I need help pls pls pls pls pls

I Need Help Pls Pls Pls Pls Pls

Answers

Answer 1

The message that the artist is trying to portray is A. Jackson had gone too far in defining the authority of the central government.

What criticism did people have of the Jacksonian presidency ?

One of the criticisms of the Jacksonian presidency was that Andrew Jackson had gone too far in defining the authority of the central government. Jackson was known for his aggressive use of executive power and his belief in a strong presidency. Some people felt that he had overstepped his bounds and was infringing on the rights of individual states and the legislative branch.

Additionally, Jackson's policies, such as his opposition to the national bank and his support for westward expansion, were seen as favoring certain interests over others.

Find out more on the Jacksonian Presidency at https://brainly.com/question/20082472

#SPJ1


Related Questions

How does Condorcet try to convince the National Convention to abolish slavery

Answers

Marquis de Condorcet, a French philosopher and mathematician, was a strong advocate for the abolition of slavery. In his 1781 work "Reflections on Negro Slavery,"

He argued that slavery violated the principles of liberty and equality that were at the heart of the French Revolution.

When addressing the National Convention, Condorcet appealed to these same principles, arguing that slavery was a form of oppression that was incompatible with the ideals of the revolution. He pointed out the hypocrisy of the French government, which had fought for its own freedom while continuing to oppress others.

Condorcet also argued that slavery was economically inefficient and a barrier to progress. He believed that free labor was more productive and would lead to greater prosperity for all.

Overall, Condorcet's argument for the abolition of slavery was rooted in principles of freedom, equality, and progress, and he believed that ending the practice was both a moral imperative and a pragmatic necessity for the success of the revolution.

For such more question on Slavery

https://brainly.com/question/567921

#SPJ4

how an immigrant can become a naturalized citizen?

Answers

Go through the 10-step naturalization process which includes: Determining your eligibility to become an American citizen. Completing Form N-400, the application for naturalization, and creating a free account to submit your form online. Taking the U.S. Naturalization Test and having a personal interview.

What is naturalization?
Naturalization is the process through which an immigrant to the United States of America can become a U.S. citizen. Only certain immigrants are eligible: those who either have been green card holders (permanent residents) for 3–5 years or meet various military service requirements.

How long does it take for an immigrant to be naturalized?
18 months to 24 months
On average, it takes 18 months to 24 months to complete the naturalization process and become a U.S. citizen. The naturalization process has five general steps. It begins with filing Form N-400 and ends with taking the Oath of Allegiance.

Indigenous peoples, women, the poor, and so-called "minorities" were and are intentionally marginalized and deliberately disadvantaged in Canada. Why does liberalism, modern liberalism, socialism, and humanitarianism in Canada support such illiberal actions against many people of our country?

I have no idea about this question I'm so confused :(

Answers

Liberalism, modern liberalism, socialism, and humanitarianism are all political and social ideologies that prioritize the well-being and equality of individuals and groups.

However, the fact that indigenous peoples, women, the poor, and minorities have been marginalized and disadvantaged in Canada suggests that these ideologies have not always been fully realized in practice.

There are a variety of factors that have contributed to this, including systemic inequalities and biases that have been deeply ingrained in Canadian society and institutions. Additionally, there may be competing interests and priorities that have led some individuals and groups to prioritize their own goals over those of marginalized communities.

It is important to continue to critically examine the ways in which these ideologies are put into practice and to actively work towards creating a more equitable and just society for all Canadians.

For such more question on Liberalism

https://brainly.com/question/14352996

#SPJ4

Why was the Navajo Code considered to be such a success during WWII?

Answers

The Navajo Code, also known as Navajo Code Talkers, was a system of coded communication used by the United States military during World War II. It was based on the Navajo language, which was spoken by relatively few people outside the Navajo tribe and was difficult for non-speakers to learn.

The Navajo Code was considered to be such a success during WWII for several reasons. Firstly, the code was extremely secure and difficult to decipher, as it was based on the Navajo language, which had no written form and was not taught in schools. This made it almost impossible for the Japanese to intercept and decode the messages, even with their best codebreakers.

Secondly, the Navajo Code Talkers were highly trained and skilled soldiers who played a critical role in many major battles, including the Pacific campaigns on Guadalcanal, Iwo Jima, and Okinawa. They were able to quickly and accurately transmit important tactical information, such as troop movements and battle plans, using the code, which helped turn the tide of many battles.

Finally, the Navajo Code Talkers were able to maintain their secrecy and avoid detection by using a combination of cunning and stealth. They often operated in small teams and would frequently change their location to avoid being detected by enemy forces.

Overall, the Navajo Code was considered to be such a success during WWII because it was a highly effective and secure means of communication, used by skilled and dedicated soldiers who played a critical role in many important battles. The code helped give the United States a significant advantage in the Pacific theater and ultimately contributed to the Allied victory in the war.

the sequence of events in the battle of the coral sea ????

Answers

Japanese planes sink the Ships Neosho and USS Sims. The Japanese Covering Group escorting the invading force is seen by the Allies. The USN Lexington and USS Yorktown unleash their assault planes, sinking the Japanese aircraft carrier Shoho. The Japanese attack of Port Moresby has been halted.

What makes Neosho MO famous?

Neosho, often known as "City of Springs," has long been an agricultural hub. The Neosho National Fish Hatchery, the oldest in the National Fish Hatchery System, has been located there since 1888. It is regarded as the "Gateway to the Ozarks" among locals. It has also been dubbed "the Flower Box City" since 1957. Some notable sons of Neosho include renowned botanist George Washington Carver and celebrated artist Thomas Hart Benton. Carver was born in Diamond and went to school in Neosho. Thomas Hart Benton was the son of a local politician and was born in Neosho.

Know more about USN Lexington Visit:

https://brainly.com/question/20091631

#SPJ1

Industrialization/Immigration Reading Activity
Read the following passages and answer the corresponding questions:
Upton Sinclair, The Jungle (1906)
1. What problems did the new immigrants face?



2. How were workers mistreated in the packing plant?




3. What corrupt practices did the meat-packing industry follow?




4. Why was the public more concerned with the descriptions of filthy surroundings and tainted meat than with the unfair and dangerous working conditions?




5. Choose an excerpt that you think is powerful and write it here. Explain why you think it is powerful

Answers

Many issues, including discrimination, low-paying occupations, language hurdles, and terrible living circumstances, beset the new immigrants. The packing plant's workers were abused in a number of ways.

Excerpt: "Everything was so businesslike that it was fascinating to watch. It was the production of pork using equipment and applied mathematics. The hogs were so innocent, they came so very trustingly, and they were so very human in their protestations - and so totally within their rights - that even the most logical person could not help but think of them." This piece is potent because it emphasises how cruelly animals are treated in the meat business and how their welfare is neglected in the name of profit. It makes people feel sympathetic and repulsed by the business methods.

Learn more about immigrants here:

https://brainly.com/question/29487746

#SPJ4

help pls pls pls pls pls

Answers

Answer:

B

Explanation:

The best explanation for the idea in the political cartoon is A. The United States made it clear to European powers that the Americas were closed to recolonization.

How did America react to European efforts at recolonization?

The Monroe Doctrine declared that the United States would not tolerate any further colonization or intervention by European powers in the Americas.

The doctrine was issued in response to a number of developments in the early 19th century, including the independence movements in Latin America and fears that European powers might attempt to reassert control over their former colonies. The Monroe Doctrine was intended to signal to European powers that the United States would oppose any attempts to colonize or interfere with the affairs of independent nations in the Western Hemisphere.

Find out more on America at https://brainly.com/question/306438

#SPJ1

What vision did mill owners have for the future?

Answers

Mill owners in the 19th century had a vision for the future that revolved around industrialization and technological advancement.

They believed that the development of new machinery and manufacturing processes would lead to increased productivity and profits, as well as improvements in living standards for workers.

Mill owners sought to create a highly efficient and mechanized system of production, with the goal of maximizing output and minimizing costs. They also aimed to expand their markets and increase their profits through the development of new products and the establishment of global trade networks.

Overall, the mill owners' vision for the future was one that placed great emphasis on the power of technology and industrialization, and they saw these developments as essential to the continued growth and success of their businesses.

For such more question on Mill owners

https://brainly.com/question/6073664

#SPJ4

8. Which modern change had the most impact on a traditional
practice, process, or idea?

Answers

One modern change that has had a significant impact on a traditional practice, process, or idea is the internet's proliferation and the widespread use of digital technology.

Which modern change had the most impact on a traditional practice, process, or idea?

The internet has revolutionized the way we communicate, work, learn, and conduct business. It has changed the way we consume media, connect with people, and access information.

For example, traditional forms of media, such as newspapers and magazines, have seen a decline in readership as people increasingly rely on online sources for their news and information.

Digital technology has also transformed industries such as music and publishing, allowing artists and authors to reach wider audiences and disrupting traditional distribution channels.

The internet has also challenged traditional ideas about privacy and security, raising new concerns and opening up new areas of debate. Overall, the impact of the internet and digital technology has been profound and far-reaching, affecting almost every aspect of modern life.

Learn more about Technology here

https://brainly.com/question/1065537

#SPJ9

What are the beliefs of a committed conservative?

Answers

Answer:

In Western culture, depending on the particular nation, conservatives seek to promote a range of social institutions such as the nuclear family, organized religion, the military, property rights, and monarchy. Conservatives tend to favor institutions and practices that guarantee stability and evolved gradually.

President Wilson asked Congress to declare war on Germany after the discovery of the Zimmermann telegram and the sinking of American ships. Make a case for how public opinion influenced the president's decision not to maintain neutrality.

Answers

Public opinion played a significant role in President Wilson's decision to abandon neutrality and declare war on Germany during World War I.

What was the influence of  Zimmermann telegram ?

The discovery of the Zimmermann telegram, which revealed a German plot to encourage Mexico to attack the United States, outraged the American public and fueled anti-German sentiment.

Furthermore, the sinking of American ships, such as the Lusitania and the Sussex, by German submarines had already strained relations between the two countries. These events led to widespread calls for action and a desire for the United States to defend its national interests.

As a result, Wilson felt pressured to act in accordance with the will of the people, who were demanding a more aggressive response to Germany's actions.

Ultimately, public opinion played a crucial role in swaying Wilson's decision to declare war and join the Allied powers in the fight against Germany.

Learn more about  Zimmermann telegram here

https://brainly.com/question/29411018

#SPJ1

List five significant facts about Tim O’Brien’s life or writing career that seem to relate to this novel. Make sure you have the correct Tim O’Brien

Answers

Tim O'Brien is an American author and veteran of the Vietnam War whose experiences have greatly influenced his writing, particularly his novel "The Things They Carried." Here are five significant facts about his life or writing career that relate to the novel:

O'Brien himself served in Vietnam as a foot soldier, and many of the stories in "The Things They Carried" are based on his own experiences. He struggled with the moral complexities of the war and the trauma of combat, themes that are central to the novel. O'Brien has written extensively about the power of storytelling and the role of imagination in shaping reality, which is a key theme in the novel. "The Things They Carried" blurs the line between fiction and nonfiction, as O'Brien uses his own experiences as a basis for the stories but also incorporates fictional elements. The novel explores the themes of memory, truth, and the unreliability of storytelling, which are recurring themes in O'Brien's writing.

To know more about Vietnam War click here:

brainly.com/question/11375126

#SPJ4

Please help!!

This map shows the results of the Election of 1800, which saw incumbent President
John Adams face Thomas Jefferson. By studying this map, it can be determined that

A. Neither candidate enjoyed support from their home state.
B. Jefferson won in a landslide.
C. Adams narrowly missed winning reelection.
D. Western territories were denied voting rights because of
sectionalism.

Which of these MOST likely hurt the Federalist Party leading up to the election?

A. The Federalists were associated with the Alien and Sedition Acts.
B. Thomas Jefferson had switched from the Federlust to the Democratic-Republican Party.
C. George Washington had spoken out against political parties.
D. John Adams had advocated the United States should assist France in their revolution.

Answers

By studying the map of the Election of 1800, it can be determined that B. Thomas Jefferson won in a landslide.

The event that most likely hurt the Federalist Party leading up to the election was A. The Federalists were associated with the Alien and Sedition Acts.

Why did the Federalists lose in 1800 ?

The Alien and Sedition Acts were a series of laws passed by the Federalist-controlled Congress in 1798 that restricted the rights of immigrants and limited freedom of speech and the press. These laws were highly controversial and led to widespread opposition among Democratic-Republicans, who saw them as a threat to civil liberties.

The Alien and Sedition Acts damaged the reputation of the Federalist Party and helped to turn public opinion in favor of Thomas Jefferson and the Democratic-Republicans.

Find out more on the Federalists at https://brainly.com/question/1040573

#SPJ1

What determines how prices are established

Answers

Answer:

Price is dependent on the interaction between demand and supply components of a market. Demand and supply represent the willingness of consumers and producers to engage in buying and selling. An exchange of a product takes place when buyers and sellers can agree upon a price.

help pls pls pls pls pls

Answers

Answer:

Protective tarrifs created potential trade issues with Europian countries.

Explanation:

Southern representatives were historically against high protective tariffs because their region was primarily agricultural and relied heavily on exports to Europe. High tariffs would make it more expensive for European countries to buy Southern cotton and other agricultural products, which would hurt the region's economy. Additionally, Southern politicians believed that high tariffs disproportionately benefited Northern industrial interests, as they would be able to charge higher prices for their manufactured goods due to reduced competition from foreign imports.

In the 19th century, the debate over tariffs was closely linked to the issue of states' rights and federal power. Southern politicians argued that the federal government did not have the authority to impose high tariffs on states without their consent. They believed that the states should be free to regulate their own economies without interference from the federal government. This was part of a broader ideological disagreement between the North and the South over the proper role of the federal government in American society.

Overall, Southern opposition to high protective tariffs was rooted in both economic and political concerns. The region's reliance on agricultural exports and its commitment to states' rights made it a natural opponent of tariff policies that favored Northern industrial interests and expanded federal power.

Please help!!
Discussion Topic
In this unit, you learned about how our nation's government operates, from the federal
level government down to the most local levels of government. Think about some of the
issues or problems that each level of government handles. Next, identify a national
issue that you think should be handled at a lower level of government. Then, identify a
state or local issue that should be handled by the federal government. In each case,
why do you think a different level of government would be better suited to deal with
each problem. Explain your answer.

Answers

At the federal level, the government operates through three branches: the executive, legislative, and judicial which all play different roles in a country administration.

How does government operates from federal level government down to the most local levels of government?

The executive branch is responsible for enforcing laws and is headed by the president, while the legislative branch creates laws and is composed of the House of Representatives and the Senate. The judicial branch interprets laws and is composed of federal courts, including the Supreme Court.

What issues does each level of government handles?The federal government handles issues related to national security, foreign policy, and interstate commerce, among other things. Examples of federal issues include regulating international trade, maintaining a national defense system, and enforcing civil rights laws.

The State governments handle a range of issues, including education, healthcare, transportation, and public safety. For example, state governments are responsible for funding and regulating public schools, maintaining state highways, and overseeing state prisons.

The Local governments also handle issues related to infrastructure and community development, such as maintaining local roads and parks, and overseeing new construction projects.

Read more about government branch

brainly.com/question/9776664

#SPJ1

Using the facts from above, create a compare and contrast writing
between The Lewis and Clark Expedition and The Dunbar and Hunter
Expedition. Help pls

Answers

Both the Lewis and Clark Expedition and the Dunbar and Hunter Expedition played significant roles in early American exploration. However there are some significant differences between the two.

What is Lewis and Clark Expedition?

Firstly, President Thomas Jefferson ordered the Lewis and Clark Expedition in 1803 with the objective of exploring the recently acquired Louisiana Territory and locating a navigable path to the Pacific Ocean. William Clark and Meriwether Lewis were in charge of the expedition, which ran from 1804 to 1806. In contrast, William Dunbar and George Hunter undertook the scientific Dunbar and Hunter Expedition in 1804 to investigate the natural riches of the Ouachita River Valley in what are now Arkansas and Louisiana.

To know more about Lewis and Clark Expedition visit:

https://brainly.com/question/1712610

#SPJ1

What did the German faith movement say about Jesus’ birth?

Answers

The German Faith Movement was a religious movement in Nazi Germany, closely associated with University of Tübingen professor Jakob Wilhelm Hauer.

What is the meaning of the German Faith Movement?

Jakob Wilhelm Hauer, a professor at the University of Tübingen, was closely linked with the German Faith Movement, a religious movement in Nazi Germany. The movement aimed to convert Germany from a Christian nation to one based on Germanic paganism and Nazi principles.

Germanic tribes were assimilated into the Empire throughout the fifth century, romanized, and eventually converted to Roman Catholicism. Around 498, the Franks became the first significant Germanic tribe to convert from their tribal faith to Catholicism.

Learn more about the German Faith Movement here:

https://brainly.com/question/637117

#SPJ9

Evaluate the equation. -8y=88 OB) y=-11 00) y = 80​

Answers

The solution to the equation -8y=88 is y=-11. It is important to always check our solutions by substituting them back into the original equation to ensure they are valid.

The given equation is -8y=88. We need to solve for y.

To isolate y, we need to divide both sides of the equation by -8.

-8y/(-8) = 88/(-8)

Simplifying this equation gives us:

y = -11

Therefore, the solution to the given equation is y=-11.

To check if this solution is correct, we can substitute y=-11 back into the original equation:

-8(-11) = 88

Simplifying this equation gives us:

88 = 88

Since both sides of the equation are equal, we can conclude that y=-11 is indeed a valid solution to the equation.

Learn more about substituting here:

https://brainly.com/question/14619835

#SPJ1

... There were tactical differences between [Frederick] Douglass and William Lloyd Garrison,
white abolitionist and editor of The Liberator-- differences between black (African American]
and white abolitionists in general. Blacks were more willing to engage in armed insurrection
(rebellion], but also more ready to use existing political devices-the ballot box, the
Constitution-anything to further their cause. They were not as morally absolute in their
tactics as the Garrisonians. Moral pressure would not do it alone, the blacks knew; it would
take all sorts of tactics, from elections to rebellion....
White abolitionists did courageous and pioneering work, on the lecture platform, in
newspapers, in the Underground Railroad. Black abolitionists, less publicized, were the
backbone of the antislavery movement. Before Garrison published his famous Liberator in
Boston in 1831, the first national convention of Negroes had been held, David Walker had
already written his "Appeal," and a black abolitionist magazine named Freedom's Journal had
appeared. Of The Liberator's first twenty-five subscribers, most were black....
Source: Howard Zinn, A People's History of the United States, 1492-Present, Harper Perennial, 2003
1. Both the black and white abolitionists mentioned in this document were
fighting against which policy

Answers

Prior to the American Civil War, the abolitionists listed in this paper, who were both black and white, fought against the enslavement of African Americans in the country.

During the Civil War, why was the abolitionist movement important? Which was it?

When the American Civil War began in 1861, abolitionists sided with the Union. On January 1, 1863, some areas of the South rejoiced when President Abraham Lincoln proclaimed that slaves would soon be free. Slavery in the US was abolished in 1865 thanks to the 13th Amendment to the Constitution.

Who fought for abolition during the American Civil War?

Although the majority of the movement's early backers were white, religious Americans, some of its most renowned leaders were also Black men and women who had escaped from slavery. Abolitionists wanted to put an end to the slave trade because they believed that slavery was wrong and a blight on the United States.

Learn more about American Civil War: https://brainly.com/question/769992

#SPJ9

How were the reporters and photographers of the black press perceived by the community

Answers

Answer:

Reporters and photographers of the black press were often highly regarded by the black community during the period of segregation and Jim Crow laws in the United States. They played a crucial role in reporting on issues and events that were ignored or misrepresented by mainstream white media outlets. They provided a voice for black Americans who were otherwise marginalized and excluded from the dominant culture.

The black press was seen as a source of information and inspiration for the black community, and its journalists were often regarded as heroes and advocates for social justice. They were seen as a means of countering negative stereotypes and promoting positive images of black people in the media.

Moreover, the black press served as a platform for community-building and organizing. It provided a means for black Americans to share their stories and experiences, and to connect with one another across geographical and social divides. Black newspapers were a source of pride for the black community, and their reporters and photographers were seen as champions of black culture, history, and identity.

Overall, the reporters and photographers of the black press were highly respected and valued by the black community during a time of immense struggle and hardship. They played a vital role in documenting the black experience and advocating for social change, and their contributions are still celebrated today.

Explanation:

Can some one please help me make this essay better. I would really appreciate it. :)

I beleive that Abraham lincon was the best president. He was the US's 14th president. He is well known by many people. The have been schools named after him. Abraham lincon had a modern mind. He though and acted on the times like today. He was able to succefully waged an political issue and civil war that had the union. He took a big risky step to end slavery. He knew that it was wrong but many people didn't like the idea of him supporting the idea to end slavery. He was bold and brave about what he thought was best and he wasn't afraid to share his thoughts and opinions even if it risked his reputation. I think that during these times we could really use a president like him. We need him now but people needed him more in the 1800's. He created the posiblity for social and civil freedom for African Americans. He saw them as equals which many did not. Lincoln has been known as the Nations greatest president of all time. He certanily is a legend. Lincoln had issued a document called The Emanciption Proclamination that had freed African Americans from slavery. Unfortantly Lincold was shot and killed by John Wilkes Booth while he was at the theater. He was shot because people who opposed his act of freeing slaves didnt like it. The man who shot and killed him believed that it could be restored to make African Americans slaves again if he was killed. Abraham Lincoln did an amazing thing to help slaves. He knew that he was putting his reputation and life on the line when he stood up for the African Americans. He didnt care all he cared about was putting true justice first. This is why that in my eyes and many others Abraham Lincoln is a great president.

Answers

Great start and introduction to the essay giving some information on it. Overall great essay and I hope you get a good grade on it

1. Discuss the positive and negative effects of the United States foreign policy's efforts to root out communist influences in the decade following World War II.

Answers

Answer:

The United States foreign policy's efforts to root out communist influences in the decade following World War II had both positive and negative effects. On the one hand, these efforts helped to contain the spread of communism and prevent the Soviet Union from expanding its sphere of influence. On the other hand, they led to a number of negative consequences, including political repression, military intervention, and the loss of American credibility abroad.

Positive effects:

1. Containment of communism: One of the most significant positive effects of the United States foreign policy's efforts to root out communist influences was the containment of communism. By providing economic and military aid to countries threatened by communist expansion, the United States was able to prevent the spread of communism and contain the Soviet Union's influence.

2. Creation of alliances: The United States formed alliances with a number of countries in Europe and Asia that were threatened by communism. These alliances not only helped to contain the spread of communism but also provided a platform for economic cooperation and the promotion of democracy.

3. Economic growth: The United States foreign policy's efforts to root out communist influences contributed to economic growth in countries that received aid. The Marshall Plan, for example, helped to rebuild Western Europe after World War II and provided the basis for the economic integration that followed.

Negative effects:

1. Political repression: In many cases, the United States foreign policy's efforts to root out communist influences led to political repression. In countries such as Guatemala, Iran, and Chile, the United States supported authoritarian regimes that suppressed political dissent and violated human rights.

2. Military intervention: The United States foreign policy's efforts to root out communist influences often involved military intervention. The Vietnam War, for example, was a direct result of the United States' attempt to contain communism in Southeast Asia. The war resulted in significant loss of life and damaged the reputation of the United States around the world.

3. Loss of American credibility: The United States foreign policy's efforts to root out communist influences damaged the credibility of the United States as a champion of democracy and human rights. The support of authoritarian regimes and the use of military force in pursuit of American interests undermined the United States' moral authority and made it more difficult for the country to promote its values abroad.

In conclusion, the United States foreign policy's efforts to root out communist influences in the decade following World War II had both positive and negative effects. While they helped to contain the spread of communism and promote economic growth, they also led to political repression, military intervention, and the loss of American credibility.

Explanation:

Who invented Barbed Wire? What was its purpose?

Answers

Answer: Joseph F. Glidden's innovative barbed wire was essential to the settlement of the American plains in the late nineteenth century. It proved to be an effective method of securely enclosing one's property, thereby keeping cattle in and trespassers out.

Explanation:

Answer:

Joseph F. Glidden was the inventor of barbed wire. It was used to provide an inexpensive method to control the movement of cattle.

Explanation:

Which characteristic best describes Aaron Douglass's painting, song of the towers

Answers

Answer: abstract and geometric

Explanation:

What did the domino theory state?

1. If one country fell to Communism, others nearby would soon follow

2. Use of nuclear weapons in one country would lead to use in others

3. If the economy of one Asian country fell, others nearby would soon follow

4.The United States should increase defense spending to cripple the Soviet economy

Answers

If one country fell to Communism, others nearby would soon follow.
The domino theory was a political theory that originated in the United States during the Cold War. It stated that if one country in a region came under the influence of communism, then the surrounding countries would soon follow in a domino effect. The theory was used to justify American involvement in the Vietnam War, as the US believed that if Vietnam fell to communism, other countries in Southeast Asia would follow.

Healing masks are worn during ceremonies or rituals to

A. communicate with the spirits of ancestors.

B. protect the people being healed from evil spirits.

C. perform exorcisms on evil spirits.

D. celebrate a festival that celebrates death and the afterlife.

Answers

Answer: B. protect the people being healed from evil spirits.

Explanation: Healing masks are worn during ceremonies or rituals to protect the individuals being healed from evil spirits.  In various cultures and traditions, masks hold symbolic significance and are believed to have spiritual powers.  These masks are worn by healers or participants during healing rituals to provide a form of spiritual protection.

The belief is that wearing the healing mask creates a barrier or shield against negative energies and malevolent spirits that may interfere with the healing process.  The mask serves as a form of spiritual armor, ensuring the safety and well-being of those involved in the ceremony.

Additionally, healing masks can also have cultural and symbolic meanings. They may represent specific deities, ancestors, or mythological figures that hold significance in the community's beliefs.  The use of masks in healing rituals allows for a deeper connection with the spiritual realm and aids in channeling positive energy and healing vibrations.

Please help me finish this really fast
The OPEC embargo caused stagflation because with low oil do to the fact we cut ties with OPEC. _________ was an effect of __________ because...


btw don't answer the question if you're not gonna help me bc I'll report you​

Answers

The OPEC embargo caused stagflation because of low oil due to the fact we cut ties with OPEC.

What was the effect of stagflation?

High inflation was an effect of stagflation because during that time period, the economy experienced both stagnant economic growth and high inflation.

This was a difficult situation for policymakers because conventional economic theories suggest that there is a tradeoff between inflation and unemployment.

However, during the stagflation period, both inflation and unemployment were high, which made it challenging to find a solution.

Ultimately, policymakers had to adopt new approaches to managing the economy, which led to the development of new economic theories and policies.

Read more about OPEC here:

https://brainly.com/question/26412451
#SPJ1

What features of both the Virginia Plan and the New Jersey Plan ended up in the Constitution?

Answers

The Virginia Plan and the New Jersey Plan were two proposals for structure and organization of U.S. government presented during the Constitutional Convention in 1787.

What was the Virginia Plan?

The Virginia Plan was a proposal presented by James Madison and other delegates from Virginia at the Constitutional Convention in 1787. It called for a strong federal government composed of three branches: the legislative, executive, and judicial. The legislative branch would be bicameral, with representation in both houses based on population. This would give larger states like Virginia more influence in the government. The plan also proposed a system of checks and balances to prevent any one branch from becoming too powerful. The Virginia Plan was one of the most influential proposals at the Constitutional Convention and served as a basis for the drafting of the United States Constitution.

To learn more about Virginia Plan, visit:

https://brainly.com/question/10922511

#SPJ9

John Locke's ideas of natural rights and social contract are evident in


Thomas jefferson's writing of the Declaration of Independence


The Bill of Rights

Answers

The statement is true. Historians agree that John Locke's ideas of natural rights and social contract are evident in Thomas Jefferson's writing of the Declaration of Independence.

Who was John Locke?

John Locke was an English philosopher and physician known as the "Father of Liberalism." He had some unique ideas about human nature, natural rights, and social contracts.

Thomas Jefferson's writing of the Declaration of Independence was influenced by John Locke.

For example, Thomas Jefferson directly quoted Locke's writing in several parts of the document, including the famous line about:

the unalienable rights of life,liberty, andthe pursuit of happiness.

You can learn more about the Declaration of Independence here https://brainly.com/question/9515546

#SPJ1

Other Questions
HELP PLSSSSS!!!!!!!Krystal throws a rappelling rope at a speed of 10 m/s down a 50 m cliff.When will the rope hit the ground? Use the drop-down to put the correct order to solve for when the rope will hit theground. Ismail and Sameer are opening a paint store. There are no competing paint stores in the area. They must decide how to organize the business. They anticipate profits of $100,000 the first year, with the ability to sell franchises in the future. Although they have enough to start the business now as a partnership, cash flow will be an issue as they grow. They feel the corporate form of operation will be best for the long term. They seek your advice.Requirements1. What is the main advantage they gain by now selecting a corporate form of business?2. Would you recommend they initially issue preferred or common stock? Why?3. If they decide to issue $10 par common stock and anticipate an initial market price of $40 per share, how many shares will they need to issue to raise $2,250,000?4.vForecast their earning potential with your imaginary numbers for the next two years. Here, you have to prepare forecasted income statements and the year-end balance sheets for the first two years, assuming that they are going the start the business as a joint-stock company?? A soccer ball with a mass of 0.43 kg is thrown to a 63 kg girl at rest who is wearing roller blades. She catches the ball and moves to the right. Her speed just after catching the ball is 0.2 m/s. How did covid affect school kids in Afrikaans 15. \( x=-5, \quad x=4, \quad x=-\frac{1}{2} \) factored form standard form 16. \( x=3, \quad x=-7, \quad x=0 \) (multiplicity of 2) factored form standard form\[ \text { 17. } x=\frac{2}{3} \text { what smaller 5.75 or 9/7 When the Europeans arrived in Central America, most countries fell to Spanish rule except ______, which became a British colony. i need help 16 divided by 6032 full solution A jet flying at 200 m/s north accelerates at a rate of 18.2 m/s for 15 seconds. What is the jet's final velocity? The RNA sequence GGAUCUCUUGUAGAUCUGUUCUCUAAACGAAC lies in a section of the COVID-19 viral genome that sets up translation, which is the process of reading the RNA to create the proteins the virus needs to survive.(a) Use the webserver to predict the lowest energy structure of the sequence. Print out a picture of it. (b)What do you think the effect will be of the RNA being longer than the stretch you just similated? (c) Design an RNA sequence that folds into a single stem-loop. Run it through the RNAfold server and print a picture of your folded design. consider a political discussion group consists of 6 democrates, 3 republicans, and 5 independents. suppose that two group members are randomly selected, in succession, to attend the political convention. find the probability of selecting a independent then a democrat According to the Kaplan-Meier plot, amplification of more than 10 copies of myc in neuroblastoma (see fig. 4-11b), decreases disease-free survival by more than 80% post-treatment. Explain two mechanisms that may contribute to gene amplification of myc? Even though both lens cells and liver cells have numerous transcription factors that are present in both colls, the lens cell makes the crystallin protein (not albumin), whereas the liver cell makes albumin (not crystallin) Which of the following explains this cell specificity?A. Different specific transcription factors made in each cell determine which genes are expressedB. At fertilization, specific colls are destined for certain functionsC. The activators needed for expression of the crystallin gene are present in all cells.D. The promoters are different for the different genes How does the author's discussion of different death rates help readers understand the spread of the Black Death? Use evidence from the text in your responsepls i need help!! a rock rolling down a slope from rest covers a distance of 4 m in the first second. What distance will it covers in 3 sec? 5 3/10 = 5 ?/50If anyone can please help me with the rest what happened to some native Americans during the Jackson presidency ? In order for following to be consistent,-3x +4y +7z =-4-11x +24y +kz = -452x -5y -8z =9solve for k ?please show full steps Air passes over the top of an airplanewing at 170 m/s, and over the bottomat 130 m/s. What is the difference inpressure between the top andbottom of the wing? Scarlett and Roger sipped their drinks on the porch, discussing all the things they still had to do before the Easter holiday. As Roger finished her last bit of burger, he sighed, "I'm stuffed." He complained of having a burning sensation in his lower chest. "You probably ate too much. How about taking some antacid?" asked Scarlett. "I use it every time I get indigestion." Roger left to search the medicine cabinet. He eventually felt better. Roger got his body test results the next day. He glanced at them briefly and put the paper in his bag. "Maybe later I will get a better sense of what all this means," he said.'Roger's test results(at rest and fasting levels)TEST Roger's Result Normal RangeHeart rate 90 beats/min 60-100 beats/minBlood pressure 138/95 mm/Hg 120/80 mm/HgTotal cholesterol 242 mg/dL