Mathematics Middle School

in 1-3 sentences, explain how we know that the the volume of a pyramid is V=1/3Bh

Answers

Answer 1

Answer:

The formula for finding the volume of a pyramid is V= lwh/3. Taking this into consideration, the length times the width times the height must be one, so we put that over three.

Step-by-step explanation:

Answer 2

The formula for the volume of a pyramid V=1/3Bh can be derived by dividing the pyramid into three identical triangular prisms, each with height h and base area B, and then calculating the total volume of the three prisms.

What is volume?

Volume is defined as the mass of the object per unit density while for geometry it is calculated as profile area multiplied by the length at which that profile is extruded.

Here,
The volume of a pyramid can be derived by considering that a pyramid is made up of a series of triangular cross-sections stacked on top of each other. The area of each triangular cross-section (the base) is given by the formula B = 1/2bh, where b is the base length and h is the height of the triangle. By multiplying the base area B by the height h of the pyramid and then dividing by 3 (to account for the triangular shape), we get the formula V = 1/3Bh for the volume of a pyramid.

Learn more about Volume here:
https://brainly.com/question/1578538

#SPJ3

Related Questions

.‍​ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ‍ ​

Answers

Answer:

52 fl oz are in 6.5 cups

Step-by-step explanation:

8 fl oz is equal to 1 cup so just multiply  8 by 6.5

the answer above me is right :)

Type "me"if you're religion is Christian.​

Answers

Not me. *laughs in atheist*

Answer:

me

Step-by-step explanation: well my mom is

A penguin is standing 3 feet above sea level and then
dives down 10 feet. What is its depth?

Answers

Answer:

7 feet below sea level

Step-by-step explanation:

he was at 3 then you subtract 10 feet because he dives.

Answer:

-7 feet or 7 feet below sea level

Step-by-step explanation:

We can find the absolute value to solve this problem.

There are two ways that we can solve this:

Solution 1: |3 - 10| = 7

Solution 2: 10 - 3 = 7

Hope this helped!

Write the ratio as a fraction in simplest form and explain it's meaning.



There are 16 girls and 20 boys in the school band. What is the ratio of girls to boys?



The ratio in simplest form is Blank 1. For every Blank 2 girls there are Blank 3 boys in the band.

Answers

Answer:4/5

Step-by-step explanation:

im not so sure but im pretty sure. it would be 16:20 and that simplified would be 4:5 so ig if thats what were supposed to do then it would be 4/5!

PLZ I WILL GIVE U BRAINS, HELPPPPPP!!!!!!!!!

Answers

30p-7
-7*-4=28
-7*1=-7
28+2= (you add them because they both have the same variable)

Answer:

−26p− 7

Step-by-step explanation:

is this expression fully simplified? Explain
4x2 + 10 - x - 6x3

Answers

Answer:

-x

Step-by-step explanation:

no it’s not. fully simplified would be -x

Please Help! Will give brainliest.

Answers

Answer:

it will not show me the pic????

Step-by-step explanation:

ok so what is 60+48j its distributive property

Answers

In distributive property, the answer would be 12(5 + 4j).

Factor 12 out of 60 + 48j

12( 5 + 4j)

Why do you think this wall was built in Berlin, Germany after WWII?

Answers

To keep western “fascist” from entering west germany and undermining the socialist state also served the objective of steeming mass defections from east to west
The official purpose of this Berlin Wall was to keep Western “fascists” from entering East Germany and undermining the socialist state, but it primarily served the objective of stemming mass defections from East to West.

I NEED HELP ON NUMBER 6 PLEASE A AND B, ITS

Answers

P-111
A-90???

I have no clueeeee

i need the answer for this

Answers

Answer:

A

Step-by-step explanation:

Answer:

A. 12%

Step-by-step explanation

There is a total of 25 people in the class only 3 people have a family household of 7 or 8 so you would just do 3/25 and that decimal would give you your answer.

5 m
5 m
4 m
8 m
AREA:

Answers

Answer:

27.5

Step-by-step explanation:

First you divide up the shape so there is a square and a triangle. Then you would solve for a square: 5 times 4 and you get 20. Then the triangle which you would do 8-5=3 (so you can get the base) and do 3*5/2= 7.5. Then add the two answers

Answer:

800

Step-by-step explanation:

1. 5*5=25

2. 4*8=32

3. 32*25=800

or --------

1. 5*8=40

2. 5*4=20

3. 40*20=800

(im so sorry if this is wrong, i suck at math-)

A music store is having a clearance sale. All items are discounted by 20%. What is the sale price of a radio that regularly costs $30?

Answers

Answer:

24

Step-by-step explanation:

You would first multiply 20% by $30. Then you would get 6 and subtract 6 from $30.

Answer:

$24

Step-by-step explanation:

Method 1: find 10% of 30 = 3 (just divide 30 by 10)

then double it to make 20% = 6

subtract 6 from 30 to give 24.

Method 2: 20% = 1/5

To find 1/5 of a number, divide it by 5.

30 divided by 5 = 6.

Then subtract 6 from 30 = 24.

Method 3: to decrease a number by 20% multiply it by 0.8.

30 x 0.8 = 24

a+6, when a=2

Help me out please I need help with tests

Answers

Answer:

8

Step-by-step explanation:

If a = 2, you write 2 instead of a.

2 + 6 = 8

Your answer is 8 because 2+6=8

A grocery store buys a pound of coffee for $5.40 and uses a mark-up rate of 25%. Find the selling price.

Answers

Answer:

noah

Step-by-step explanation:

Answer:

Step-by-step explanation:

(1+25/100)5.40

(1.25)5.40

$6.75

the algebraic expression that represents the situation being described. Hector’s dog weighs 15 pounds more than Cesar’s dog, who weighs x pounds. *

Answers

Answer:

x=y+15 .......

Step-by-step explanation:

x is equal to Cesar's dog and y is Hector

At last weekend's football game, 15 out of the first 50 people who entered the field were wearing hats.
If this sample is representative of the 250 people attending the game, about how many of them were probably wearing hats?

A. 65 people

B. 70 people

C. 75 people

D. 80 people

If you can pls explain how you got your answer pls ;-;

Answers

Answer:

C.  75 people

Step-by-step explanation:

50x5=250

15x5 = 75

so, 75 people

Answer: 75 people

Step-by-step explanation: 50x 5 = 250 so 15 x 5 = 75

Plz help me and answer right

Answers

I think it might be 30 but I don’t know
I’m not sure if this is right but I tried...

The Equation you are going to use: P(event)=number of favorable outcomes/total number of possible outcomes

1. Equal to
The probability of rolling a 4 is 1/6. There is 1 favorable outcome and 6 possible outcomes. The frequency of rolling a 4 after 90 times is 15/90 which is equal to 1/6. Therefore equal to.

2. Greater than
The probability of rolling a number less than 4 is 3/6 or 1/2. After 90 times, the outcome was 46/90 which simplified is 23/45. Half of 45 is 22.5 and 23 > 22.5.

3. Less than
The probability of rolling a multiple of 3 is 2/6 or 1/3. After rolling the cube 90 times, the outcome was 24/90 which simplified is 4/15. 1/3 of 15 is 5. 4 < 5. Therefore, less than.

Hope this helps!!!!

PLEASE ANSWER ASAP!!!
Consider the following expression.
3b+9a+5+2a
Select all of the true statements below.

3b is a factor.

5 is a constant.

3b is a coefficient.

3b is a term.

9a and 9a are like terms.

None of these are true.

I do mark Brainlyest

Answers

Answer:

3b is a factor, 5 is a constant, 3b is a term, 9a and 9a are like terms.

Step-by-step explanation:

i believe this is a trick none of them are true

"A curtain manufacturer uses a 90-yard roll of material to make 77 identical curtains. There was 7.75 yards of material left over.

How many yards were needed for each curtain?"

this is what I meant lol

Answers

Answer:

1.06818181 there you go

1.06818181 hehehehehe

An airplane is traveling at a constant speed of 600 miles per hour. Which graph could represent that motion?

Answers

Answer:

b

Step-by-step explanation:

2. The cost of 8 jars of jalepenos is $23.92. Find the unit price, then find the cost of 10 jars of jalepenos. (PLEASE SHOW YOUR WORK OR EXPLAIN HOW YOU DID IT ITS FOR A GRADE)

Answers

Answer:

23.92 / 8=$ 2.99 each unit

$2.99 x 10= $ 29.90

Step-by-step explanation:

23.92 divided by 8=2.99

2.99x10=29.9

The answer is 29.9

HELP PLEASE!!! A flower bed is in the shape of a triangle, with a base of 15 feet and a height of 9 feet. What is the area of the flower bed?

24 square feet
32.5 square feet
67.5 square feet
135 square feet

Answers

Answer:

C) 67.5 square feet

Step-by-step explanation:

the equation for finding the area of a triangle is height times the base divided by 2. so it would be 15/2 then multiplied by 9

Answer: 67.5 square feet

Area of triangle equation is :
(Base x height) /2

15 x 9 = 135

135/2= 67.5

A circle has a circumference of 16π yards. Find the area in terms of π (pi).

Answers

64 pi. Since the formula for the circumference of a cirlcle is: pi x diameter. The diameter of the circle would be 16. And the radius of that would be 8 since its half of 16. The formula to find the area is: pi x radius squared. So 8 squared pi would be 64 pi.

64 pi is the answer if I’m correct

Select all ordered pairs that are solutions of y=3x−1.

1: (1,3)

2: (3,8)

3: (7,17)

4: (10,29)

Answers

Step-by-step explanation:

The correct options are

2. (3,8)

4. ( 18 , 29 )

Hope it will help :)

I only know that it is number 2

Your teacher is selecting class partners by drawing names out of a bag. There are 12 girl's names and 10 boy's names. What is the probability that she selects a boy's name followed by a girl's name (without replacement)?

A) 20/77

B) 30/121

Answers

The answer would be A)20/77.
The reason is that without replacement it would go (10/22)*(12/21)=0.2597
You can do the easy route I did then do (20/77) which would also give you 0.2597.
The answer is exactly A there is not other choises make sense

Deposition does NOT occur

A. as a glacier melts.

B . as rocks move downhill due to gravity.

C . when a river empties into the ocean.

D . as calcite dissolves from limestone.

PLZ HELP WILL MARK BRAINLIEST

Answers

Answer:

D

Step-by-step explanation:

Not A because it has rocks in it

Not B because thats clear

Not C same reason for B

Yes D because it dissolves

I think it’s A. But not sure

At school, 19 percent of the students wore red shirts on Valentine’s Day. There are sixteen classes in the school with twenty-two students in each class. How many students wore red shirts on Valentine’s Day?

Answers

66% of the students wore red on Valentine’s Day

▓ What is 4,907 x 5,560? ▓

Answers

Answer:
27,282,920

Step by Step:
4,907 x 5,560

Alysa is solving the question below
y=3x-12
y=-2x+8
what step should she do first when using the substitution method
A. add 8+-12
B. write 3x-12=-2x+8
C. move the x terms to the left side of the equal sign
D. add y+y

Answers

Answer:

Step-by-step explanation:

Since y=y for a solution to the system of equations she should just solve

3x-12=-2x+8

Other Questions
Which is the dominantmouth shape for emojis inthe picture below?How do you know?Smiley = MFrowny = mSchilly ScienceSMILEYFROWNY Gary wants to buy a bike that is 30% off. The original price is $109.56. What is the amount of the discount? Loss of voluntary control over urination is calledO dialysisO incontinenceO neurogenic bladderO urgencyPrevious what is one sixth of the product of four and nine table saws you can use with __ or __ but not both at the same time HELP PLS What is the value of the x variable in the solution to the following system of equations? (1 point)4x + 2y = 6x - y = 3O-15-22 Do violence and alcohol have anything to do with each other? If so, what do they have in common? If they don't have anything in common, tell me why? (SAT Prep) Find the value of x. He math team does practice drills that each last hour. In February the team did practice drills for a total of 24 hours. How many practice drills did the math team do in feburary PLEASE ANSWER FAST!!!!Explain why the U.S. decided to change its goal from protecting western settlements to attacking Native Americans and forcing them onto reservations. i just asked my best friend if she talk ab me behind my back bc i kinda have trust issues and i dont get what she means by this.... do yall have any idea? Write and solve an equation to determine the value of x in the figure. a. 3x 84; 252 b. 3x 84; 28 c. 3x 84; 84 d. 3x 84; 81 Find the value of x. Plsssssss Help!!!!Look at the map. How might the Gupta empire have been able to flourish through trade? Identify geographic features to support your answer. transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC Hey can somebody get this for me been stuck for five min Select the correct answer from the drop-down menu.What is implied by the underlined section in the passage?Caesar's statement to Brutus implies that imagine being in spanish course on edmentum its pretty hard not gonna kap features of liberalism theory A square has side lengths as shown in the picture and a perimeter of 54.8 centimeters. Write an equation to find the measure of each side length.