How does carbon flow between photosynthesis and cellular respiration?

A. Photosynthesis produces carbon dioxide from glucose made by the process of
cellular respiration.

B. Cellular respiration produces carbon dioxide from glucose made by the process of
photosynthesis.

C. Photosynthesis produces carbon dioxide from ATP made by the process of cellular
respiration

D. Cellular respiration produces carbon dioxide from ATP made by the process of
photosynthesis.

Answers

Answer 1

Answer:

B. Cellular respiration produces carbon dioxide from glucose made by the process of

photosynthesis.

Explanation:

Answer 2

Photosynthesis is a process by which the autotrophic cells make food by absorbing and converting solar energy into chemical energy.

Cellular respiration is a process in which the oxygen molecules couple with food nutrients to generate energy, CO₂ and water.

The correct answer is:

Option B. Cellular respiration produces carbon dioxide from glucose made by the process of photosynthesis.

This can be explained as:

Photosynthesis uses the light energy from the sun to convert them into chemical energy.

The reactants of photosynthesis are sunlight, carbon dioxide and water molecules and the products produced are glucose and oxygen molecules.

The glucose produced by the process of photosynthesis is then utilized in cellular respiration to produce carbon dioxide.

Therefore, cellular respiration utilizes the glucose produced from photosynthesis.

To learn more about cellular respiration and photosynthesis follow the link:

https://brainly.com/question/3422103


Related Questions

shamash is the god of?

Answers

Sun shamash religion the god of the sun who with the mood god sin Sumerian nanna and ishtar sumerian Inanna the goddess of venus was part of an astral triad of divinities

How does starting the y-axis at 300 affect the graph? Remember that no matter what number you start labeling an axis at, you have to go up by the same amount for each subsequent tick mark!

Answers

Not sure if this applies to biology, but I’m using more statistics for this.

Basically, when you change the y-axis to 300, you are able to exaggerate the patterns on the graph. From afar, or starting the y-axis at 0, a person cannot easily identify the increases and decreases of CO2. However, with a y-axis at 300, you see these changes much more easily, so you can make accurate inferences and conclusions regarding the graph.

Hope this helps

why does the bimetallic strips bend when it been heated​

Answers

Answer:

The bimetallic strip is made of two metal strips, stuck together. One of the metals expands much more than the other when they are heated. This causes the strip to bend.

Explanation:

Which of the following best identifies a key component of the hydrologic cycle that powers the movement of water and is missing from the diagram?
A
Terrestrial animals
B
The Sun
С
Bacteria
D
Volcanoes

Answers

Answer: the sun

Explanation:

FIRST TO ANSWER IN DIFFERENT SENTENCES GETS BRAINLIEST

Answers

Answer:

1.An example of Batesian mimicry is when the yummy viceroy butterfly mimics the orange and black coloration of the distasteful monarch butterfly. ... Wasmannian mimicry occurs when the mimic resembles it's host (the model) in order to live within the same nest or structure. For example, several beetles closely resemble ants

2.Orange and black Monarchs (Danaus plexippus) are among the most familiar and easily recognizable butterflies found in the vivarium. Bright colors and distinctive wing patterns can be an example of aposematism, also known as a warning coloration.

Explanation:

please mark me as the brainliest answer and please follow me for more answers to your questions

In the forest there is a population of rabbits. Which of the following TWO are BIOTIC limiting factors of the
rabbit population?
1. holes to hide in for shelter
2. amount of plants to eat
3. competition with deer eating same plants
4. amount of water to drink
PLEASE HELP

Answers

1. holes to hide in for shelter

3. competition with deer eating the same plants

Which sphere contains the solid part of the Earth that is covered with non-living rock, soil, minerals, and landforms?


A. Biosphere


B. Geosphere


C. Hydrosphere


D. Cryosphere

Answers

B. Geosphere.
The geosphere includes rocks and minerals on Earth.

Answer:

b.

Explanation:

The form of cellular transport that expends the cell's energy is known as… *
Assisted transport
Passive transport
Active transport
Facilitated transport

Answers

Answer:

C- active transport

Explanation:

Because energy is required in this process, it is known as 'active' transport. Examples of active transport include the transportation of sodium out of the cell and potassium into the cell by the sodium-potassium pump. Active transport often takes place in the internal lining of the small intestine.

Answer: C. Active transport. In cellular biology, active transport is the movement of molecules across a cell membrane from a region of lower concentration to a region of higher concentration—against the concentration gradient. Active transport requires cellular energy to achieve this movement. Please mark brainliest!

when is hypothesis accepted as a theory by the scientific community

Answers

Answer:

A hypothesis is an idea that hasn't been proven yet. If enough evidence accumulates to support a hypothesis, it moves to the next step — known as a theory — in the scientific method and becomes accepted as a valid explanation of a phenomenon.

PLSSSS HELPPPPPP ME WITH THIS QUESTION
Explain the relationship between DNA structure and protein function?

Answers

Answer: Functionally, DNA maintains the protein-encoding information, whereas RNA uses the information to enable the cell to synthesize the particular protein. 1 Differences between DNA and RNA: DNA stores the genetic information, whereas RNA uses the information to help the cell produces the protein.

Explanation:

This type of vessel carries blood TO the heart:

Answers

Answer:

vein

Explanation:

carries blood vessels with no oxygen to the heart to get oxygen.

I’m not gif at this sorry

can someone help me solve #8 :(​

Answers

The type of cell being shown is Eukaryotic. This is evident because there is a nucleus in the picture. Since Prokaryotes do not have a nucleus, it is a Eukaryotic Cell.

in cell A, what is the structure labeled X?

Answers

Answer:

Yo i dont know but when someone does please help me bro

Explanation:

In cell A, the structure labeled X is a centriole.

Centrioles are cylindrical organelles found in animal cells, usually existing in pairs called the centrosome. They play a crucial role in cell division by organizing and forming the spindle fibers during the process of mitosis and meiosis.

Centrioles are involved in the separation of chromosomes, ensuring that each daughter cell receives the correct number of chromosomes.

Additionally, centrioles are essential for the organization of microtubules in the cytoskeleton, which provides structural support and maintains cell shape.

Their function in cell division and cellular organization makes centrioles vital components of animal cells.

Know more about centriole:

https://brainly.com/question/909799

#SPJ6

The cell membrane acts as a barrier between the cell and its environment. Which best describes the type of barrier that the cell membrane forms?

Answers

Answer:

B: Permiable but selective, like a wall with gates.

Explanation:

Peptide bonds in proteins can be broken down by the enzyme peptidase. Adrianordes a hamburger abd French fries for.lunch. He adds cheese and mayonaise to his hamburger abd then sits down to eat lunch with his friends. Which statement would most likely result from the action of peptidase in Adrians small intestine?
A. Lipid
B. Amino acid
C. Hydrocarbon
D. Glucose

Answers

Answer: Amino Acid

Explanation:

Tectonic plates are made up of rocks that are part of the?

Answers

Answer:

here ya go

Explanation:

A tectonic plate (also called lithospheric plate) is a massive, irregularly shaped slab of solid rock, generally composed of both continental and oceanic lithosphere. Plate size can vary greatly, from a few hundred to thousands of kilometers across; the Pacific and Antarctic Plates are among the largest.

how can humans increase the amount of endangered or extinct species

Answers

Human activities that influence the extinction and endangerment of wild species fall into a number of categories: (1) unsustainable hunting and harvesting that cause mortality at rates that exceed recruitment of new individuals, (2) land use practices like deforestation, urban and suburban development, agricultural

Answer:

educate family about endangered species in the area

recycle

buy sustainable products

reduce water consumption

reduce personal footprint

don't buy plastic products

pressure your civil servants

volunteer your time to protect wildlife

Give reason diffrent types of plant are available in riverside, lakeside​

Answers

Answer:

because it contain moist environment or land filled with different minerals. Such type of climate is favourable for mostly all kinds of plants.

Different types of plant are available in riverside, lakeside​ because of the

presence of nutrients and resources in them.

Plants are regarded as primary producers which produce their food through

the process of photosynthesis. Photosynthesis involves reaction between

carbondioxide and water to form glucose.

The availability of water favors photosynthetic processes which is why plants are present in such areas to increase food production.

Read more on https://brainly.com/question/9498584

Which of the following is true about DNA?
Adenine pairs with thymine, cytosine pairs with guanine
Adenine pairs with guanine, cytosine pairs with thymine
There are no base pairing rules in DNA. It does what it wants.
O Adenine pairs with cytosine, thymine pairs with guanine

Answers

Answer: 1) Adenine pairs with thymine, cytosine pairs with guanine

Explanation: Here’s a helpful tip ;) Think of it as apples to trees, cars to garage. Apples being adenine, trees being thymine. Cars being cytosine and garage being guanine.

Answer:

THE FIRST ONE

Explanation:

Name the vestigeal part of human alimentary canal? ​

Answers

Answer:

vermiform appendix
In human, vermiform appendix is the vestigial part of alimentary canal. Explanation: The vermiform appendix is a finger like structure which is connected to cecum, it is present in the junction of small and large intestine. This is known as the tail part of the human.

HOPED IT HELPED:) HAVE A NICE DAY<3

The James-Lange theory of emotion is different from the Cannon-Bard and
Schachter-Singer theories in that it:
A. does not acknowledge the importance of the body.
B. says the brain and body are both important.
ОО
C. says the thalamus routes the signals.
D. does not acknowledge the limbic system.

Answers

A. does not acknowledge the importance of the body.

What is James-Lange theory?

The James-Lange theory is a psychological theory of emotion that argues that emotions arise from physiological reactions to events in the environment.

According to the theory, emotions are not inherent or innate, but rather are learned through experiences with external stimuli. The theory proposes that when a person experiences an event, their body reacts with physical arousal, and it is this physical arousal that then gives rise to the subjective experience of emotion. For example, if someone is scared, their heart rate will increase, and it is the physical arousal caused by this increase in heart rate that produces the feeling of fear. The James-Lange theory has largely been discredited, but it continues to influence contemporary theories of emotion and to inform research in the field of psychology.

Learn more about James-Lange theory, here:

https://brainly.com/question/12836612

#SPJ1

The exchange of genetic material between homologous chromosomes when they are closely paired during meiosis is called?

Answers

The answer is: Crossing-Over

Select three functions of the cell membrane: *
:
A. It sends and receives messages to maintain homeostasis
B. It prevents anything harmful from entering the cell.
C. It creates separation between the cell and the outside.
D. It changes lipids into usable proteins for the cell.
E. It controls the movement of molecules in and out of the cell.
F. It holds all of the genetic material for the cell.

Answers

Answer:

B, C, E

Explanation:

Answer:

B,C,E

Explanation:

poriferons are called sessils because​

Answers

Answer:

Poriferans are sessilebecause they donot move from one place to another. They are fixed in a single place.

Explanation:

The meaning of sessile is fixed in one place or immobile. As poriferans donot move from one place to another. They are called sessile.

The name porifera means 'pore bearer' in Latin (a pore is a tiny hole). A sponge's body is covered by a skin, one cell thick. This skin has lots of small pores and a few large openings.


HAVE A GREAT DAYYY!!

What happens to an atom if it gains an electron? *

A.It becomes negative
B.It becomes neutral
C.It becomes positive
D.None of the above

Answers

Answer:

It would get more negatively charged.

Explanation:

What condition is caused by carbon dioxide, methane, and water vapor trapping heat in the Earth's atmosphere?
A biomagnification
B greenhouse effect
C photosynthesis
D transpiration​

Answers

B. Greenhouse effect

The condition that is caused by carbon dioxide, methane, and water vapor trapping heat in the Earth's atmosphere is known as the greenhouse effect. Thus, the correct option is B.

What is the Earth's atmosphere?

The earth's atmosphere may be defined as the significant presence of a layer of various gases that surrounds the whole planet. It is known that the Earth's atmosphere is composed of about 78% nitrogen, 21% oxygen, and one percent other gases.

Carbon dioxide, methane, and water vapor are considered greenhouse gases that ultimately capture the heat radiations from the sun and liberate the earth's atmosphere. As a result of this, the average temperature of the earth's surface has gradually increased for four to five decades.

This is all known as the greenhouse effect. The Greenhouse effect may be defined as the phenomenon of keeping the earth warm due to the presence of certain gases in the atmosphere that captures heat from the sun.

Therefore, the condition that is caused by carbon dioxide, methane, and water vapor trapping heat in the Earth's atmosphere is known as the greenhouse effect. Thus, the correct option is B.

To learn more about Greenhouse gases, refer to the link:

https://brainly.com/question/19521661

#SPJ6

What organelle are in red blood cells

Answers

Answer:

endoplasmic reticulum or mitochondria.

Explanation:

I think its that but I really hope this helps

Nucleus dna & endoplasmic reticulum or mitochondria is the correct answer

What act of Congress descried general organic principles that organic farmers, ranchers, and food processors must follow?


A)Organic Act of 1916

B)Organic Act 1801

C)NPS Organic Act

D)Organic Foods Production Act of 1990

Answers

Answer:

The correct answer is - option D) Organic Foods Production Act of 1990

Explanation:

The Organic Food Production Law or Act 1990 provides the general principles regarding the production, handling, and processing of organic products and must be followed by the farmers, ranchers, and food processors.

These principles include utilizing only approved materials, conserve natural resources and biodiversity, organic and processing farms, and many other rules and principles.

9. Which type of molecule (small or large) has an easier time diffusing in/out of the cell
membrane?

Answers

Answer:

small

Explanation:

I learned this in the 7that grade

what keeps earth’s temperature at the proper level for life

Answers

Answer:

greenhouse gases

Explanation:

all gases whose have three or more greenhouse gases :carbon dioxide (CO2), methane (CH4) and water vapor (H2O)

Other Questions
Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression? Read the poem. Then, select the correct answerexcerpt adapted fromI Wandered Lonely as a Cloudby William WordsworthI wandered lonely as a cloudThat floats on high o'er vales and hills,When all at once I saw a crowd,A host, of golden daffodils;Beside the lake, beneath the trees,Fluttering and dancing in the breeze,Continuous as the stars that shineAnd twinkle on the milky way.They stretched in never-ending lineAlong the margin of a bayTen thousand sawl at a glance,Tossing their heads in sprightly dance.For oft, when on my couch I lieIn vacant or in pensive moodThey upon that inward eyeWhich is the bliss of solitude:And then my heart with pleasure fills,And dances with the daffodils.Which word best describes the author's tone?Aadmiring.desperateOC somberOD playful \How does the allusion to Ham affect the meaning of the text?It emphasizes Douglass's desire to be free.It allows Douglass to discredit using the Bible to justify slavery.It highlights the similarities between enslaved people and those who enslave them.It compares slavery in the modern world to slavery in Biblical times. Write the definition of a function named count that reads all the strings remaining to be read in standard input and returns their count (that is, how many there are) So if the input was: hooligan sausage economy ruin palatialthe function would return 5 because there are 5 strings there. PLSS HELPP What is the value of x in this equation?4x 2(2x 2) = 2(2x 4) The company's profit will be exactly $0 if it makes and sells jackets. The company will make a profit if it makes and sells jackets, but will not make a profit if it makes and sells jackets why are Hispanics not a race in the u.s but only defined as ethnicity? Leann is learning about chemical reactions. She wants to create a model of a chemical reaction, so she is examining the information that she should include. What are the different components that she should include in her model? Choose the three that apply.A.the kinds of atoms that form during a reactionB.the kinds of molecules involved in the reactionC.the kinds of elements that make up a moleculeD.whether the molecules are products or reactantsE.whether the products have more mass than the reactants