If anyone knows please help me

If Anyone Knows Please Help Me

Answers

Answer 1

Answer:

Step-by-step explanation:

Standard form of a circle is given by,

(x - a)² + (y - b)² = r²

Here, (a, b) is the center and 'r' is the radius of the circle.

For a circle having center (8, -4) and radius r = 1

Equation of the circle will be,

(x - 8)² + (y + 4)² = 1²

(x - 8)² + (y + 4)² = 1

Option (1) is the answer.

Question (2)

Circle with the center (-1, 0) and a point (2, -4) on it,

Radius of the circle = Distance between the center and the given point on                                         circumference

                                = [tex]\sqrt{(x_1-x_2)^2+(y_1-y_2)^2}[/tex]

                                = [tex]\sqrt{(-1-2)^2+(0+4)^2}[/tex]

                                = [tex]\sqrt{9+16}[/tex]

                                = 5

Therefore, equation of the circle will be,

(x + 1)² + (y - 0)² = 5²

(x + 1)² + y² = 25


Related Questions

Help pls I’ll give brainliest to whoever replies first and to whoever replies accurately

Answers

13!

Explanation:
The ratio is 1:4
52 represents 4.
If you divide 52 by 4, you get 13!

!!!!!!please solve!!!!!

Answers

Answer:

first one x=4

second one x=3

Step-by-step explanation:

<3

Answer:

1. True

2. True

Step-by-step explanation:

So we are playing with variables here, lets look at 1.

5x + 9 = 29 if x = 4

This means that if x equals 4, would it make the equation true? Let's find out :

Substitute :

5(4) + 9 = 29

20 + 9 = 29

This is true, let's do the same for 2. :

7x - 8 = 13 if x = 3

7(3) - 8 = 13

21 - 8 = 13

This is also true.

What numbers multiply to make 90 and adds to -19?

Answers

Answer:

-10,-9

Step-by-step explanation:

Answer:

We know that the factors of the number 90 are 1, 2, 3, 5, 6, 9, 10, 15, 18, 30, 45, 90. Now, to find the sum of the factors, add all the numbers, you will get a total of 234.

Step-by-step explanation:

a number d minus 2 is less than -1 as an inequality

Answers

Answer:

(d-2) <-1

Step-by-step explanation:

The number be d. d minus 2 means (d-2).

(d-2) is less than -1.

It means,

(d-2) <-1

It is the required inequality.

So,

Adding 1 both sides.

d-2+1 <-1+1

d-1<0

or

d<1

Hence, this is the required solution.

HELP FAST FAST FAST FAST PLS ILL LOVE YOU FORVER. Greta is putting a 20 foot fence around her pool. She uses all the border to make four sections that are the same length. Which expression does NOT equal the length of one of these sections in feet?

Answers

Answer:

20 over 4 llllllllll

help please !!!!!!!!!!!!!!!!!!!​

Answers

2% and 0.12 as the second answer

Answer:

Step-by-step explanation:

20 percent

0.12

Mr. Voelz estimates that he will spend $10 on concessions at the basketball game, He actually spends $15. What is the percent error?

PLEASE ANSWER

Answers

Answer:

.........................................................................................................................................................................

Step-by-step explanation:

what is 8/3y=5/6x-2 in standard form?

Answers

Answer:

6x + 3y = 3

I hope that this helps

Answer:

5x-16y=12

Step-by-step explanation:

Ax+By=C

FIND the LCD (6)

MULITPLY BOTH SIDES BY 6

6(8/3Y)=6(5/6X-2)

An item has a listed price of 35$ if the sales tax rate is 3% how much is the sales tax in dollars

Answers

Answer:

$1.05

Step-by-step explanation:

3% of 35 = 0.03 × 35 = 1.05

Solve for q if 5q-21/14=1

Answers

Step 1: Simplify both sides of the equation.

Step 2: Add 3/2 to both sides.

Step 3: Divide both sides by 5.

Answer:

q=0.5 or 1/2

Step-by-step explanation:

5q-21/14=1

add 21/14 to both sides

5q=2.5

divide both sides by 5

q=0.5 or 1/2

A rectangle has an area of 9 and 5/8 square cm. If the length of the rectangle is 3 and 1/2 cm, what is the width of the rectangle?

Answers

Answer:

2 and 3/4 cm

Step-by-step explanation:    2 and 3/4 cm x 3 and 1/2 cm = the answer

15/3 x 2/2= in fraction someone please help fast I’m going to get in trouble help help on fraction

Answers

Answer

30/6

Step-by-step explanation:

you need to multiply 15 x 2 and 3 x 2 because 2 is your least common denominator and 2/2 is 1

sorry if that didn't make any sense

Solve m1 and m2 In the diagram

Please help me solve Im so confused

Answers

Answer:

m<1=117

m<2=99

Step-by-step explanation:

Answer:

Angle 1 is 117 degrees.

Angle 2 is 59 degrees.

Step-by-step explanation:

Let angle 1 be x, and angle 2 be y.

By the exterior angle theorem, x + 21 = 138, so x = 138 - 21 = 117.

Again, by the exterior angle theorem, 79 + y = x = 138, so y = 138 - 79 = 59.

A recipe for a fruit drink calls for 2 cups of fruit juice for every 5 cups of water. Look at each drink mix. Does each drink mix follow the recipe?

4 cups of fruit juice and 10 cups of water. Yes. No.

0.5 cup of fruit juice and 1 cup of water. Yes. No.

1 cup of fruit juice and 2.5 cups of water. Yes. No.

7 cups of fruit juice and 17 cups of water. Yes. No. ​

Answers

1. Yes
2. No
3. Yes
4.no

Answer:

A. Yes

B. No

C. Yes

D. No

Step-by-step explanation:

A and C has an equivalent ratio.

B and D do not.

2:5 x2 = 4:10

Because if we multiply 2 on both the 2 cups of fruit juice and the 5 cups of water we'll get

4:10 which is the ratio of A

If we divide both the 2 cups of fruit juice and the 5 cups of water with 2 we'll get...

2 ÷ 2 = 1

5 ÷ 2 = 2.5

1:2.5 is the ratio for C.

So both C and A are correct

The rest, B and D, are not equivalent.

PLS ANSWER QUICK

Select the letter of the correct answer.
A baseball has a circumference between 9 and 9.25 inches. What is its radius? Choose the
closest answer
Hint
A Between 1.43 in. and 1.47 in.
B Between 2.86 in. and 2.95 in.
C Between 2.64 in. and 2.71 in.
D Between 1.32 in. and 1.36 in.

Answers

Answer:

A Between 1.43 in. and 1.47 in.

Step-by-step explanation:

If the circumference is between 9 and 9.25 inches, and we know that circumference equals 2 * pi * radius, we can solve to find that the radius equals the circumference divided by 2pi. So we get between 1.43 in and 1.47in

HI i need help i will give brainliest to correct answer.

Answers

Answer:

Top picture: 1/3

middle picture: 1

bottom picture: 1/2

Step-by-step explanation:

rise over run

Sara makes and sells bracelets. She bought material for $28.50 and used it all to make 15 bracelets.

Sara used the equation 15 x minus 28.50 = 99 to determine x, the amount she should charge for each bracelet to make a profit of $99. How much should each bracelet cost?

Answers

Answer: the bracelet should cost at least  $29

Step-by-step explanation:

Answer:

The answer is $8.50 I just took a quiz

Step-by-step explanation:

Find the measure for < LQR

Answers

Answer:

A

Step-by-step explanation:

90 - 12b = - 3b + 63

- 12b + 3b = 63 - 90

- 9b = - 27

- b = - 27/9

-b = -3

b = 3

to find the measure of MQR:

-3*3 + 63 = 54°

to find the measure of LQR:

180 - 54 = 126° + 1 = 127°

 

Answer:  131 degrees

====================================================

Work Shown:

Angles MQX and LQR are vertical angles, so they are equal to one another.

angle MQX = angle LQR

-4a+139 = 4a+123

-4a-4a = 123-139

-8a = -16

a = -16/(-8)

a = 2

Use this to find each angle

angle MQX = -4a+139 = -4*2+139 = 131angle LQR = 4a+123 = 4*2+123 = 131

We get the same value 131 each time, so this confirms we have the correct value for 'a', and it confirms our answer for angle LQR.

Factor completely
6z^4 - 14z^3- 40z^2

Answers

Answer:

Step-by-step explanation:

2z^2(3z^2 - 7z - 20)

2z^2(3z + 5)(z - 4)

whats greater 9.354 or 9.012

Answers

Answer:

9.354

Step-by-step explanation:

Find the m<1
69
71
111
86

Answers

Answer:

69

Step-by-step explanation:

m1 = 180 - (180 - 39 - 30) = 180 - 111 = 69

Your digital camera has a 512 megabyte memory card. You take pictures at two resolutions, a low resolution requiring 4 megabytes of memory per photo and a high resolution requiring 8 megabytes of memory per photo. Write an equation to model the amount of each kind of photo you can take.

Answers

One possible answer is 8H + 4L = 512

=======================================================

Explanation:

H = number of high resolution photosL = number of low resolution photos

H and L are placeholders for positive whole numbers, or 0 could replace either variable.

1 high resolution photo takes up 8 mb of space, so H of them take up 8H megabytes of space.

1 low resolution photo takes up 4 mb of space, so L of them take up 4L megabytes.

Overall, the two types of photos take up 8H+4L megabytes, which is equal to 512 since that's the max capacity. That leads to the equation 8H+4L = 512

----------------------------------

Extra info:

There are other ways to express the equation 8H+4L = 512. We could divide each part by 4 to get 2H+L = 128, but I think this equation loses its descriptive quality in a way. We no longer can see that each high resolution photo takes up 8 megabytes (instead we might mistakenly think only 2 megabytes are used per high resolution photo). A similar mistake may happen with the low resolution photos also.

The equation 2H+L = 128 can be rearranged into L = -2H+128 when solving for L.

where do I put the ( so it can equal 40​

Answers

Answer:

the answer is 4+(2x3)^2

How to solve (with steps)
3 ( x + 2 ) = 9 ( 6 - x )

Answers

Answer: x = 4

Step-by-step explanation:

Distribute the 3 and the 9

[tex]3(x+2)=9(6-x)\\3x+6=54-9x[/tex]

Add 9x to both sides

[tex]12x+6=54[/tex]

Subtract 6 on both sides and simplify

[tex]12x = 48\\x=4[/tex]

Answer:

x=4

Step-by-step explanation:

3 (x+2) = 9 (6-x)

3x + 6 = 54 - 9x

     -6  =  -6

3x = 48 - 9x

+9x        +9x

12x = 48

/12     /12

x = 4

1.
a.
- 12.5-(-12)
Noah said the value of this expression is -0.5. Is he correct? Explain or show your reasoning to prove
your answer.

Answers

Answer:

Yes he is correct!!!!!!

Determine if the expressions 100 divided by (25 divided by 5) and (100 divided by 25) divided by 5 are equivalent. If so, tell what property is applied. If not explain why.

Answers

Answer:

They aren't equivalent because when using P.E.M.D.A.S you solve what is in the parenthesis first. After you solve what is in the parenthesis the two expressions are completely different.  

Step-by-step explanation:

100/(5)=20    (4)/5= .8

The requried results of the two expressions are different (20 and 0.8), the expressions are not equivalent.

Expression 1:
100 ÷ (25 ÷ 5)

Evaluate the expression inside the parentheses.

25 ÷ 5 = 5

Replace the expression inside the parentheses with its result:

100 ÷ 5

Perform the division:

100 ÷ 5 = 20

So, the result of Expression 1 is 20.

Expression 2:
(100 ÷ 25) ÷ 5

Evaluate the expression inside the first set of parentheses.

100 ÷ 25 = 4

Replace the expression inside the first set of parentheses with its result:

4 ÷ 5

Perform the division:

4 ÷ 5 = 0.8

So, the result of Expression 2 is 0.8.

Since the results of the two expressions are different (20 and 0.8), the expressions are not equivalent.

The reason why they are not equivalent is due to the order of operations. In Expression 1, we first divide 25 by 5 and then divide 100 by the result, while in Expression 2, we first divide 100 by 25 and then divide the result by 5.

Learn more about division here:

https://brainly.com/question/1296833

#SPJ6

Which of the following could represent the question: How many 4/9s are in 6/5 as a multiplication equation?

x*4/9=6/5
x*6/5=4/9
6/5*4/9=x
4/9*6/5=x

Answers

Answer:

Select the third answer listed which states: 6/5 * 9/4

Step-by-step explanation:

To find how many of a quantity x are in another quantity y, we normally divide in the following fashion:

y divided by x = y ÷ x = y / x

Then we do the same here: 6/5 divided by 4/9  =  6/5 ÷ 4/9 = 6/5 * 9/4

(using the properties of division of fractions as equal to the product of the first one times the reciprocal of the second one)

Answer:

3rd one

Step-by-step explanation:

4. Consider the mailbox shown below. It consists of a square prism for the main pole, a rectangular prism for the main box and half a cylinder for top portion. You are going to provide the dimensions for each of these parts. When you provide the dimensions, they must meet the following criteria:
Use these dimensions to determine the overall volume of the mailbox. This should include both the pole, main box and cylindrical top portion. If necessary, use 3.14 for π and round your answer to the nearest hundredths.

Answers

Answer:

Too many answers could be correct

Step-by-step explanation:

This one is hard because it will depend on what numbers you pick for each measurement.

-----------------------------------------------------------------------------

if a = 1, b = 2, c = 3, d = 4, and e = 5

find the volume for all the shapes

The post

V = lwh = (1)(1)(2) = 2

The bottom of the mailbox

V = lwh = (3)(4)(5) = 60

The top of the mailbox

V = πr²h = (3)(5)π = 15π = 48.2

Then add them all together:

2 + 60 + 48.2 = 110.2 is the total Volume

How long does it take an account with a principal of $400 to earn $48 in interest at a simple annual interest rate of 2%?

Answers

Answer:

6 years

Step-by-step explanation:

8$ per year $48 divided by $8=6

Answer:

6 years

Step-by-step explanation:

$8 per year $48 ÷ $8 = 6 years  

Can someone please help as soon as you can!

Answers

Question 13. 3/5

Question 14. Option number 2- √(12xy)2

Have a beautiful day!

Other Questions
Photosynthesis uses all of the following exceptto make food.carbon dioxideO light energyO chemical energywateris its A? Sally says her stomach and liver have nothing to do with her heart and blood, and that they are completely separate. What did she say that is wrong?What would be the correct statement?What are the facts youd use to correct her? In 1985, the Gramm-Rudman-Hollings Balanced Budget and Emergency Control Act was passed in order to ensure that the federal government submitted goals to meet the deficit. If the goals are not met, then the president must order spending cuts across the entire budget based on the recommendation of the comptroller general, a position appointed by the president.The scenario above describes which of the following powers attributed to Congress?a. Congressional oversight by reviewing appropriations requests that need to meet certain spending criteriab. Congressional response to presidential budget cuts based on the comptroller general's recommendationsc. Congressional subcommittees that can review improper relationships between the comptroller and the presidentd. Congressional action to block proposed spending cuts to all federal agencies by amending the executive budget to target items from the president's agenda Which is the dominantmouth shape for emojis inthe picture below?How do you know?Smiley = MFrowny = mSchilly ScienceSMILEYFROWNY Gary wants to buy a bike that is 30% off. The original price is $109.56. What is the amount of the discount? Loss of voluntary control over urination is calledO dialysisO incontinenceO neurogenic bladderO urgencyPrevious what is one sixth of the product of four and nine table saws you can use with __ or __ but not both at the same time HELP PLS What is the value of the x variable in the solution to the following system of equations? (1 point)4x + 2y = 6x - y = 3O-15-22 Do violence and alcohol have anything to do with each other? If so, what do they have in common? If they don't have anything in common, tell me why? (SAT Prep) Find the value of x. He math team does practice drills that each last hour. In February the team did practice drills for a total of 24 hours. How many practice drills did the math team do in feburary PLEASE ANSWER FAST!!!!Explain why the U.S. decided to change its goal from protecting western settlements to attacking Native Americans and forcing them onto reservations. i just asked my best friend if she talk ab me behind my back bc i kinda have trust issues and i dont get what she means by this.... do yall have any idea? Write and solve an equation to determine the value of x in the figure. a. 3x 84; 252 b. 3x 84; 28 c. 3x 84; 84 d. 3x 84; 81 Find the value of x. Plsssssss Help!!!!Look at the map. How might the Gupta empire have been able to flourish through trade? Identify geographic features to support your answer. transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC Hey can somebody get this for me been stuck for five min Select the correct answer from the drop-down menu.What is implied by the underlined section in the passage?Caesar's statement to Brutus implies that