? If so, what do they have in common? If they don't have anything in common, tell me why? (SAT Prep) Find the value of x. He math team does practice drills that each last hour. In February the team did practice drills for a total of 24 hours. How many practice drills did the math team do in feburary PLEASE ANSWER FAST!!!!Explain why the U.S. decided to change its goal from protecting western settlements to attacking Native Americans and forcing them onto reservations. i just asked my best friend if she talk ab me behind my back bc i kinda have trust issues and i dont get what she means by this.... do yall have any idea? Write and solve an equation to determine the value of x in the figure. a. 3x 84; 252 b. 3x 84; 28 c. 3x 84; 84 d. 3x 84; 81 Find the value of x. Plsssssss Help!!!!Look at the map. How might the Gupta empire have been able to flourish through trade? Identify geographic features to support your answer. transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC Hey can somebody get this for me been stuck for five min Select the correct answer from the drop-down menu.What is implied by the underlined section in the passage?Caesar's statement to Brutus implies that imagine being in spanish course on edmentum its pretty hard not gonna kap features of liberalism theory A square has side lengths as shown in the picture and a perimeter of 54.8 centimeters. Write an equation to find the measure of each side length. On January 1, Year 1, a contractor began work on a $3.2 million construction contract that is expected to be completed in 3 years. The contractor concludes that it is appropriate to recognize revenue over time using the input method based on costs incurred (cost-to-cost method). At the inception date, the estimated cost of construction was $2.4 million. The following data relate to the actual and expected construction costs: Year 1 Year 2 Year 3 Costs incurred $720,000 $1,170,000 $1,110,000 Expected future costs $1,680,000 $810,000 $0 For this long-term construction contract, the contractor needs to calculate the estimated dollar values of the revenue and gross profit (loss) to be recognized each year. Complete the contractor's long-term construction contract using the information above. Write the appropriate amounts in the associated cells. Indicate losses by using a leading minus (-) sign. Round all amounts to the nearest dollar. If no entry is necessary, enter a zero (0). Revenue Gross profit (loss) Year 1Year 2