Identify the congruent triangles

Identify The Congruent Triangles

Answers

Answer 1

The congruent triangles are given as follows:

DEC and BEA.

What are the congruent triangles?

Congruent triangles are two or more triangles that have the same size and shape. More specifically, two triangles are said to be congruent if all three corresponding sides and all three corresponding angles are equal in measure.

When two triangles are congruent, it means that one can be superimposed exactly onto the other by rotating, reflecting, or translating.

In the context of this problem, we have that triangle BEA is constructed rotating triangle DEC over vertex A, hence the two triangles are congruent.

More can be learned about congruent triangles at https://brainly.com/question/1675117

#SPJ1


Related Questions

9+what=58 im confused i used calculator the awnser is 49

Answers

Yes, the answer is 49

​Triangle ABC​ is similar to triangle DEF. The length of BC¯¯¯¯¯ is 44 cm. The length of DE¯¯¯¯¯ is 14 cm. The length of EF¯¯¯¯¯ is 22 cm.



What is the length of AB¯¯¯¯¯?



Enter your answer in the box.

Answers

Answer:

28cm

Step-by-step explanation:

[tex] \frac{44}{22} \times 14 = 28[/tex]

Express (x+10)^2 as a trinominal in standard form

Answers

Answer:

x^2 + 10x + 20

Step-by-step explanation: When you multiply binomials, you are practically taking each term and multiplying it with others until you are out of combinations. However, when the product is represented in standard form, it requires the terms to be set within a specific order that prompts the term at the highest order/power placed on the furthest left side of the expression. The first term x^2 can be referred to as a term of the second power, 10x is seen as one to the first power (x^1 = 1st), and 20 as 0, since it is a constant.

The rectangular floor of a classroom is 32 feet in length and 34 feet in width. A scale drawing of the floor has a length of 16 inches. What is the perimeter, in inches, of the floor in the scale drawing?

Answers

As a result, the floor's perimeter in the size illustration is 38,016 inches.

In maths, what is perimeter?

The perimeter of an object is the space surrounding its border. Find the perimeter of different forms by combining the lengths of their sides.

We can start by finding the scale factor that relates the length of the actual floor to the length of the scale drawing.

The length of the actual floor is 32 feet = 384 inches (since there are 12 inches in a foot).

The length of the scale drawing is given as 16 inches.

Therefore, the scale factor is:

384 inches / 16 inches = 24

This means that one inch on the scale drawing represents 24 inches in the actual floor.

To find the perimeter of the floor in the scale drawing, we need to multiply the perimeter of the actual floor by the scale factor.

The perimeter of the actual floor is:

2(32 feet) + 2(34 feet) = 64 feet + 68 feet = 132 feet

Converting to inches, we get:

132 feet x 12 inches/foot = 1584 inches

Multiplying by the scale factor of 24, we get:

1584 inches x 24 = 38,016 inches

Therefore, the perimeter of the floor in the scale drawing is 38,016 inches.

To know more about Perimeter visit:

https://brainly.com/question/19819849

#SPJ1

Ammed five practice test to help him prepare for the written drivers permit test this chart shows the number of times he correctly answered the first five questions

Answers

Answer:

there is no chart or questions

Step-by-step explanation:

List the decimal numbers 4.76, 4.9, 4.08, and 4.7 in order from least to greatest.

4.9, 4.7, 4.08, 4.76
4.7, 4.76, 4.9, 4.08
4.08, 4.7, 4.76, 4.9
4.08, 4.76, 4.9, 4.7

Answers

The order of the decimal number from least to greatest is

4.08< 4.7<4.76<4.9.

What is decimal number?

Decimals are a form of number in algebra that have a full integer and a fractional portion separated by a decimal point. The decimal point is the dot that separates the whole number from the fractional element of the number. A decimal number is, for instance, 34.5.

Here the given decimal numbers are,

=>  4.76, 4.9, 4.08,4.7

Now ordering the number from smallest to largest

=>4.08< 4.7<4.76<4.9.

Hence the order of the decimal number from least to greatest is 4.08< 4.7<4.76<4.9.

To learn more about decimal numbers refer the below link

https://brainly.com/question/28393353

#SPJ1

Please help
Point A is one vertex of triangle ABC. Point B is the
x-intercept of 6x - 4y = -12 and point C is the y-intercept.
What are points B and C? Sketch the triangle in the
coordinate plane.
Point B is _ and point c is_

Answers

Answer: Point B is (-2,0) and Point C is (0,3)

Step-by-step explanation:

We know x-intercept is when y=0 and y-intercept is when x=0

Let's first find the x-intercept by replacing y with 0.

6x-4(0)=-12

now let's solve for x

6x-0=-12

x=-2

so Point B is (-2,0)

Now let's find the y-intercept by replacing x with 0

6(0)-4y=-12

now solve for y

-4y=-12

y=3

So point C is (0,3)

3.8% of 25. Show your work

Answers

[tex]\begin{array}{|c|ll} \cline{1-1} \textit{\textit{\LARGE a}\% of \textit{\LARGE b}}\\ \cline{1-1} \\ \left( \cfrac{\textit{\LARGE a}}{100} \right)\cdot \textit{\LARGE b} \\\\ \cline{1-1} \end{array}~\hspace{5em}\stackrel{\textit{3.8\% of 25}}{\left( \cfrac{3.8}{100} \right)25}\implies \text{\LARGE 0.95}[/tex]

Answer:

To find 3.8% of 25, we can convert the percentage to a decimal and then multiply it by 25:

3.8% = 0.038 (converting percentage to decimal)

0.038 x 25 = 0.95

Therefore, 3.8% of 25 is 0.95.

An engineer determines that the angle of elevation from her position to the top of a tower is 52°. She measures the angle of elevation again from a point 47 meters farther away from the tower and
finds it to be 31°. Both positions are due east of the town. Find the height of the tower

pls help

Answers

Answer:

Step-by-step explanation:

The question is illustrated with the attached image.

Angle of elevation is the angle between a line of sight and the horizontal surface.

Let h be the height of the tower

First, calculate distance BC (x).

This is calculated using the following tan ratio,

tan52=h/x

h=xtan52

From the attached image:,

CD=47+x

tan31=h/x+47

h=(x+47)tan31

xtan52=(x+47)tan31,

solving for x we get, x=41.156m

h=xtan52=41.156 * tan52=53.2m

Question 3 options: St. Louis Stock Car Races - Attendance Time Trials Finals 1st round 12,645 1st round 17,352 2nd round 16,234 2nd round 21,896 3rd round 18,817 3rd round 23,773 To the nearest thousand, about how many more fans attended the third round finals than the third round time trials?

Answers

About 5,000 more fans attended the third round finals than the third round time trials.

Calculating the number of fans that attended the finals than the trials

From the question, we are to find the approximate difference between the attendance of the third round finals and the third round time trials.

From the given data, we have:

Attendance Time             Trials                      Finals

1st round                           12,645                    17,352

2nd round                         16,234                    21,896

3rd round                          18,817                     23,773

Third round finals attendance = 23,773

Third round time trials attendance = 18,817

The difference between these two numbers is:

23,773 - 18,817 = 4,956

Rounding this to the nearest thousand gives:

4,956 ≈ 5,000

Hence, The number of fans that attended the third round finals than the third round time trials is about 5,000

Learn more on Calculating the number of fans that attended the finals than the trials here: https://brainly.com/question/30865831

#SPJ1

A car is sold for $20,000. After one year, the value of the car is $13,000. Write an exponential function y to determine the value of the car after x years if the rate of decrease is the same each year.
y=20000*(13000/20000)^x
Estimate the value of the car after 2 years. Round to the nearest dollar. $______________

Answers

So, the value of the car after 2 years, rounded to the nearest dollar, is $8450.

To determine the value of the car after 2 years, we need to plug in x=2 into the exponential function y=20000*(13000/20000)^x.

y=20000*(13000/20000)^2

y=20000*(0.65)^2

y=20000*0.4225

y=8450

Therefore, the value of the car after 2 years is $8450.

To round to the nearest dollar, we can look at the decimal part of the number. Since the decimal part is less than 0.5, we can round down to the nearest whole number.

So, the value of the car after 2 years, rounded to the nearest dollar, is $8450.

Learn more about Nearest

brainly.com/question/959839

#SPJ11

A zipline cable is attached to two platforms 1000 ft apart at an angle of depression from the taller platform of 12°. What is the length of the cable, rounded to the nearest foot? 1000 ft 20 ft​

Answers

Answer:

We can use trigonometry to solve this problem.

A is the taller platform, B is the shorter platform, and x is the length of the zipline cable that we want to find.

We can see that the angle between the horizontal and the zipline cable is 12 degrees, so we can use the tangent function to find x:

Therefore, the length of the zipline cable, rounded to the nearest foot, is 209 ft.

In a survey of 200 pet owners in Kathleen's state, the average number of pets per household
was estimated to be 2.75. Using these survey results, Kathleen predicted that about
49,500 pets, in total, would live in 18,000 households in her state. Why is her prediction
flawed? How could she modify her prediction to make it more accurate?

Answers

To make her prediction more accurate, Kathleen could modify her approach by using a larger and more representative sample size, or by conducting a more in-depth survey that accounts for regional and socioeconomic variations.

Where is Kathleen mistaken?

Kathleen's prediction is flawed because she assumed that the average number of pets per household would remain the same for all households in the state, which may not necessarily be true. The sample size of 200 households may not be representative of the entire population of households in the state, and there may be variations in the number of pets per household across different regions or socioeconomic groups.

To make her prediction more accurate, Kathleen could modify her approach by using a larger and more representative sample size, or by conducting a more in-depth survey that accounts for regional and socioeconomic variations. Alternatively, she could use data from existing sources, such as census data, to estimate the number of pets per household in different regions of the state and adjust her prediction accordingly. It's also worth noting that factors such as pet ownership trends, cultural attitudes towards pets, and population growth may also impact the accuracy of Kathleen's prediction and should be taken into account.

To know more about census data visit:

https://brainly.com/question/4634088

#SPJ1

Find and simplify f (-x) and use it to determine itf is even, odd, or neither. Use * to enter exponents, as in - 3x^5+4x^2 means --3x3 + 4x?. Do not enter any spaces in the answear f(x) = x^4 - 6x + 2 f(-x)+_______

Answers

The answer is f(-x) = x^4 + 6x + 2 and the function is neither even nor odd.

To find f(-x), we simply substitute -x for x in the original function:

f(-x) = (-x)^4 - 6(-x) + 2 = x^4 + 6x + 2

Now, to determine if f is even, odd, or neither, we compare f(x) and f(-x). If f(x) = f(-x), then the function is even. If f(x) = -f(-x), then the function is odd. If neither of these conditions are met, then the function is neither even nor odd.

In this case, f(x) = x^4 - 6x + 2 and f(-x) = x^4 + 6x + 2. These are not equal, so the function is not even. However, if we multiply f(-x) by -1, we get:

-f(-x) = -x^4 - 6x - 2

This is also not equal to f(x), so the function is not odd either. Therefore, the function is neither even nor odd.

Know more about function here:

https://brainly.com/question/3641581

#SPJ11

Please help! I need to pass this class so please help!

Answers

Answer:

x= 27.4

Step-by-step explanation:

a triangle's angles always equal 180 so

34.6+118+x=180

add 34.6 and 118 to get

152.6+x=180

subtract both sides by 152.6 to get

x=27.4

The STEM Innovation Academy building covers about (4)/(7) of the space provided. The area of the space STEM IA owns is about 40,000 square kilometres. What is the approximate area of the school?

Answers

The approximate area of the school is 22857 kilometer square.

The approximate area of the school can be found by multiplying the fraction of space covered by the STEM Innovation Academy building by the total area of the space.

In this case, the fraction of space covered is (4)/(7) and the total area of the space is 40,000 square kilometres.

To find the approximate area of the school, we can multiply these two values together:

(4)/(7) * 40,000 = 22,857.14

Therefore, the approximate area of the STEM Innovation Academy building is 22,857.14 square kilometres.

To know more about fraction click on below link:

https://brainly.com/question/8482939#

#SPJ11

What dimensions of a rectangular prism are 1.5 feet by 3.5 by 2 feet. What is the volume of the rectangular prism in cubic feet

Answers

If a rectangular prism has dimensions of 1.5 feet by 3.5 feet by 2 feet, its volume, expressed in cubic feet, is 10.5 cubic feet.

The rectangular prism's measurements are —

3.5 feet in length

1.5 feet wide in Size

Height is two feet.

The volume of the rectangular prism is calculated by multiplying these dimensions collectively.

Volume equals length, width, and height, or 3.5 feet, 1.5 feet, and 2 feet.

= 10.5 cubic feet of volume

Hence, the rectangular prism has a volume of 10.5 cubic feet.

To know more about Volume -

brainly.com/question/21416050

Peter's parents ollow a regular schedule for taking care of their car.they change the plugs every 30 000km,rotate the tyres every 10 000 km,and replace the brake pads blades every 15 000 km.fter how many kilometers will they first have to change the plugs,rotate the tyres,and replace the brake pads all at once for the first time​

Answers

They will have to change the plugs, rotate the tyre, and replace the brake pads all at once for the first time​ after 30,000 km.

What is LCM?

LCM is the abbreviated form for Least Common Multiple. LCM of two or more numbers is the lowest of all the common multiples of them.

Given,

Plugs are changed every 30,000 km

Rotate the tyres every 10,000 km

Replace the break pads blades every 15,000 km

All the three will be done together for the first time when all the multiples of the three distances intersect for the first time.

It is enough to find the LCM of 30000, 10000 and 15000 to find the least distance travelled when all the things are done together.

Multiples of 30,000 = 30000, 60000, 90000, ...........

Multiples of 10,000 = 10000, 20000, 30000, .......

Multiples of 15,000 = 15000, 30000, 45000, ........

The common multiple for the first time is 30,000.

Hence all the changes will be made to the car together for the first time after 30,000 km.

To learn more about LCM, click :

https://brainly.com/question/20739723

#SPJ9

Alex goes to a movie on Saturday for $10. While there, he pays $3 for each item he buys at the concession stand.
Which equation best represents this information?
y = 10x + 3
y = 3x - 10
y = 3x + 10
y = 10x - 3

Answers

y = 3x-10
he has 10 dollars and each item is $3

Answer:

y = 3x + 10

Step-by-step explanation:

y represents total he pays

x represents items he buys

total he pays = $3 for each item + $10 movie

y = 3x + 10

Suppose you are playing with someone new in soccer and you do not know how is strong, but you suspect you are. Let e be the probability that you win a single game. For now, we will treat o as discrete, with possible values 0, 0.1, ..., 1.0, and suppose you guess that the corresponding probabilities are ө teta Prior: P (0)
0 0
0.1 0.01
0.2 0.02
0.3 0.04
0.4 0.1
0.5 0.15
0.6 0.2
0.7 0.25
0.8 0.16
0.9 0.04
1 0
total Suppose you win the first time (), but then you lose twice () How does this information change your belief about the probability e. In another word, calculate the overall chances (expected values) of winning the games before/ and after you played? Note -Before you play, you believe that there is a 1% chance that your probability of winning any given game is 10%. - 2% chance that your winning probability is 20%, and so on.

Answers

The overall chances of winning the games before playing were 52%, and after playing and winning once but losing twice, the overall chances of winning are 17.33%. This shows that the new information has changed your belief about the probability of winning, and you now suspect that your chances of winning are lower than before.

Before playing the games, the expected value of winning is calculated by multiplying the probability of winning with the corresponding probabilities and adding them together. This is shown below:

E(win) = (0)(0) + (0.1)(0.01) + (0.2)(0.02) + (0.3)(0.04) + (0.4)(0.1) + (0.5)(0.15) + (0.6)(0.2) + (0.7)(0.25) + (0.8)(0.16) + (0.9)(0.04) + (1)(0) = 0.52

After playing the games and winning once but losing twice, the expected value of winning is calculated by multiplying the probability of winning with the corresponding probabilities, and adding them together. However, the probabilities are adjusted based on the new information. The new probabilities are shown below:

P(win) = (0)(0) + (0.1)(0.01)(1/3) + (0.2)(0.02)(1/3) + (0.3)(0.04)(1/3) + (0.4)(0.1)(1/3) + (0.5)(0.15)(1/3) + (0.6)(0.2)(1/3) + (0.7)(0.25)(1/3) + (0.8)(0.16)(1/3) + (0.9)(0.04)(1/3) + (1)(0)(1/3) = 0.17333

Therefore, the overall chances of winning the games before playing were 52%, and after playing and winning once but losing twice, the overall chances of winning are 17.33%. This shows that the new information has changed your belief about the probability of winning, and you now suspect that your chances of winning are lower than before.

Learn more about Chances of winning

brainly.com/question/28725688

#SPJ11

Find the perimeter of a regular pentagon with consecutive vertices at A(-3, 5) and B(7, 6).

Answers

The regular pentagon's perimeter is therefore sqrt(101) units when its adjacent edges are at A(-3, 5) and B(7, 6).

what is perimeter ?

The perimeter of a two-dimensional object is the space surrounding it. It represents the total length of the shape's edges. Typically, the perimeter is calculated using measures like centimetres, metres, or feet.

given

We can use the calculation for the distance between the two provided vertices to determine the length of one side:

sqrt[(7 - (-3))2 Plus (6 - 5)2] yields AB. = sqrt[10^2 + 1^2] = sqrt(101) (101)

Since the five sides of a normal pentagon are all the same length, one side's length is:

sqrt(101) / 5

s = AB / 5

Now, utilising the method for the regular pentagon's perimeter, we have:

Circumference = 5s = 5 sqrt(101) / 5 = sqrt (101)

The regular pentagon's perimeter is therefore sqrt(101) units when its adjacent edges are at A(-3, 5) and B(7, 6).

To know more about perimeter visit:

https://brainly.com/question/6465134

#SPJ1

I need help figuring out this question

Answers

Answer:

(4[tex]x^{2}[/tex]+2)([tex]x^{2}[/tex]-3)

Step-by-step explanation:

 4x    +2

  x       -3

Lesson 11-4 Three-dimensional Geometry Name "CHTC Lock hart 1. Identify each of the following polyhedra. Aloblique square pyramid

Answers

ABCD is the square base and A is the apex. As you can see, the apex is not directly above the center of the base, which makes this an oblique square pyramid.

An oblique square pyramid is a type of three-dimensional geometry that has a square base and four triangular faces that meet at a point, called the apex, but the apex is not directly above the center of the base. In other words, the pyramid is "tilted" or "leaning" to one side.

The key difference between an oblique square pyramid and a regular square pyramid is the location of the apex. In a regular square pyramid, the apex is directly above the center of the base, while in an oblique square pyramid, the apex is off-center.

Here is a diagram of an oblique square pyramid:

      A
     /|\
    / | \
   /  |  \
  /___|___\
 B    C    D

In this diagram, ABCD is the square base and A is the apex. As you can see, the apex is not directly above the center of the base, which makes this an oblique square pyramid.

Learn about Three-dimensional geometry

brainly.com/question/4427815

#SPJ11

Identify a variable inequality that describes the problem situation. Select the correct answer for each part of the equation.
Vigo earned $127.50 by washing driveways. He spent $70.35 on a new game console controller and then wanted to buy frozen meals that cost $5.99 each. How many frozen meals (x) could he buy while spending no more than his earnings? Also ty if you answer this I appreciate it <3

Answers

127.50 >70.35+5.99x The inequality has a line under i just cant type it with the line

Answer: 57.15[tex]\geq[/tex] 5.99x

Step-by-step explanation:

127.5-70.35[tex]\geq \\[/tex]x

57.15[tex]\geq[/tex] 5.99x

A-the mean of 10 numbers is 27. What is the sum of the numbers
B-if 5 is added to each number. What is the sum of new set of numbers
C-what is the mean is the new set of numbers

Answers

The sum of number is 270, after adding 5 to each number , sum of numbers is 320 and mean is 32.

The mathematical average of a group of two or more numbers is arithmetic mean, add the numbers in a set together and divide by the total number of numbers in the set.

Here the mean of 10 number is 27. We know that ,

[tex]mean=\frac{sum of numbers}{total numbers}\\[/tex]

[tex]27= \frac{sum of numbers}{10}[/tex]

=sum of numbers = 27*10=270.

Now 5 added to each number, we need to add 5 in 10 times( because 10 total number), Then 5*10=50.

Sum of numbers after adding 5 to each number [tex]270+50=320[/tex]

Now, [tex]mean=\frac{320}{10}=32[/tex]

To learn more about arithmetic mean refer the below link

brainly.com/question/30214653

#SPJ4

All help is appreciated this is due RLLY SOON HAHAH :D

Answers

Answer would be 12x! Hope this helps :)

Find the vertex of the parabola y = –x^2 + 10x – 21.

Answers

The vertex of the parabola is (5, 4). The solution has been obtained by using quadratic formula.

What is quadratic formula?

The quadratic formula is used to determine an equation's roots. This formula assists in evaluating the solutions of the quadratic equations instead of the factorization approach.

We are given equation as  y = -x² + 10x - 21.

Using quadratic formula, we know that x = -b/2a

So,

x = -10/-2

x = 5

On substituting this in the equation, we get

y = -5² + 10(5) - 21

y = -25 + 50 - 21

y = 4

Hence, the vertex of the parabola is (5, 4).

Learn more about quadratic formula from the given link

https://brainly.com/question/1063546

#SPJ1

HELP DUEEE TONIGHT!!!!!

a group of 175 adults were asked whether they exercise and whether they are vegetarian. their responses are summarized in the following table.​

Answers

im not sure if im right at all but ,

a) 44%
b) 40%
c) 28%
d) either one of the no's.

i need help with this bro

Answers

The value of x in the triangle given the midsegment points and sections is 1.35 units

Midsegment of a triangle

The mid-segment of a triangle (also called a midline) is a segment joining the midpoints of two sides of a triangle.

The midsegments of triangle UWY are VR, VZ, ZR

To find the value of x, we use a theorem called the mid segment theorem which states that:

"The mid-segment of a triangle, which joins the midpoints of two sides of a triangle, is parallel to the third side of the triangle and half the length of that third side of the triangle."

The third side of triangle UWY is WY and it measures 2.7.

Therefore, x will be 2.7 divided by 2 2.7/2 which will give us the value 1.35 i.e. x = 1.35

To learn more about midsegment triangles visit

https://brainly.com/question/11412750

#SPJ1

Det - Given the vector ū = (-1,5), find the magnitude and angle in which the vector points (measured counterclockwise from the positive x-axis, 0

Answers

The magnitude of the vector ū is approximately 5.10, and the angle is approximately 281.31°.

The magnitude of a vector is the length of the vector, and is calculated using the Pythagorean Theorem. The angle of a vector is the direction in which the vector points, measured counterclockwise from the positive x-axis.

To find the magnitude of the vector ū = (-1,5), we can use the formula:

magnitude = √(x^2 + y^2)

where x and y are the components of the vector.

Plugging in the values of x and y from the vector ū, we get:

magnitude = √((-1)^2 + (5)^2)

Simplifying the expression, we get:

magnitude = √(1 + 25)

magnitude = √(26)

magnitude ≈ 5.10

To find the angle of the vector, we can use the formula:

angle = tan^-1(y/x)

Plugging in the values of x and y from the vector ū, we get:

angle = tan^-1(5/-1)

angle = tan^-1(-5)

angle ≈ -78.69°

Since the angle is measured counterclockwise from the positive x-axis, we need to add 360° to get the angle in the correct quadrant:

angle = -78.69° + 360°

angle = 281.31°

Therefore, the magnitude of the vector ū is approximately 5.10, and the angle is approximately 281.31°.

Learn more about Magnitude

brainly.com/question/14452091

#SPJ11

Other Questions
Isn't it supposed to be one black triangle and one black square? Why is the Basque language not increasing anymore and is still a dying/endangered language? Help needed with the question please! Information sent to a function is a?Group of answer choicessumloop control variablecount variableparameter If a strand of DNA has a sequence TAGGATC, what would be thecomplementary sequence?CGAAGATTACCGGACGAAGTCATCCTAG ______ is the usual starting point for budgeting.Select one:a. The production budgetb. The estimated net incomec. The revenues budgetd. The cash budget Which of the following are examples of biodegradable wastes? a. Plastic and cow-dung cakes c. Cow-dung cakes and vegetable peelsb. Plastic and rubber d. Glass and the cow-dung cakes In Exercises \( 1-8, W \) is a subset of \( R^{2} \) consisting of vectors of the form \[ \mathbf{x}=\left[\begin{array}{l} x_{1} \\ x_{2} \end{array}\right] \] In each case determine whether \( W \) Please I need help. I dont understand this. Two resistors of resistances 3 and 6 are connected in parallel across a battery having voltage of 12V. Determine (a) the total circuit resistance and (b) the current flowing in the 3 resistor determine which of the following features they have in common. private vs public enterprises debate Please provide steps! You are given a primary amino acid sequence of a protein.Explain how you would predict the secondary and tertiary structuresthat the mature version of the given protein would adopt. ABC Incorporated shares are currently trading for $32 per share. The firm has 1.13 billion shares outstanding. In addition, the market value of the firms outstanding debt is $2 billion. The 10-year Treasury bond rate is 6.25%. ABC has an outstanding credit record and has earned a AAA rating from the major credit-rating agencies. The current interest rate on AAA corporate bonds is 6.45%. The historical risk premium over the risk-free rate of return is 5.5%. The firms is estimated to be 1.1, and its marginal tax rate, including federal, state, and local taxes, is 40%.a. What is the cost of equity?b. What is the after-tax cost of debt?c. What is the WACC? Fill in the blank with the French word that best completes the sentence.La sur de mon pre est________.ma surma tantema fillema cousine Question:What is the importance of being educated? Cite and explain the things thhat Filipinos consider to be educated.Note:(I would really appreciate it if it was a simple answer. But if not, it's fine. :) ) What is illustrated by the following line from the second inaugural address: "seeking to destroy it without warseeking to dissolve the union"?a. Allusion b. Didacticismc. Dramaticd. Irony e. Parallelism a ballon contains 7.36 g of oxygen gas, how many oxygen molecules are in the balloon Calculate the interest earned when $46 230 is invested for 9 years at 7.8% p.a., with interest compounded twice a year.