How is the series 3+5+7+...+51 represented in sigma notation?

How Is The Series 3+5+7+...+51 Represented In Sigma Notation?

Answers

Answer 1

Answer:

The third one

Step-by-step explanation:

The only one which gives the last number of the sequence is the third one as subbing in 16 you get 3×16 + 3 = 48 + 3 = 51

Answer 2
The 3 ok so have a nice day

Related Questions

The scale factor of two similar cylinders is 5:2.

The volume of the smaller cylinder is 28 m3.

What is the volume of the larger cylinder?

Possible answers
437.5 m3


700 m3


175 m3


350 m3


70 m3

Answers

The volume of the larger cylinder as 70 m³.

What is a cylinder, simply defined?

With two parallel bases joined by a curving surface, a cylinder is a three-dimensional solid. The bases are typically shaped like circles. The cylinder's height ("h") and radius ("r") are used to represent the perpendicular distance between the bases.

The scale factor of the cylinders = 5:2

The scaling factor indicates how much a figure has increased or decreased from its initial value.

The volume of the smaller cylinder = 28 m³

We are asked to find the volume of the larger cylinder.

let the volume of the larger cylinder be x.

x / 28 = 5/2

x  =(5/2) * 28 = 70

Therefore using the scale factor, we found the volume of the larger cylinder as 70 m³.

Learn more about the cylinder

brainly.com/question/16134180

#SPJ1

[tex]3\sqrt{x} -\sqrt{14x-10 =0[/tex]

Answers

The value of the variable x is 2 in the given expression [tex]3\sqrt{x} - \sqrt{14x - 10} = 0[/tex].

What is square root?

Square rοοt οf a number is a value, which οn multiplicatiοn by itself, gives the οriginal number. The square rοοt is an inverse methοd οf squaring a number. Hence, squares and square rοοts are related cοncepts.

Suppοse x is the square rοοt οf y, then it is represented as x=√y, οr we can express the same equatiοn as x² = y. Here, ‘√’ is the radical symbοl used tο represent the rοοt οf numbers. The pοsitive number, when multiplied by itself, represents the square οf the number. The square rοοt οf the square οf a pοsitive number gives the οriginal number.

Find the value of x in the expression given below.

[tex]3\sqrt{x} - \sqrt{14x - 10} = 0[/tex]

Square both sides

[tex](3\sqrt{x} - \sqrt{14x - 10} )^2= 0^2[/tex]

Use (a - b)²

9x + 14x - 10 - 2([tex]3\sqrt{x} \times \sqrt{14x - 10}[/tex]) = 0

9x + 14x - 10 - 2([tex]3\sqrt{x} \times \sqrt{14x - 10}[/tex]) = 0

Use distributive property

23x - 10 - 43x + 50 = 0

-20x + 40 = 0

40 = 20x

x = 40/20

x = 2

Thus, the value of the variable x is 2 in the given expression [tex]3\sqrt{x} - \sqrt{14x - 10} = 0[/tex].

Learn more about Square rοοt

https://brainly.com/question/27934687

#SPJ1

50 points
At a financial conference, the 750 attendees were given the choice of turkey, ham, both, or neither on the sandwich in their sack lunch. Seventy-five of the attendees chose neither and 250 chose both. If a total of 450 people had ham on their sandwiches, use the given Venn diagram to determine how many people had turkey on their sandwiches.



475
525
225
300

Answers

The number of people who had turkey on their sandwiches is 475.

option A.

What is the number of people who had turkey on sandwiches?

Let's define the following;

A be the number of people who chose turkey,

B be the number of people who chose ham,

C be the number of people who chose both, and

D be the number of people who chose neither.

From the problem statement, we know that:

D = 75 (75 attendees chose neither)

C = 250 (250 attendees chose both)

B = 450 (450 attendees chose ham)

We want to find A (the number of attendees who chose turkey).

We can start by using the formula for the number of elements in the union of two sets:        

|A U B| = |A| + |B| - |A n B|

where;

|A|  and |B| denotes the number of elements in set A, set B and A n B denotes the intersection of sets A and B.

Applying this formula to the problem, we get:

750 - D = A + B - C

750 - 75 = A + 450 - 250

675 = A + 200

A = 475

Therefore, 475 attendees chose turkey on their sandwiches. The answer is (A) 475.

Learn more about set analysis here: https://brainly.com/question/30649500

#SPJ1

A parabola has x-intercepts -2 and -8, and has vertex (-5,-18). Determine the equation of this parabola in the form y=a(x-r)(x-s) Consider the function f(x)=4x^3+1. a) Find the derivativo of f. Answer f’(x)= b) Compute the derivative of f at x=1. Answer f’(1)=
c) Deterine the equation of the tangent line to the curve y=f(x) at the point (1,5).

Answers

a) The derivative f'(x) is 12x².

b) The amount of f'(1) is 12.

c) The equation of the tangent line is 12x - 7.

a) To find the derivative of f(x), we can use the power rule for each term. The power rule states that for any function f(x) = xⁿ, the derivative f'(x) = nx^(n-1). So for f(x) = 4x³ + 1, Thus, the derivative f'(x) = 12x².

b) To compute the derivative of f at x=1, we simply plug in x=1 into the derivative equation we found in part a. So f'(1) = 12(1)² = 12.


c) To determine the equation of the tangent line to the curve y=f(x) at the point (1,5), we use the point-slope form of a line, which is y-y1 = m(x-x1), where m is the slope of the line and (x1,y1) is the point the line passes through. The slope of the tangent line is the derivative of f at x=1, which we found in part b to be 12. So the equation of the tangent line is y-5 = 12(x-1), or y = 12x - 7.

Learn more about the derivative: https://brainly.com/question/30365299

#SPJ11

please someone help me asap :(

Answers

The prοbability οf the events is:

P(A and B) = 7/100

P(A | B) = 16/25

P(A | B) = 0.495

P(A and B) = 0.175

What is a Prοbability?

The likelihοοd οr chance οf an event οccurring is measured by prοbability. The prοbability is expressed as a number between zerο (0) and οne (1), with zerο (0) shοwing that the event is impοssible, and οne (1) shοwing that the event is certain tο οccur. A prοbability οf 0.5 indicates that the event is equally likely tο οccur οr nοt οccur.

By dividing the number οf favοrable οutcοmes by the entire number οf pοssible pοssibilities, the prοbability οf an event is determined.

Fοr example, if we tοss a fair cοin, the prοbability οf getting heads is 1/2, because there is οne favοrable οutcοme (heads) οut οf twο pοssible οutcοmes (heads οr tails).

Therefοre, All events are dependent, sο the prοbability οf each event is:

P(A and B) = 7/100

P(A | B) = 16/25

P(A | B) = 0.495

P(A and B) = 0.175

To know more about events visit:

brainly.com/question/25839839

#SPJ1

a phone tree is planned to get the word out quickly as possible about a schedule change at school suppose Step 1 it the lead person calling 5 people. Step 2 is those 5 people each calling 5 new people. This process continues until all the people on the phone tree have been called answers

Answers

By answering the above question, we may state that Once everyone on unitary method the phone tree has been contacted and advised of the schedule change, the procedure may be repeated.

What is unitary method ?

The unit technique is a strategy for addressing issues that entails first figuring out the value of a single unit, then multiplying that value to figure out the needed value. Simply expressed, the unit technique is used to extract a single unit value from a multiple that is provided.

First, the coordinator phones five persons to let them know that the school's schedule is changing.

Step 2: Those 5 people then each phone 5 more people, resulting in a total of 25 people receiving the news.

Step 3: The 25 call 5 additional individuals each, reaching a total of 125 people.

Step 4: The 125 call 5 additional individuals apiece, reaching a grand total of 625 persons.

Step 5: A total of 3,125 individuals have been told after the 625 phone 5 further persons each.

Once everyone on the phone tree has been contacted and advised of the schedule change, the procedure may be repeated.

To know more about unitary method  visit:

https://brainly.com/question/28276953

#SPJ1

Write the correct postulate, theorem, property, or definition that justifies the statement below the diagram.
Given: ∠MRS ≅ ∠MRO

Answers

In the given figure the equation m∠MRS + m∠MRO = 180° is the postulate describing the linear pair of angles.

What is an angle?

The English word "angle" derives from the Latin word "angulus," which means "corner." The vertex and the two rays are referred to as the sides of an angle, respectively, and are the shared termini of two rays.

It is given that -

∠MRS ≅ ∠MRO

Now, what that means is that ∠MRS is congruent to ∠MRO.

Thus, to understand this concept of equality or congruence, we can prove it since from the given image, we see that -

m∠MRS = m∠MRO = 90°

Since they are both right angles then we can say that the correct theorem is the definition of a right angle triangle.

m∠MRS + m∠MRO = 180°

It is seen that the angles form a linear pair and lie on the same plane.

Therefore, the correct postulate is linear pair.

To learn more about angle from the given link

https://brainly.com/question/2046046

#SPJ1

There are five cities in a country, and two are connected with one road that goes straight between them. How many roads would be in this country if there were 6 cities? 7 cities? And N cities? PLEASE SOLVE 20 POINTS!

Answers

For 6 cities, the number of roads would be 9. This is because each city must be connected to every other city, and there are 5 pairs of cities that need to be connected, which means 5 roads.

What is road?

Roads are a form of transportation infrastructure consisting of a prepared surface for vehicles to travel on. They are typically made from asphalt or concrete and are designed to provide a safe and efficient means of travel.

Then, the remaining 4 cities need to be connected, which means 4 more roads for a total of 9.
For 7 cities, the number of roads would be 12. This is because each city must be connected to every other city, and there are 6 pairs of cities that need to be connected, which means 6 roads. Then, the remaining 5 cities need to be connected, which means 5 more roads for a total of 12.
For N cities, the number of roads would be equal to N(N-1)/2. This is because each city must be connected to every other city, and there are N(N-1)/2 pairs of cities that need to be connected. For example, if N = 10, then 10 × 9 = 90 pairs of cities need to be connected, which means 90 roads.


To learn more about road
https://brainly.com/question/30174321
#SPJ1

Ifx >= 0 , which function, f(x) models the total monthly cost based on the number of songs a subscriber downloads?

Answers

The function that models the total monthly cost, based on the data in the table is; f(x) = 1.25·x + 30

What is a function?

A function is a rule, definition or law that specifies an output based on the input provided , such that each input is mapped to exactly one output

The function that models the monthly cost can be found as follows;

Number of songs downloaded [tex]{}[/tex]       Monthly cost

0 [tex]{}[/tex]                                                            30.00

1[tex]{}[/tex]                                                              31.25

2[tex]{}[/tex]                                                             32.50

3[tex]{}[/tex]                                                             33.75

4 [tex]{}[/tex]                                                            35.00

The required value of x is; x ≥ 0

The function, f(x) can be found by analyzing the data provided in the table as follows;

The first difference of the data in the Monthly cost column is; 35 - 33.75 = 33.75 - 32.5 = 32.5 - 31.25 = 31.25 - 30.00 = 1.25 = Constant

The (first) difference in the values in the Number of Songs Downloaded column is 1 (constant), therefore, the function is a linear function with a slope of 1.25

The value of the function which is the Monthly cost When the Number of Songs Downloaded is 0 is 30, therefore, the y-intercept is; c = 30

The function f(x) is therefore; f(x) = 1.25·x - 30

Learn more on functions here: https://brainly.com/question/29874896

#SPJ1

Given that the lines with arrows in figure 10. 29 are parallel , determine the sum of the angles a+b+c+d+e without measuring the angles. Explain your reasoning

Answers

The parallel line pairs, AB and BC ; CE and AD are present in the above figure. The sum of the angles a+b+c+d+e without measuring the angles is equals to the 180°.

We have the lines, AB and BC with arrows in above figure are parallel and we determine the sum of the angles a + b + c + d + e, without measuring the angles. Both of lines, AB and BC intersects each other at point B. Similarly, AD and CE lines also intersect. Properties of parallel lines are

Corresponding angles are equal.Vertically opposite angles are equal.Alternate interior angles are equal.Alternate exterior angles are equal.

Measure of angle, ECD = d

Measure of angle, CED = c

Measure of angle, ADE = b

Measure of angle, DAE = e

Measure of angle CBA = a ( corresponding angles)

Now, measure of angle ACE, ∠ACE= ∠CED = c ( alternating angles)

Similarly, ∠CAE = ∠CDE = e (alternating angles)

Now, measure of angle ACB = measure of angle BCE + measure of angle ACE

= c + d

Measure of angle CAB = measure of angle CAD + measure of angle DAB

= e + b

Sum of interior angles of a triangle is equals to the 180°. So, ∠ACB + ∠ABC + ∠BAC = 180°

=> c + d + e + b + a = 180°

Hence, required sum of angles is 180°.

For more information about parallel lines, visit :

https://brainly.com/question/26961508

#SPJ4

Complete question:

Given that the lines with arrows in above figure are parallel , determine the sum of the angles a+b+c+d+e without measuring the angles. Explain your reasoning

Help algebra 2 please answer 8 its urgent

Answers

The time it takes for the bacteria to reach 1,000,000 is given as follows:

t = 164.5 minutes.

How to obtain the time needed?

The number of bacteria after t minutes is given by the exponential function presented as follows:

P(t) = 1000e^(0.042t).

The population will reach 1,000,000 when:

P(t) = 1,000,000.

Hence the time needed is obtained solving the equation as follows:

1,000,000 = 1000e^(0.042t).

e^(0.042t) = 1,000,000/1,000

e^(0.042t) = 1000.

The inverse operation regarding the exponent e is the natural logarithm, hence we can isolate t as follows:

0.042t = ln(1000)

t = ln(1000)/0.042

t = 164.5 minutes.

More can be learned about exponential functions at https://brainly.com/question/30113628

#SPJ1

If the scale factor of a dilation is 8: 7, what kind of image does it create?

Answers

The required correct option out of given is B) This scale factor results in an enlarged image is correct.

What is scale factor of a dilation?

Finding the dilation's center point is the first step in determining the scale factor. Next, we measure the distances between the center point and various points on the preimage and the image. According to Math Bits Notebook, the scale factor is equal to the ratio of these lengths.

According to question:

When the scale factor of a dilation is greater than 1, the image is an enlargement.

In this case, the scale factor is 8:7, which means that every length in the image is 8/7 times larger than the corresponding length in the original figure. Therefore, the image is larger than the original figure.

So; B) This scale factor results in an enlarged image is correct.

To know more about scale factor visit:

brainly.com/question/30215119

#SPJ1

how many different 3 digit numbers can be formed from 1,3,5,7,9 if each number formed is greater than 300? distinguishable permutations

Answers

There are a total of 28 different 3-digit numbers that can be formed from the numbers 1,3,5,7,9 if each number formed is greater than 300. This can be found by using the formula for distinguishable permutations.

There are a total of 5 different 3-digit numbers that can be formed from the numbers 1,3,5,7,9 if each number formed is greater than 300. These numbers are 315, 357, 375, 397, and 359. This can be found by using the formula for distinguishable permutations, which is n!/(n-r)!, where n is the total number of items and r is the number of items chosen. In this case, n is 5 (the numbers 1,3,5,7,9) and r is 3 (the number of digits in each number formed).

The formula for distinguishable permutations is:

n!/(n-r)!

= 5!/(5-3)!

= 120/2

= 60

Therefore, there are a total of 60 different 3-digit numbers that can be formed from the number 1,3,5,7,9. However, we need to subtract the numbers that are less than 300, which are the numbers formed from the digits 1 and 3 in the hundreds place. There are 2 numbers in the hundreds place (1 and 3) and 4 numbers in the tens and ones place (3,5,7,9), so there are a total of 2*4*4 = 32 numbers less than 300. Subtracting these from the total gives us:

60 - 32 = 28

To learn more about  permutations here:

https://brainly.com/question/1216161#

#SPJ11

Owen is writing a program that will lock his computer for one hour if the incorrect password is entered more than five times. This set of instructions is an example of GIVING BRAINLIEST AND 25 POINTS


A a loop

B an algorithm

C debugging

D logical reasoning

Answers

The correct option is B an algorithm. If the wrong password is put in more than five times, Owen's computer will lock for an hour. To prevent this, he is building a programme. An illustration of a "algorithm" is this collection of instructions.

Explain about the algorithm?

An algorithm is a process used to carry out a computation or solve a problem. In either hardware-based or software-based routines, algorithms operate as a detailed sequence of instructions that carry out prescribed operations sequentially.

All aspects of information technology leverage algorithms extensively. A simple technique that resolves a recurring issue is typically referred to as an algorithm in computer science and math. Algorithms are essential to automated systems because they serve as specifications for processing data.An initial input and a list of instructions are used by algorithms. The input, which can be described as either words or numbers, is the first batch of information required to make judgements. The input data is subject to a number of calculations or instructions.

Know more about algorithm

https://brainly.com/question/30637743

#SPJ1

heeeellllllpppppp i havent done decimals and shaded parts in a whileeeee

Answers

Answer:

0.40 or 40% is shaded

Step-by-step explanation:

There are 40 shaded out of the 100 squares. Therefor, .40 is the answer

The drawing is composed of a rectangle and a semicircle. Find the area of the figure to the nearest unit. The number on top of the figure is 10 cm and the number on the side is 22 cm

not drawn to scale. If you can help me i would appreciate it!!!

Answers

The correct option is B, The area of the figure will be the sum of the area of the rectangle and half the area of the circle is 220 cm².

The rectangle has a length of 22 cm and a width of 10 cm, so its area is:

A_rectangle = length × width = 22 cm × 10 cm = 220 cm²

A rectangle is a four-sided polygon with opposite sides parallel and equal in length. The area of a rectangle is the measure of the space that it occupies and is given by the product of its length and width.

To find the area of a rectangle, one needs to multiply the length of the rectangle by its width. For example, if the length of the rectangle is 5 meters and its width is 3 meters, the area would be 15 square meters. This is because 5 multiplied by 3 is equal to 15. In general, the formula for the area of a rectangle is A = lw, where A is the area, l is the length, and w is the width. The units of the area will depend on the units of the length and width.

To learn more about Area of the rectangle visit here:

brainly.com/question/16309520

#SPJ4

Complete Question: -

The drawing is composed of a rectangle and a semicircle Find the area of the figure to the nearest unit:

Not drawn to scale.

a. 41 cm^2

b. 220 cm^2

c. 410 cm^2

d. 820 cm2

Solve the following system of linear inequalities: \[ \begin{array}{l} -2 x-y1 \end{array} \]

Answers

To solve the system of linear inequalities, we need to graph each inequality and find the region that satisfies both inequalities.

Here are the steps:
1. Graph the first inequality: -2x-y1. We can rearrange the equation to get y>-2x-1. This means that the region above the line y=-2x-1 is the solution to the first inequality.
2. Graph the second inequality: 3x+y<6. We can rearrange the equation to get y<-3x+6. This means that the region below the line y=-3x+6 is the solution to the second inequality.
3. The solution to the system of inequalities is the region that satisfies both inequalities. This is the region above the line y=-2x-1 and below the line y=-3x+6.
4. To find the coordinates of the vertices of the solution region, we can find the intersection point of the two lines. Setting the two equations equal to each other, we get: -2x-1=-3x+6. Solving for x, we get x=7. Substituting x=7 into one of the equations, we get y=-3(7)+6=-15. So the intersection point is (7,-15).
5. The solution region is the triangular region with vertices at (7,-15), (0,-1), and (2,0).

Therefore, the solution to the system of linear inequalities is the region with vertices at (7,-15), (0,-1), and (2,0).

To know more about linear inequalities refer here:

https://brainly.com/question/11897796

#SPJ11

what type of transformation has occurred from f(x) to g(x) on the graph
a)cant be determined
b)rotation
c) reflection
d) vertical translation

Answers

The solution is, it represents a vertical translation, and value is (d)  k = 8.

What is transformation?

Transformations are changes done in the shapes on a coordinate plane by rotation, reflection or translation.

here, we have,

Translations of various kinds are often most easily seen by comparing points where the graph has a distinctive feature. On this graph, that is the vertex.

When looking at the graph we can discard 2 of the options, these are rotation (as they are parallel, it is impossible to find a rotation axis) and reflection. We can observe that it occur a translation. To know what kind of translation happened, let's look at the y intercept of both lines.

For f(x) the y intercept is 0 and for g(x) the y intercept is -4, it means it occured a vertical translation down 4 units.

so, we have,

The value k in the equation ...

 g(x) = f(x) +k

represents a vertical translation by k units.

The vertex coordinates for f(x) and g(x) are ...

 f(x): vertex = (-3, -3)

 g(x): vertex = (-3, 5)

This means ...

 f(-3) = -3

 g(-3) = 5 = f(-3) +k = -3 +8  

⇒   k = 8

Hence, The solution is, it represents a vertical translation, and value is (d)  k = 8.

To learn more on transformation  click:

brainly.com/question/29791450

#SPJ1

I am needing some help with this​

Answers

The volume of the rectangular pyramid is 1200 m³, the volume of the oblique cone is 5890 ft³ while the volume of the triangular prism is 321.75 ft³

What is an equation?

An equation is an expression that shows the relationship between numbers and variables using mathematical operations like exponents, addition, subtraction, multiplication and division.

a) The volume of the rectangular pyramid is:

Volume = (1/3) * area of base * height

Substituting:

Volume = (1/3) * (15 m * 12 m) * 20 m = 1200 m³

b) The volume of the oblique cone is:

Volume = (1/3) * π * radius² * height

but radius = 30 ft / 2 = 15 ft,

Substituting:

Volume = (1/3) * π * 15² * 25  = 5890 ft³

The volume of the cone is 5890 ft³

c) The volume of the triangular prism is:

Volume = area of base * height

Substituting:

Volume = (1/2 * 9 ft * 5 ft) * 14.3 ft = 321.75 ft³

Find out more on equation at: https://brainly.com/question/2972832

#SPJ1

Paula bought $12.74$12.74 worth of $0.49$0.49 stamps and $0.21$0.21 stamps. The number of $0.21$0.21 stamps was six less than the number of $0.49$0.49 stamps. Solve the equation 0.49s+0.21(s−6)=12.740.49�+0.21(�-6)=12.74 for s�, to find the number of $0.49$0.49 stamps Paula bought.

Answers

The number of $0.49$ stamps Paula bought is s = (1274 - 49s / 21) + 6.

To solve the equation 0.49s + 0.21(s - 6) = 12.74 for s, we can multiply both sides by 100 to get:



49s + 21(s - 6) = 1274



Now, we can move the 21(s - 6) term to the left side of the equation and the 49s term to the right side of the equation. To do this, we will subtract the 49s from both sides of the equation, which yields:



21(s - 6) = 1274 - 49s



Next, we can divide both sides of the equation by 21 to isolate the (s - 6) term, resulting in:



(s - 6) = 1274 - 49s / 21



Finally, we can add 6 to both sides of the equation to solve for the number of $0.49$ stamps that Paula bought:



s = (1274 - 49s / 21) + 6



Therefore, the number of $0.49$ stamps Paula bought is s = (1274 - 49s / 21) + 6.

Learn more about equation

brainly.com/question/29657992

#SPJ11

Express the following as a linear combination of
u = (3, 1, 7), v = (1, -1, 6)
and w = (7, 5, 5).
(14,10,14)

Answers

To express (14, 10, 14) as a linear combination of u = (3, 1, 7), v = (1, -1, 6), and w = (7, 5, 5), we need to find values for a, b, and c such that:

(14, 10, 14) = a(3, 1, 7) + b(1, -1, 6) + c(7, 5, 5)

This can be written as a system of equations:

14 = 3a + b + 7c

10 = a - b + 5c

14 = 7a + 6b + 5c

We can solve this system of equations using any method we prefer, such as substitution or elimination. One possible solution is:

a = 1

b = 2

c = 1

Therefore, the linear combination of u, v, and w that gives us (14, 10, 14) is:

(14, 10, 14) = 1(3, 1, 7) + 2(1, -1, 6) + 1(7, 5, 5)

= (3, 1, 7) + (2, -2, 12) + (7, 5, 5)

= (14, 10, 14)

So, the linear combination is 1u + 2v + 1w.

Know more about linear combination here:

https://brainly.com/question/30341410

#SPJ11

The table shows the distance a runner has traveled y, in miles, x minutes after the start of a race. What is the runner's average rate of change, in miles per minute, from 60 to 120 minutes?

Time (min) Distance (miles)
0 0
30 3. 48
60 6. 42
90 9. 18
120 12. 0

Answers

The runner's average rate of change from 60 to 120 minutes is 0.093 miles per minute based on the given information.

Given that,

In the table, it shows the distance a runner has traveled.

The time (in minutes) and distance (in miles) values are as follows:

0 minutes: 0 miles

30 minutes: 3.48 miles

60 minutes: 6.42 miles

90 minutes: 9.18 miles

120 minutes: 12.0 miles

To find the runner's average rate of change from 60 to 120 minutes,

Use the formula:

The average rate of change = (Change in the distance) / (Change in time)

From the table,

At 60 minutes:

The runner has traveled 6.42 miles,

And at 120 minutes:

The runner has traveled 12.0 miles.

So, the change in distance is 12.0 miles - 6.42 miles = 5.58 miles.

The change in time is 120 minutes - 60 minutes = 60 minutes.

Now, we can calculate the average rate of change:

The average rate of change = 5.58 miles / 60 minutes

The average rate of change = 0.093 miles per minute.

Hence,

The runner's average rate of change from 60 to 120 minutes is 0.093 miles per minute.

To know more about average visit:-

brainly.com/question/24057012

#SPJ12

A large container of breath mints has a mass of 50 g. A small container has a mass of 32 g. What is the percent decrease from the mass of the large container to the mass of the small container?

Answers

Answer:

The percent decrease is 36%.

Step-by-step explanation:

Shaquana's car used 8 gallons of gas to drive 312 miles. Fill out a table of equivalent ratios and plot the points on the coordinate axes provided.

Answers

Answer: See attached.

Step-by-step explanation:

     First, we will find the unit rate by dividing.

312 miles / 8 gallons = 39 miles per gallon

     Then, we can fill out the other values using this unit rate.

39 miles / 39 miles per gallon = 1 gallon

3 gallons * 39 miles per gallon = 117 miles

       Lastly, we will use these two equivalent ratios we found above to fill out the table and then plot the points. See attached.

Which expression is equivalent to |a|≤5 ?

Responses

a ≥ –5 and a ≤ 5

a ≥ –5 and a ≤ 5

a ≥ –5 or a ≤ 5

a ≥ –5 or a ≤ 5

a ≤ –5 or a ≥ 5

a ≤ –5 or a ≥ 5

a ≤ –5 and a ≥ 5

Answers

the values of a that satisfy the inequality |a|≤5 are those that satisfy both a ≤ 5 and a ≥ -5. This is why the expression equivalent to |a|≤5 is a ≥ –5 and a ≤ 5.

What is expression ?

In mathematics, an expression is a combination of numbers, variables, and operators that can be evaluated to produce a value. It can be as simple as a single number or variable, or as complex as a long sequence of operations involving multiple variables and operators.


According to the given conditions :

The expression |a|≤5 means that the absolute value of a is less than or equal to 5. The absolute value of a number is its distance from zero on the number line, regardless of whether the number is positive or negative.

So, if |a|≤5, then a must be between -5 and 5, including both.

To see why this is true, consider two cases:

If a is greater than or equal to zero, then |a| = a, and so we have a ≤ 5.

If a is less than zero, then |a| = -a, and so we have -a ≤ 5, which is equivalent to a ≥ -5.

Therefore, the values of a that satisfy the inequality |a|≤5 are those that satisfy both a ≤ 5 and a ≥ -5. This is why the expression equivalent to |a|≤5 is a ≥ –5 and a ≤ 5.

To know more about expressions visit :

https://brainly.com/question/1859113

#SPJ1

Answer:

the values of a that satisfy the inequality |a|≤5 are those that satisfy both a ≤ 5 and a ≥ -5. This is why the expression equivalent to |a|≤5 is a ≥ –5 and a ≤ 5.

Step-by-step explanation:

What is expression ?

In mathematics, an expression is a combination of numbers, variables, and operators that can be evaluated to produce a value. It can be as simple as a single number or variable, or as complex as a long sequence of operations involving multiple variables and operators.

According to the given conditions :

The expression |a|≤5 means that the absolute value of a is less than or equal to 5. The absolute value of a number is its distance from zero on the number line, regardless of whether the number is positive or negative.

So, if |a|≤5, then a must be between -5 and 5, including both.

To see why this is true, consider two cases:

If a is greater than or equal to zero, then |a| = a, and so we have a ≤ 5.

If a is less than zero, then |a| = -a, and so we have -a ≤ 5, which is equivalent to a ≥ -5.

Therefore, the values of a that satisfy the inequality |a|≤5 are those that satisfy both a ≤ 5 and a ≥ -5. This is why the expression equivalent to |a|≤5 is a ≥ –5 and a ≤ 5.

To know more about expressions visit :

brainly.com/question/1859113

#SPJ1

A stadium has 10,500 seats and eight VIP boxes. The stadium is divided into 12 equal sections to premium sections and 10 standard sections. A seat at the premium section cost $48 per game. AC at the standard section cost $27 per game.  how many more seats are there in each section? If all the seats in the premium section are sold out for a game how many will the stadium get from those tickets sales? PLEASE HELP 44 POINTS!

Answers

There are a couple of questions here, so let's break them down one by one:

How many more seats are there in each section?
The stadium is divided into 12 equal sections. We know that there are 8 VIP boxes, which leaves 12 - 8 = 4 non-VIP sections. We also know that there are 10,500 seats in total. To find out how many seats are in each section, we can divide the total number of seats by the number of sections:
Number of seats per section = Total number of seats ÷ Number of sections
Number of seats per section = 10,500 ÷ 12
Number of seats per section = 875

So there are 875 seats in each section. To find out how many more seats there are in the premium section compared to the standard section, we need to know how many seats are in each type of section. We know that there are 4 non-VIP sections, which means there are:

4 premium sections
10 - 4 = 6 standard sections
To calculate the total number of seats in the premium sections, we can multiply the number of premium sections by the number of seats per section:

Total number of seats in premium sections = Number of premium sections x Number of seats per section
Total number of seats in premium sections = 4 x 875
Total number of seats in premium sections = 3,500

To calculate the total number of seats in the standard sections, we can multiply the number of standard sections by the number of seats per section:

Total number of seats in standard sections = Number of standard sections x Number of seats per section
Total number of seats in standard sections = 6 x 875
Total number of seats in standard sections = 5,250

The difference in the number of seats between the premium and standard sections is:

Difference in seats = Total number of seats in premium sections - Total number of seats in standard sections
Difference in seats = 3,500 - 5,250
Difference in seats = -1,750

This means that there are 1,750 fewer seats in the premium sections compared to the standard sections.

If all the seats in the premium section are sold out for a game, how much will the stadium get from those ticket sales?
We know that there are 4 premium sections, each with 875 seats, for a total of 3,500 seats. We also know that each seat in the premium section costs $48 per game. To calculate the total revenue from selling out all the premium seats, we can multiply the number of seats by the price per seat:
Total revenue = Number of seats x Price per seat
Total revenue = 3,500 x $48
Total revenue = $168,000

Therefore, if all the seats in the premium section are sold out for a game, the stadium will get $168,000 from those ticket sales.

Answer:

There are 875 seats. The stadium got $168,000 from the tickets.

Step-by-step explanation:

So there is more than one question so let's break them down one by one

1). How many seats are there in each section? So the stadium is divided into 12 sections and 8 are VIP boxes so 12 - 8 = 4 so there are 4 non-VIP sections. Now to find out how many seats are in each section we need to divide the number of seats by the number of sections which would be 10,500 ÷ 12 = 875.

2). If all the seats in the premium section are sold out for the game how many will the stadium get from those ticket sales? So first we need to find out how many seats there are in the premium section, we already know that there are 4 premium sections and we also know that there are 875 seats in each section. Multiply the number of sections by the number of seats 4 x 875 = 3,500 now multiply the number of seats by the cost of the seat 3,500 x $48 = $168,000

So the answers are $168,000 and 875 seats

Hope this helped :)

One year, an estimated 6,955 sandhill cranes migrated in March. The next March, an estimated 3,480 sandhill cranes migrated. To the nearest percent, what is the percent change in the number of migrating cranes from the first March to the next? Decreases should be negative numbers and increases should be positive numbers. Do not include the percent in your answer

Answers

Rounding to the nearest percent, we get that the percent change in the number of migrating cranes from the first March to the next is approximately -50%.

How is a percentage calculated?

To calculate the percentage, we must first divide the amount by the total value and then multiply the result by 100.

To find the percent change in the number of migrating cranes from the first March to the next, we can use the formula:

percent change = ((new value - old value) / old value) × 100%

where the old value is the number of migrating cranes in the first March and the new value is the number of migrating cranes in the next March.

Substituting the given values, we get:

percent change = ((3480 - 6955) / 6955) × 100%

Simplifying, we get:

\percent change = (-3475 / 6955) × 100%

percent change ≈ -50%

Rounding to the nearest percent, we get that the percent change in the number of migrating cranes from the first March to the next is approximately -50%.

To know more about percentage visit:

https://brainly.com/question/29306119

#SPJ1

This graph shows a proportional relationship.

What is the constant of proportionality?

Enter your answer in the box.

Answers

The constant proportionality between the x-coordinates and y-coordinates of these four points is 12.

What is Proportionality?

Proportionality refers to the relationship between two quantities that change in a consistent and predictable way. In a proportional relationship, when one quantity changes, the other quantity changes in a constant ratio or proportion to the first.

Assuming that you want to find the constant proportionality between the x-coordinates and y-coordinates of these four points:

First, we can calculate the ratios of the y-coordinates to the x-coordinates for each point:

For (3,36): y/x = 36/3 = 12

For (5,60): y/x = 60/5 = 12

For (6,72): y/x = 72/6 = 12

For (7,84): y/x = 84/7 = 12

We can see that the ratios are all equal to 12. Therefore, the constant proportionality between the x-coordinates and y-coordinates of these four points is 12.

Note that if you had asked for the constant proportionality between the differences in the y-coordinates and the differences in the x-coordinates of these points, the answer would be different. That constant proportionality is known as the slope of the line passing through these points.

To learn more about Proportional Relationship from the given link

https://brainly.com/question/28777033

#SPJ1

A cone has a volume of 2863.68 cubic meters and a height of 19 meters. What is its radius?

Answers

r ≈ 12 meters is your answer :)

Anyway, it is from this formula: V=πr^ 2   h/ 3

it is actually ≈ 11.99696m

The radius is 12 meters

4. [10 pts) 25 participants enter a sushi-making competition! Each of them must make 4 rolls with different proteins: a salmon roll, a tuna roll, a shrimp roll, and a crab roll, for a total of 100 rolls made in the competition. All of the rolls are distinguishable, even if they have the same protein (ex. a salmon roll is distinguishable from all other salmon rolls, as well as all the other rolls with different protein). According to the competition rules, salmon and tuna rolls are always made with white rice, while shrimp and crab rolls are always made with brown rice. The judges select a sushi roll uniformly at random from the 100 rolls. Without putting it back, they select a second roll uniformly at random from the remaining 99 rolls. What is the probability that both of the rolls are made by the same participant, or both have the same protein, or one has white rice and one has brown rice?

Answers

50 possible combinations

The probability that both of the rolls are made by the same participant is 25/99, since there are 25 participants and the second roll must be chosen from the remaining 99 rolls. The probability that both rolls have the same protein is 4/99, since there are 4 types of proteins and the second roll must be chosen from the remaining 99 rolls. Lastly, the probability that one roll has white rice and one roll has brown rice is 50/99, since there are 50 possible combinations of white and brown rice and the second roll must be chosen from the remaining 99 rolls.

Learn more about probability

brainly.com/question/30034780

#SPJ11

Other Questions
15. \( x=-5, \quad x=4, \quad x=-\frac{1}{2} \) factored form standard form 16. \( x=3, \quad x=-7, \quad x=0 \) (multiplicity of 2) factored form standard form\[ \text { 17. } x=\frac{2}{3} \text { what smaller 5.75 or 9/7 When the Europeans arrived in Central America, most countries fell to Spanish rule except ______, which became a British colony. i need help 16 divided by 6032 full solution A jet flying at 200 m/s north accelerates at a rate of 18.2 m/s for 15 seconds. What is the jet's final velocity? The RNA sequence GGAUCUCUUGUAGAUCUGUUCUCUAAACGAAC lies in a section of the COVID-19 viral genome that sets up translation, which is the process of reading the RNA to create the proteins the virus needs to survive.(a) Use the webserver to predict the lowest energy structure of the sequence. Print out a picture of it. (b)What do you think the effect will be of the RNA being longer than the stretch you just similated? (c) Design an RNA sequence that folds into a single stem-loop. Run it through the RNAfold server and print a picture of your folded design. consider a political discussion group consists of 6 democrates, 3 republicans, and 5 independents. suppose that two group members are randomly selected, in succession, to attend the political convention. find the probability of selecting a independent then a democrat According to the Kaplan-Meier plot, amplification of more than 10 copies of myc in neuroblastoma (see fig. 4-11b), decreases disease-free survival by more than 80% post-treatment. Explain two mechanisms that may contribute to gene amplification of myc? Even though both lens cells and liver cells have numerous transcription factors that are present in both colls, the lens cell makes the crystallin protein (not albumin), whereas the liver cell makes albumin (not crystallin) Which of the following explains this cell specificity?A. Different specific transcription factors made in each cell determine which genes are expressedB. At fertilization, specific colls are destined for certain functionsC. The activators needed for expression of the crystallin gene are present in all cells.D. The promoters are different for the different genes How does the author's discussion of different death rates help readers understand the spread of the Black Death? Use evidence from the text in your responsepls i need help!! a rock rolling down a slope from rest covers a distance of 4 m in the first second. What distance will it covers in 3 sec? 5 3/10 = 5 ?/50If anyone can please help me with the rest what happened to some native Americans during the Jackson presidency ? In order for following to be consistent,-3x +4y +7z =-4-11x +24y +kz = -452x -5y -8z =9solve for k ?please show full steps Air passes over the top of an airplanewing at 170 m/s, and over the bottomat 130 m/s. What is the difference inpressure between the top andbottom of the wing? Scarlett and Roger sipped their drinks on the porch, discussing all the things they still had to do before the Easter holiday. As Roger finished her last bit of burger, he sighed, "I'm stuffed." He complained of having a burning sensation in his lower chest. "You probably ate too much. How about taking some antacid?" asked Scarlett. "I use it every time I get indigestion." Roger left to search the medicine cabinet. He eventually felt better. Roger got his body test results the next day. He glanced at them briefly and put the paper in his bag. "Maybe later I will get a better sense of what all this means," he said.'Roger's test results(at rest and fasting levels)TEST Roger's Result Normal RangeHeart rate 90 beats/min 60-100 beats/minBlood pressure 138/95 mm/Hg 120/80 mm/HgTotal cholesterol 242 mg/dL create a journal from the perspective of a citizen living in paris during the french revolution CAN SOMEONE HELP ME PLEASE ASAP write three rations that are equivalent to 6/9 Is this a function? Why or why not? Explain your reasoning for each part. How did Claudette Colvin's social status contribute to why civil rights groups didn't use her actions to inspire the bus boycott? Has your social status ever influenced the way people treat you? If so, describe the experience.