A heterotrophic and chlorophyll protist
Food is ingested by protists in three forms. We produce, eat and digest their own organic molecules. Meat ingestion or english bacteria ingests protists. The cell wall and cell membrane are stretched to create an alimentary vacuolum around the foodstuff. Enzymes extract the food inside the food vacuole. At the other side, absorbent protists consume food molecules through their cell membrane by diffusion. In decomposition, absorbent protists play a crucial role. They are assumed to be essential decomponents. Light energy is used to make your own food by big farmers including photosynthetic protists.
----------------------
Hope this helps!
Brainliest would be great!
----------------------
With all care,
07x12!
Complete the following vocabulary exercise related to DNA replication.Match the words in the left-hand column with the appropriate blank in the sentences in the right-hand column.
1. During DNA replication, an open section of DNA, in which a DNA polymerase can replicate DNA, is called a_______ .
2. After replication is complete, the new DNAs, called_______ , are identical to each other.
3. The enzyme that can replicate DNA is called_______ .
4. _________are the short sections of DNA that are synthesized on the lagging strand of the replicating DNA.
5. The new DNA strand that grows continuously in the 5' to 3' direction is called the________.
leading strand
okazaki fragments
replication fork
DNA polymerase
daughter DNA
Answer:
1. During DNA replication, an open section of DNA, in which a DNA polymerase can replicate DNA, is called a replication fork.
2. After replication is complete, the new DNAs, called daughter DNA , are identical to each other.
3. The enzyme that can replicate DNA is called DNA polymerase.
4. Okazaki fragments are the short sections of DNA that are synthesized on the lagging strand of the replicating DNA.
5. The new DNA strand that grows continuously in the 5' to 3' direction is called the leading strand.
Explanation:
Hope it helps.
DNA replication is the process by which a cell makes an exact copy of its DNA.
It is a fundamental process in all living organisms that allows for the accurate transmission of genetic information from one generation to the next. During DNA replication, the double-stranded DNA molecule unwinds and separates into two individual strands.
Each of the original strands serves as a template for the synthesis of new DNA occurs. This replication process follows a semi-conservative mechanism.
The correct options are:
Replication forkDaughter DNADNA polymeraseOkazaki fragmentsLeading strandLearn more about DNA replication, here:
https://brainly.com/question/30111562
#SPJ6
Heart rate, stroke volume, and cardiac output are dependent on one another, these relationships can
provide many clues as to why Jean fainted during her workout session. Which of the following events
could lead to a decrease in cardiac output that could increase Jean's risk of fainting?
Jean did not like the idea of having an echo transducer in her esophagus, but the explanation of what could happen afterward was even more frightening. If Dr. Gardner saw no evidence of blood clots in the echocardiogram, she would then attempt to electrically shock Jean's atria back into a normal sinus rhythm. Direct current cardioversion (DCC) is a procedure that uses electrical current supplied by electrodes applied to the chest and back. Electrical current interrupts the abnormal rhythm, atrial fibrillation in Jean's case, by forcing cardiac muscle cells to contract simultaneously, and hopefully restores normal sinus rhythm. Jean would need to give her consent to proceed with this course of action.
Dr. Gardner discussed alternatives that included using medications to control Jean's heart rate. The main concern for using these medications is that they inherently lower blood pressure. Jean's blood pressure had been in the low normal range, which made this option a concern. Chemical cardioversion, using medication instead of electrical current, was also an option, but Dr. Gardner would still need to know that Jean's heart was free of blood clots. She did not like to use these medications, such as amiodarone, because they had a number of side effects that damaged the thyroid gland and lungs over time. Unfortunately, anticoagulation therapy with blood-thinning medication would be unavoidable if a blood
clot, or thrombus, was detected by echo. Thrombi form in nonfunctional atria, which explains how A Fib and CVA are related. The risk of CVA is greatly increased when normal sinus rhythm is restored, as thrombi can move into the left ventricle and then into the systemic circulation. Thrombi could occlude, or block, small blood vessels that would deprive the brain of blood flow, resulting in a CVA Anticoagulation therapy reduces the risk of blood clot formation and CVA in patients with AFib, Dr. Gardner explained Jean had a relatively low risk for developing CVA based on the medical history she shared with Dr. Gardner. It was possible that she might go home with just instructions to take a baby aspirin once per day for stroke prevention. The doctor did think that Jean should maintain a close relationship with her primary
Answer:
hmm this is confusing
Explanation:
is lactase exergonic
Answer:
The correct answer is - yes lactase action is exergonic.
Explanation:
Lactase is an enzyme located in the small intestine of mammals including humans, however it is produced by many organisms in their body. Lactase is an essential enzyme as it helps in the digestion of the whole milk by breaking down the lactose, sugar present in milk.
Exergonic reactions are the reaction that releases energy by the breaking of molecules in any reaction. Generally, catabolic reactions are exergonic lie lactase catabolizes the lactose present in milk and release energy.
Thus, the correct answer is - yes lactase action is exergonic.
The Coriolis effect contributes to ________.
a. an increase in eutrophication
b. increased acidic deposition
c. a reduction in eutrophication
d. global warming
e. global wind patterns
Describe the flow of energy from a glucose molecule to ATP during respiration, and compare this to the flow of energy from glucose to acids and alcohols during fermentation. Specifically, what carries the energy from glucose to ATP - what energy conversions must occur during the process. Compare the ATP production during respiration with ATP production during fermentation.
Answer:
Glycolysis is the first step of the cellular respiration in an organism which is metabolic pathway that is completed in the cytosol of the cell that leads to the converting glucose to the pyruvate in order to produce energy in form of ATP:
1. Glucose-6-phosphate is ---> fructose-6-phosphate
2. fructose-6-phosphate ---> fructose-1,6-biphosphate
3. fructose-1,6-biphosphate ---> glyceraldehyde-3-phosphate(GAP) and dihydroxyacetone phosphate (DHAP).
4. GAP is oxidised ----> 3-bisphosphoglycerate + NADH
5. 3-bisphosphoglycerate ----> 1,3-bisphophoglycerat
6. 1,3-bisphophoglycerate ----> 3-phosphoglycerate
7. 3-phosphoglycerate ----> 2-phosphoglycerate
8. 2-phosphoglycerate ----> phosphoenolpyruvate (PEP)
9. phosphoenolpyruvate to ADP ----> pyruvic acid + ATP
Formation of ATP occurs in both pathways or process that are respiration and fermentation. Fermentation is a catabolic pathway leads to the degradation of sugars (partial) that result in the gain of energy and this energy are absorbed in ATP. There are difference of the amount of energy or ATP produce in these process in respiration 38 ATP are produced whereas during fermentation only 2 ATP are produced.
In chickens, a condition referred to as "creeper" exists whereby the bird has very short legs and wings, and appears to be creeping when it walks. If creepers are bred to normal chickens, one-half of the offspring are normal and one-half are creepers. Creepers never breed true. If bred together, they yield two-thirds creepers and one-third normal. Propose an explanation for the inheritance of this condition.
Answer Explanation:
Due to technical difficulties, the answer and explanation for this problem are available in the attached file.
The following models show one large cell (A) and four small cells (B).
O
O
olo
O
00
ОО,
O
A
B.
Which of the following states why one of the models is better for moving
more nutrients in and out of the cell?
O A. A is better because it has more surface area.
The question is incomplete and the diagram is also not given. So the diagram is attached below and the complete question is as follows:
The following models show one large cell (A) and four small cells (B).
Which of the following states why one of the models is better for moving more nutrients in and out of the cell?
A. B is better because it has more surface area.
B. A is better because it has less surface area.
C. A is better because it has more volume.
D. B is better because it has more volume
Answer:
A. B is better because it has more surface area.
Explanation:
The movement of nutrients in a cell depends on the surface to volume ratio. More is the surface to volume ratio, better will be the movement of nutrients in and out of the cell.
In the given model, small cells (B) has more surface to volume ratio as surface area of B is larger, so, the model B is better for moving more nutrients in and out of the cell.
Hence, the correct option is "A".
Answer:
B has smaller cells but more surface area than A
Explanation:
B
Is your prediction supported by the membrane potential chart?
Answer:
The membrane potential of a resting neuron is primarily determined by the movement of K+start text, K, end text, start superscript, plus, end superscript ions across the membrane. ... Zero voltage across the membrane, as measured by a voltmeter with one electrode inside and one electrode outside the cell.
Answer:
Yes, it is. The chart shows that the initial charge of the neuron is negative. When the neuron is stimulated, sodium ions enter the cell. So, the voltage inside the cell changes to positive. When potassium ions move outward, the voltage decreases until it reaches its previous state.
Explanation:
The process of DNA replication is described. Identify the enzyme that participates in each part of the replication process. DNA partially unwinds as the hydrogen bonds between complementary bases are broken. This process is catalyzed by the enzyme
Answer:
Helicase
Explanation:
DNA replication is the process in which DNA makes copies of itself.
The process of DNA replication is supported by several enzymes.
The initial step of DNA replication is unwinding of double stranded DNA which is catalyzed by helicase enzyme. Helicase enzymes breaks the hydrogen bond between the DNA strands and prepare them for replication process.
Hence, the correct asnwer is "Helicase".
explain test for reducing sugar
Answer:
A food sample is dissolved in boiling water.
Explanation:
A small amount of Benedict's reagent is added and the solution begins to cool. In the next 10 minutes, the solution changes colour. if it turns blue, there is no glucose present in it.
As it is heated, it turns yellow. The hotter the colour of the reagent, the higher the concentration of reducing sugar. E.T.C.
There is more,e.t.c.
Hope this few helps.
Yellow dung flies (Scathophaga stercoraria) are diploid organisms with 12 chromosomes in their diploid cells. Without taking into account recombination, how many different genetic gametes can this fly generate based on the arrangement of its chromosomes in the metaphase plate during meiosis
In the given case, the sum of the number of gametes possible in the fruit fly is 2¹² or 4096.
Determination of the number of genetic gametes:
At metaphase I, the arrangement of chromosomes takes place at the equatorial plate and at the equator, the orientation of homologous pairs takes place randomly. This orientation helps in finding the genes found within a gamete as each of the gametes will get only one chromatid of a chromosome.
Now by independent assortment, the variation occurs within the gametes, which suggests that the alleles of distinct genes separate independently from one another at the time of cell differentiation. Due to independent assortment, the number of different kinds of gametes possible within the chromosomes can be determined by using the formula, 2ⁿ, where n is the number of chromosomes present within a set.
Thus, based on the given information, the number of chromosomes present in a fruit fly is 12. Thus, the sum of the number of gametes possible in the mentioned fruit fly is 2¹² or 4096.
Find out more information about determination of gametes here:
https://brainly.com/question/6760841
Environmental engineers minimize the impact of land development on the environment.
Please select the best answer from the choices provided
t or f
The correct answer is True
Explanation:
The focus of environmental engineering is to create technologies and solutions to prevent environmental pollution and destruction, and in this way protect human societies, as well as, natural ecosystems. This includes solutions to reduce the impact of land development that involves altering natural ecosystems to build houses and other human constructions. In this area, environmental engineers make the use of land for humans efficient and create models that are more friendly to the environment. Thus, the statement is true.
Answer:
T R U EExplanation:
just took the test on and got it right
In the diagram, how many angles are alternate exterior angles with angle 5?
Answer:
One.
Explanation:
The attached figure shows the diagram of the given question.
We need to find how many angles are alternate exterior angles with angle 5?
Exterior angle = Angle that is made outside of the shape
Alternate angle = an angle opposite of a transversal line of another angle.
From the figure, 8, 7, 9, 10, 12, and 11 are the angles that are on the same transversal. 8, 7, 9, 10, and 12 are just exterior. It means that 11 is the alternate exterior of angle 5. So, only one angle is alternate exterior angles with angle 5.
A certain strain of E. coli is constitutive for the enzymes for lactose metabolism. On an F' plasmid you have the choice of adding one (but only one) element of the lac system to make the bacteria a merodiploid for that element. Assume the original E. coli has wild-type structural loci. If your goal is to determine whether the lac operon is constitutive because of a mutant regulator OR because of a mutant operator, which one wild-type element of the lac operon would you add using sexduction?
a. operator region
b. regulator (repressor)
c. gene promoter region
d. structural genes
Answer:
The correct option is B: regulator (repressor)
Explanation:
A regulator gene would be required to control the expression by either increasing or decreasing the transcription of that particular gene. In doing so, the amount of protein product made by the gene can be regulated. In the wild-type case, the gene lacl is responsible for generating the mRNA which translates to a Lac repressor protein that binds at the operator region.
g The pH of the space between the inner and outer mitochondrial membrane is ______________ the pH of the mitochondrial matrix.
Answer:
lower than
Explanation:
The protons obtained from the spit of hydrogen atoms, to protons and electrons, (which was transported to the Matrix of the mitochondria by NADH and FADH2 ) are pumped by PMF into the intramembrane space.
The constant pumps by the PMF,due to the electron transport chains set up high concentration of Hydrogen ions in the intramembrane space.If pH is -log[H+] then the high the number of H+/protons,the stronger the acidity,and lower the pH of the medium.
This set up higher electrochemical gradient compare to the matrix.Thus H+ diffuses down the gradients into the matrix.
This generate energy needed for the synthesis of ATPs by ATPase synthase in the matrix
In the process of cellular respiration, glucose is broken down into simpler compounds. Respiration is carried on in the presence (aerobic) or absence (anaerobic) of free oxygen.
a. True
b. False
Answer:
a. True
Explanation:
Cellular Respiration is the process by which cells of all living organisms obtain the required energy for their metabolic activities. Respiration is a catabolic process whereby glucose is broken down to release Its high energy and used to synthesize a usable form of energy by the cell (ATP).
Cellular respiration occurs in living cells with oxygen (aerobic) or without oxygen (anaerobic). In aerobic respiration, three processes viz: Glycolysis, Kreb's cycle and Oxidative phosphorylation are involved. Oxygen is the final electron acceptor in the Electron transport chain of the Oxidative phosphorylation.
On the other hand, anaerobic respiration is employed by certain bacteria in the absence of oxygen. In anaerobic respiration, another final electron acceptor is used other than oxygen.
Both processes yield Adenosine triphosphate (ATP).
Which molecules are used to form cell membranes
Answer:
membranes and internal membranes — are made of glycerophospholipids, molecules composed of glycerol, a phosphate group, and two fatty acid chains. Glycerol is a three-carbon molecule that functions as the backbone of these membrane lipids.
Explanation:
PlZzzzz follow me
The citric acid is a stage of catabolism that oxidizes acetate into carbon dioxide and generates energy. There are eight enzymes involved in the citric acid cycle.
1. Which enzymes produce NADH as a product?
a. alpha-ketoglutarate dehydrogenase
b. succinate dehydrogenase
c. malate dehydrogenase
d. isocitrate dehydrogenase
2. Which enzymes produce carbon dioxide as a product? Select all that apply.
a. malate dehydrogenase
b. isocitrate dehydrogenase
c. succinate dehydrogenase
d. alpha-ketoglutarate dehydrogenase
3. Which enzymes produce coenzyme A as a product? Select all that apply.
a. fumarase
b. citrate synthase
c. succinyl-CoA synthesase
d. citraste synthase
4. Which enzymes have an alpha-keto acid substrate? Select all that apply.
a. fumarase
b. alpha-ketoglutarate dehydrogenase
c. citrate synthase
d. malate dehydrogenase
5. Which enzyme catalyzes a hydration reaction?
a. aconitase
b. fumarase
c. citrate synthase
Answer:
1.(a ) alpha-ketoglutarate dehydrogenase
(c) malate dehydrogenase
(d) isocitrate dehydrogenase
2. b. isocitrate dehydrogenase d. alpha-ketoglutarate dehydrogenase
3. b. citrate synthase (c) succinyl-CoA synthesase
4. b. alpha-ketoglutarate dehydrogenase c. citrate synthase d. malate dehydrogenase
5. a. aconitase
Explanation:
The citric acid cycle is responsible for the oxidation of acetyl-CoA produced from pyruvate from glycolysis. The citric acid cycle has eight steps requiring nine enzymatic reactions involving eight enzymes.
The enzymes in the citric acid cycle are: citrate synthase , aconitase, isocitrate dehydrogenase, alpha-ketoglutarate dehydrogenase , succinyl-CoA synthesase, succinate dehydrogenase , fumarase , and malate dehydrogenase .
1. The dehydrogenation reactions of isocitrate dehydrogenase, alpha-ketoglutarate dehydrogenase , and malate dehydrogenase produces NADH from isocitrate, alpha-ketoglutarate and malate respectively.
2. Oxidative decorboxylation (removal of carbon as CO₂) also occurs in the reactions of isocitrate dehydrogenase and alpha-ketoglutarate dehydrogenase to produce alpha-ketoglutarate and succinyl-CoA respectively.
3. Coenzyme-A (CoA-SH) is produced in the reactions of citrate synthase and succinyl-CoA sythetase to produce citrate and succinate respectively.
4. The enzymes alpha-ketoglutarate dehydrogenase has alpha-ketoglutarate as substrate , whereas citrate synthase and malate dehydrogenase has oxaloacetate as substrate. These substrates are alpha-keto acids.
5. Aconitase catalyzes the conversion of citrate to isocitrate by first a dehydration and then a hydration reaction.
A person who has Diabetes has difficulty controlling the glucose levels in their blood and must take Insulin to regulate it. Which characteristic of life do they need assistance with?
Based on the given information I believe this will help:
Insulin is a hormone made by the pancreas that allows your body to use sugar (glucose) from carbohydrates in the food that you eat for energy or to store glucose for future use. Insulin helps keeps your blood sugar level from getting too high (hyperglycemia) or too low (hypoglycemia).
If you have more sugar in your body than it needs, insulin helps store the sugar in your liver and releases it when your blood sugar level is low or if you need more sugar, such as in between meals or during physical activity.
If your body does not produce enough insulin or your cells are resistant to the effects of insulin, you may develop hyperglycemia (high blood sugar), which can cause long-term complications if the blood sugar levels stay elevated for long periods of time.
Treatment:
People with type diabetes cannot make insulin because the beta cells in their pancreas are damaged or destroyed. Therefore, these people will need insulin injections to allow their body to process glucose and avoid complications from hyperglycemia.
Which sphere does the frog belong to? atmosphere biosphere geosphere hydrosphere
Answer:
biosphere
Explanation:
The frog belongs to the biosphere -the vicinity of the planet wherein organisms live, inclusive of the floor and the air. An example of the biosphere is in which existence happens on, above, and beneath the floor of Earth.
Define the term biosphere in short?The biosphere is made of the components of Earth wherein life exists—all ecosystems. The biosphere extends from the private root structures of bushes to the darkish environments of ocean trenches, to lush rain forests, high mountaintops, and transition zones like this one, in which ocean and terrestrial ecosystems meet.
What is the role of the biosphere?The biosphere presents important environmental situations for survival. living organisms are required to adapt to the environment of the biosphere. The biosphere is home to biodiversity within ecosystems while imparting a reliable source of meals on the earth.
Learn more about the biosphere here: https://brainly.com/question/25750450
#SPJ2
The cardiac tissue has fewer T tubules and store less calcium than skeletal muscle. What is the outcome of these two traits
Answer:
The slow arrival of contraction or the slow onset of contraction.
Explanation:
The T tubules function in the transformation of the action potential from the sarcolemma to the sarcopasm reticulum.
In the skeletal muscles, it is located at the junction of the A and I bands but in the cardiac muscles, it is located only at the z discs thus giving rise to to T tubules.
The cardiac muscles also do not possess as much calcium as the skeletal muscles thus, its calcium ion must come from outside producing the slow arrival of contraction or the slow onset of contraction.
The cardiac tissue has fewer T tubules and stores less calcium than skeletal muscle, thereby the onset for muscle contraction is SLOWER in the heart than in skeletal muscle.
The sarcolemma is the plasma (excitable) membrane of muscle cells, which are surrounded by endomysial connective tissue.The T-tubules are invaginations of the sarcolemma that enter into the muscle cell in order to form interconnected networks.These tubules (T tubules) store intracellular calcium ions under the supervision of membrane depolarization through a voltage sensor channel (i.e., DHPR).In conclusion, the cardiac tissue has fewer T tubules and stores less calcium than skeletal muscle, thereby the onset for muscle contraction is SLOWER in the heart than in skeletal muscle.
Learn more in:
https://brainly.com/question/6763078
Which could best be used to explain why bacteria can infect a person very quickly? outer capsule binary fission protective covering genetic recombination
Answer:
The answer is binary fission.
Explanation:
Binary fission is the process of reproduction by bacteria in which they divide into two cells.
They do this about every 20-30 minutes, this fast rate of reproduction could be best be used to explain why bacteria can infect a person very quickly.
Answer:
B. Binary Fission
Explanation:
Um. BeCaUsE
Transcribe and translate the following strand.
CGTACGGGCAGGATCGGCGAACTGGA
Transcription: 1
(The answer for transcription must be in all caps; example: AAAAAAA)
Translation:
(The answer for translation must be in the following format: first letter capitalized and each amino
acid separated by a hyphen; example: Met-Met-Met-Met)
Second Base of mRNA Codon
С
A
G
UUU Phe
UUC Phe
UUA Leu
UUG Leu
UCU Ser
UCC Ser
UCA Ser
UCG Ser
UAU Tyr UGU Cys
UAC Тут UGC Cys
С
UAA STOPUGA STOPA
UAG STOP UGG Trp
CUU LCI
CUC Leu
CỦA LcU
CƯ Leu
CCU Pro
CCC Pro
CCA Pro
CCG Pro
CAU His
CAC His
CAA Gln
CAG Gln
CGU Ang
CGC Arg
CGA Arg
CGG Arg
First Base of mRNA Codon
Third Base of mRNA Codon
AUU Te
AUC le
AUA Ile
AUG Met
ACU Thr
ACC Thr
ACA Thr
ACG Thr
AAU Asn
AAC Asn
AAA Lys
AAG Lys
AGU Ser
AGC Ser
AGA Arg
AGG Arg
G
GUU Val
GUC Val
GUA Val
GUG Val
GCU Ala
GCC Ala
GCA Ala
GCG Ala
GAU Asp
GAC Asp
GAA Glu
GAG Glu
GGU Gly
GGC Gly
GGA Gly
GGG Gly
Pon-90A
Answer:
AAC Asn
AAA Lys
AAG Lys
AGU Ser
AGC Ser
AGA Arg
AGG Arg
G
GUU Val
GUC Val
GUA Val
GUG Val
GCU Ala
G
Match the following respiratory conditions to the
1. Emphysema
a. A condition in which an attack can trigger constri
2. Pneumonia
b. The inflammation of bronchioles in the lungs
3. Bronchitis
c. The buildup of fluid in the alveoli of the lungs
4. Asthma
d. A condition often caused by smoking, featuring d
Answer:
D
C
B
A
Alveoli
larynx
mucus
nitrogen
diaphragm
Air enters the body through the mouth or nose and passes through the pharynx and larynx. Then it travels down the trachea and branches through the bronchi into the two lungs. In the lungs, small alveoli are the site of gas exchange where carbon dioxide diffuses into the lungs for exhalation, while oxygen from the air diffuses into the capillaries surrounding the alveoli to be pumped throughout the body.
Explanation:
Emphysema is caused by smoking. Pneumonia is buildup of fluid in the alveoli of the lungs, bronchitis is inflammation of bronchioles in the lungs, and asthma is condition in which an attack can trigger constrict air passage. The correct match is 1-d, 2-c, 3-b, and 4-a.
What is respiration?The process by which cells shatter down sugar and obtain energy by using oxygen.
There are several conditions that can affect the respiratory conditions. Some can be listed as:
Smoking causes emphysema. Pneumonia is the accumulation of fluid in the alveoli of the lungs.Bronchitis is the inflammation of the bronchioles in the lungs.Asthma is a condition in which an attack can cause constrictions in the airways.Thus, the correct match is 1-d, 2-c, 3-b, and 4-a.
For more details regarding respiration, visit:
https://brainly.com/question/12605249
#SPJ5
new insecticide is advertised to kill more than 95% roaches upon contact. In a laboratory test, the insecticide was applied to 400 roaches and 384 died immediately after contact. Is this sufficient evidence to support the advertised claim?
Answer:
Yes! The Commercial is telling the truth that the product kills a good amount, but they are lying when they say it kills 95%. Because it kills 96%!
Explanation:
This is a great question to be asking!
With is experiment, instead of killing 95% of the roaches in the laboratory, it killed 96%. But, it is strange that the commercial did not say 96%. But, to me, maybe that because 95% looks more appealing to the broad audience, instead of a higher number?
Anyways! Hahaha, sorry for getting off topic, but all you need to do to figure this out is to set up a division equation!
Because only 384/400 died, that would be the equation. And when plugging that into a calculator you get 96%.
Fun fact! If the product had killed only 380/400 roaches, then the commercial would be telling the truth.
Michael, a new lab analyst, receives an email notifying him that his expected samples from a recent outbreak should be arriving soon. To prepare for his analysis, he decides to look into what type of diseases could be spread between animals and humans, as this is a new field for him. Michael has received limited information about the details of the outbreak from the epidemiologists that traveled to the site, but he does know that both animals and humans were infected by some type of virus. Michael looks through some of the lab manuals on how the samples will be handled once in the lab. While reading through these guidelines, he realizes that there are some terms he is not quite sure of. Below are sentences that reflect the terms that Michael had to acquaint himself with while reading through the published guidelines from his laboratory.
Please review the sentences below and fill in the blanks with the correct word(s).
A. arthropods
B. togaviruses
C. encephalitis
D. flaviviruses
E. zoonosis
1. A virus that is able to be transmitted via________ like ticks, flies, and mosquitoes is considered a(n)_______
2. Some arboviruses are able to move through the bloodstream and infect the brains of humans and arbovirus animals. This disease manifestation is called_________
3. A________ is a disease that can be transmitted from animals to humans.
4. Several encephalopathies, such as Eastern equine encephalitis and West Nile virus encephalitis, are caused by the_______ animals such as horses and birds. These viruses can infect humans and animals
1.A arthropods
2.C encephalitis
3.E zoonosis
4.C togaviruses
For 2 minutes write down every sound you hear. Write in dot points.
What was the quietest noise? What was the loudest noise? Did you have any distractions?
an example could be:
quietest noise - a clock
loudest noise - family members talking
distractions - a TV show
Which joint performs adduction, abduction, horizontal adduction and abduction, medial and lateral rotation, and circumduction?
Answer:
The ball and socket joint is the one that can perform all those movements.
Explanation:
Ball and socket joint, also know as spheroid joint are types of joints where the part of the bone that articulates with the other bone has a spheroidal shape or ball shape that fits in the depression of the other bone, which means that they are a synovial enarthrosis joint. It has a wide range of movements because it can move in the transverse, vertical, and sagittal axes. An example of this joint is the shoulder, between the scapula and the humerus.
Answer: Sholder and hip
Explanation:
g 1 molecule of glucose is catabolized to pyruvate and then acetyl-coA. All the acetyl-coA enters the citric acid cycle. How many molecules of NADH are produced from the citric acid cycle only (do not include NADH from glycolysis or the pyruvate dehydrogenase complex in your calculation.) You must answer as a number i.e if you think the answer is 12, you must enter 12, not twelve.
Answer:
6NADH
Explanation:
In the kreb's cycle NAD is reduced during the reduction of 6-carbon citrate to 5 carbon Alpha-Ketoglularate.
The second is produced during the conversion of 5carbon alpha ketoglutarate to succinate. Lastly in the conversion of fumirate to oxoloacetate;another NADH is formed.
However, since two pyruvate enters the Kreb's cycle therefore 6NADH(three NADH per cycle of Citric) are produced for each molecule of glucose that is broken down from glycolysis.
Remember,each glucose molecule goes through 2 cycles of Kreb.
Futhermore co-enzyme FADH2 are also produced,with 2 molecules per 1 glucose.
These Co-ezymes transfer hydrogen ions,into the matrix of the mitochondria,where is is splits to protons and electrons.
The electrons formed the ETC,which produce PMF for transporting protons into the intramembranes for electrochemical gradients needed to generate energy for ATP s synthesis,by ATP synthase.
.
Drag each tile to the correct box. Lucia is walking barefoot in her yard. She accidentally steps on a nail. How will her nervous system work to generate a reaction? Arrange the events chronologically.
Answer:
First the proprioceptors found in the tissues will capture tissue damage and the presence of a continuity solution in the skin, then these receptors will activate the afferent pathway, which is the pathway of pain, which is sensory.
This stimulus that ascends to the central nervous system activates the "flight" mechanism in the face of pain (it is also known as the withdrawal mechanism).
It is in this way that a stimulation is sent to the alpha motor neuron in the form of an action potential as an efferent pathway to the skeletal muscles of the foot and the damaged leg, so that an automatic and involuntary muscle contraction is generated in a matter of millisemas of second after the damage, so the foot is removed from the damage area.
Explanation:
The withdrawal mechanism is a reflex that the human acquires before pain, that is why it is the muscular contraction is automatic and fast once the pain occurs.
So as a summary: 1 - the proprioceptors of the damaged tissue are activated 2- the signal of tissue damage rises as afferent to the CNS 3- the CNS responds by activating a signal that will be sent by interneuronal connections to the alpha motor neuron 4- the signal arrives as potential of action to the alpha motor neuron that innervates the muscles of the surrounding area to which it is damaged 5 - the muscles contract, generating the withdrawal of the limb.