Find the value of x. The angles are in the picture! Please quick I will give Brainliest!

Find The Value Of X. The Angles Are In The Picture! Please Quick I Will Give Brainliest!

Answers

Answer 1

Answer:

x = 50

Step-by-step explanation:

The interior angles of a Pentagon adds up to 540.

90 + 125 + 125 + 2x + 2x = 540

340 + 4x = 540

4x = 200

x = 50


Related Questions

Required information Skip to question A die (six faces) has the number 1 painted on two of its faces, the number 2 painted on three of its faces, and the number 3 painted on one of its faces. Assume that each face is equally likely to come up. If the die were loaded so that the face with the 3 on it were twice as likely to come up as each of the other five faces, would this change the value of P(odd number)

Answers

Answer:

The change to the face 3 affects the value of P(Odd Number)

Step-by-step explanation:

Analysing the question one statement at a time.

Before the face with 3 is loaded to be twice likely to come up.

The sample space is:

[tex]S = \{1,1,2,2,2,3\}[/tex]

And the probability of each is:

[tex]P(1) = \frac{n(1)}{n(s)}[/tex]

[tex]P(1) = \frac{2}{6}[/tex]

[tex]P(1) = \frac{1}{3}[/tex]

[tex]P(2) = \frac{n(2)}{n(s)}[/tex]

[tex]P(2) = \frac{3}{6}[/tex]

[tex]P(2) = \frac{1}{2}[/tex]

[tex]P(3) = \frac{n(3)}{n(s)}[/tex]

[tex]P(3) = \frac{1}{6}[/tex]

P(Odd Number) is then calculated as:

[tex]P(Odd\ Number) = P(1) + P(3)[/tex]

[tex]P(Odd\ Number) = \frac{1}{3} + \frac{1}{6}[/tex]

Take LCM

[tex]P(Odd\ Number) = \frac{2+1}{6}[/tex]

[tex]P(Odd\ Number) = \frac{3}{6}[/tex]

[tex]P(Odd\ Number) = \frac{1}{2}[/tex]

After the face with 3 is loaded to be twice likely to come up.

The sample space becomes:

[tex]S = \{1,1,2,2,2,3,3\}[/tex]

The probability of each is:

[tex]P(1) = \frac{n(1)}{n(s)}[/tex]

[tex]P(1) = \frac{2}{7}[/tex]

[tex]P(2) = \frac{n(2)}{n(s)}[/tex]

[tex]P(2) = \frac{3}{7}[/tex]

[tex]P(3) = \frac{n(3)}{n(s)}[/tex]

[tex]P(3) = \frac{1}{7}[/tex]

[tex]P(Odd\ Number) = P(1) + P(3)[/tex]

[tex]P(Odd\ Number) = \frac{2}{7} + \frac{1}{7}[/tex]

Take LCM

[tex]P(Odd\ Number) = \frac{2+1}{7}[/tex]

[tex]P(Odd\ Number) = \frac{3}{7}[/tex]

Comparing P(Odd Number) before and after

[tex]P(Odd\ Number) = \frac{1}{2}[/tex] --- Before

[tex]P(Odd\ Number) = \frac{3}{7}[/tex] --- After

We can conclude that the change to the face 3 affects the value of P(Odd Number)

Doy 10 puntos al que me responda esto:

2 fracciones equivalentes a:

7/6

8/3

5/4

Answers

Doy 10 puntos al que me responda esto:

2 fracciones equivalentes a:

Responda:

7/6

5/4

Answer:

7/6

5/4

Step-by-step explanation:

A study is conducted to investigate whether customer satisfaction is greater among computer companies that offer tech support versus those that do not offer tech support. A random sample of 50 customers are selected from among those that purchased computers that offer tech support. A separate random sample of 40 customers are selected from among those that purchased computers that do not offer tech support. The study found that the mean satisfaction rating was significantly greater among customers that purchased computers that offer tech support. Which of the following is the best description of this study?
A) An experiment using a completely randomized design.
B) An experiment using a randomized block design.
C) An experiment using a matched pairs design.
D) An observational study using a simple random sample.
E) An observational study using a stratified sample.

Answers

Answer:

E) An observational study using a stratified sample.

Step-by-step explanation:

This study is not an experiment because the customers were not subjected to any treatment but just observation from those selected. Also, the sampling method used was stratified sampling because we see that random samples were selected independently from two unique populations which are population of those that purchased computers and those that offer tech support.

Therefore the correct option is E.

Subjective probability has little use in the real world.
True
False

Answers

Answer:

false

Step-by-step explanation:

simplify using order of operations
5.3-6.3+5²​

Answers

IT SHOULD BE 24 IF NOT IM SRRY

Answer:

5.3−6.3+52

=−1+52

=−1+25

=24

If a person walks 1/4 mile in 10 minutes, how far will that person walk in one hour?

Answers

Answer:

1.5 miles

Step-by-step explanation:

1.5 miles

Since there are 60 minutes in an hour, the person will walk 60/10 = 6 times as much in 1 hour. If that person can walk 1/4 mile in 10 minutes, she will walk (1/4)*6 = 1.5 miles in 1 hour.

Answer:

1 and 1/2 mile

Step-by-step explanation:

The equation would be 1/4 times 6/1 because 60 divided by 10 is 6

1/4 times 6/1 is 6/4

simplified the answer is 1 and 1/2

I need help with this one also

Answers

b
hope this helped !!

I need to find the width of the rectangle

Answers

The answer is 8 let get it !!

Teresa runs each lap in 5 minutes. She will run less than
55 minutes today. What are the possible number of laps
she will run today?

Answers

Answer:

11 laps i think

Step-by-step explanation:

mark brainliest and have a great day!

Diego is trying to find the value of x in 5 times x = 35.

Answers

Answer:

The answer is 7

Step-by-step explanation:

5x7=35

Answer:

7

Step-by-step explanation:

What you would have to do is divide the 5 and 35 to get 7


Alex is thinking of a number.
She divides it by 100
The answer has one more in the hundreds column than in the
tens column
The total of the digits is 15
What could the number be?

Answers

33.50% is the answer

What is the best first step in solving the equation 3 + 36x = 5?

Answers

Flip the question around. Ex: 36x = 5-3

In a college of exactly 2920 students, exactly 55 % are male. What is the number of female students?

Answers

Answer:

1305 female students

Step-by-step explanation:

Total no. of students = 2900

Percentage of students male = 55%

No. of students male = 55% of 2900

                                 = 55/100*2900

                                 = 1595

No. of female students = 2900 - 1595 = 1305

Answer:

1314

Step-by-step explanation:

First I found the number of male students

[tex]\frac{x}{2920} =\frac{55}{100} \\\\160600=100x\\1606=x[/tex]

Then I subtracted the number of male students from the number of total students

[tex]2920-1606=1314[/tex]

Could someone explain this to me ??

Answers

Answer: C) 12

========================================================

Explanation:

Refer to the diagram below. I'm using the points A,B,C,D,E to help label the triangles, and to label the angles as well.

For now, let's focus on triangle DEC.

The top most angle is given as D = 65. Note how the angles D and E are opposite the congruent lines (marked with the red single tickmarks). This means that angles D and E are congruent to one another. So E = 65 as well. This is shown in the diagram below.

For now we don't know what angle C is, so we'll call it y. More specifically, we'll make y the measure of angle DCE.

For any triangle, the three angles always add to 180

y+65+65 = 180

y+130 = 180

y = 180-130

y = 50

So angle DCE is 50 degrees.

-------------------------------

Now we move onto triangle ABC.

Because angles DCE and ACB are vertical angles, this makes angle ACB 50 degrees also. Effectively, anywhere you see a 'y' in the diagram below, replace it with 50.

So triangle ABC has the three angles y = 50, y = 50 and 7x-4

We can solve for x like so

y+y+(7x-4) = 180

50+50+(7x-4) = 180

7x+96 = 180

7x = 180-96

7x = 84

x = 84/7

x = 12

This points to choice C as the final answer.

write
14/17
as a decimal rounded to the nearest tenth.

Answers

Answer:

0.8235 is a decimal and 82.35/100 or 82.35% is the percentage for 14/17.

Step-by-step explanation:

hope it helps

The decimal rounded to the nearest tenth is,  8.235×10⁻¹

What is Simplification?

Simplification in mathematical terms is a process to convert a long mathematical expression in simple and easy form.

The given term is 14/17,

Simplify this term, by dividing,

14/17 = 0.823529411

The decimal rounded to the nearest tenth is,  8.235×10⁻¹.

To know more about Simplification on :

https://brainly.com/question/2804192

#SPJ2

PLEASE HELP!!!!
Which equations could be used to solve
for x? Circle all that apply.


A. x – 58 = 129
B. x + 58 = 129
C. 180 – 129 − 59 = x
D. 129 – 58 = x
E. (180 – 129) – 51 + x = 180

Answers

Answer:

dang

Step-by-step explanation:

A. x – 58 = 129 yes

B. x + 58 = 129 no

C. 180 – 129 − 59 = x yes

D. 129 – 58 = xyes

E. (180 – 129) – 51 + x = 180no

hope this helps

Answer:

E

Step-by-step explanation:

The pool shown below is drawn to scale. If the actual diameter of the pool is 16 feet, then what is the actual depth of the pool?

Answers

Answer:

10.67

Step-by-step explanation:

Rachel has 75 books.18 of the books are comics books. The rest of books are novels.
a. What percentage of the books are novels?
b. What percentage of her books are comics?

Answers

Answer:

Novels: 24% Comics: 76%

Step-by-step explanation:

Divide 18/75= 0.24= 24% to find percent of novels

Subtract 100-24= 76 to get the remaining percent

Or

Subtract 75-18= 57 (to get the number of comics she has)

Divide 57/75= 0.76= 76% to find percent of comics

Mildred has three little girls, Margo, Delilah, and Gertrude. If she randomly chooses one of them to clean the kitchen after dinner, what is the probability that she will NOT pick Gertrude

Answers

1/3 let me know if I’m right

help plsssss rnnnrnnnn

Answers

Answer:

66

Step-by-step explanation:

Since the triangels are similar, 3x+18=4x+2.

Let's solve that.

3x+18=4x+2

16=x

THIS IS NOT THE VALUE OF THE ANGLE! We have to plug x into one of the equations to find the answer.

3(16)+18=66

which is greater 1/4 or 3/4 ? ​

Answers

Answer:

3/4

Step-by-step explanation:

We have two fractions, 1/4 and 3/4. Lucky they have the same denominator :

Which is the number under the line, which means their capacity is the same amount. Now we just have to see the greater numerator (the number above the line).

So since 3 is greater than 1

Therefore 3/4 is the answer

Answer:

You answer would be 3/4

Step-by-step explanation:

3/4 is larger than 1/4.

Help me out please I need you’re help with this question ✏️

Answers

the answer to your question might be (B).

What is the algebra representation of the
transformation in the diagram
below?*

Answers

Answer:

Abstract

We give a recursion formula to generate all the equivalence classes of connected graphs with coefficients given by the inverses of the orders of their groups of automorphisms. We use an algebraic graph representation to apply the result to the enumeration of connected graphs, all of whose biconnected components have the same number of vertices and edges. The proof uses Abel’s binomial theorem and generalizes Dziobek’s induction proof of Cayley’s formula.

Answer:

180° rotation about the origin

Step-by-step explanation:

As per diagram, the coordinates of the points changed:

(x, y) → (-x, -y)

This rule is 180° rotation about the origin

Please help I need a answer

Answers

Answer:

b) 2 20/100

Step-by-step explanation:

2.20 = 2 2/10

so, if that fraction is multiplied by 10/10 then it's still the same.

Answer: Not here is the answer

Step-by-step explanation:

To write 2.20 as a fraction you have to write 2.20 as numerator and put 1 as the denominator. Now you multiply numerator and denominator by 10 as long as you get in numerator the whole number.

2.20 = 2.20/1 = 22/10

And finally we have:

2.20 as a fraction equals 22/10

Find mZB in the parallelogram.
B
С
51°
A
D
7
mZB=

Answers

Answer:

plzz show me the diagram otherwise I can't help you sorry!!!!

remember reality is an illusion the universe is a hologram buy gold bye

Answers

Answer: Say what is this

Answer:

this is possibly real so good luck

Step-by-step explanation:

Which of the following equations represents a line that is perpendicular to the line represented by x + 2y = 6 and passes through the point (3 , –4)?

Answers

Answer:

y=2x-10

Step-by-step explanation:

First change to equation into slope intercept form

2y=-x+6

y=-1/2x+3

slope=2 (beacause it is perpendicular)

y--4=2(x-3)

y+4=2x-6

y=2x-10

Javier says that when you add a positive and a negative number, the sum is always
negative. Is Javier's statement true or false? Explain your reasoning.
Hint: Try making an equation that is true and one that is
false.

Answers

Answer:

False

If the positive number is greater than the negative, then it will stay positive.

say the question is 5+ -3.

The answer would be 2

Stephen wants to purchase a laptop, but he does not have enough money in his bank account to pay for one.
Which of these is not an option for Stephen?

Answers

Answer:

A

Step-by-step explanation:

If you have no money in the bank the debit card won't work

Answer:

its C

Step-by-step explanation:

store A sells boxes of rice for $2.50 each

Answers

Answer:

I need more information

Step-by-step explanation:

Answer:

i need to see the full word problem to help you

Step-by-step explanation:

Other Questions
Loss of voluntary control over urination is calledO dialysisO incontinenceO neurogenic bladderO urgencyPrevious what is one sixth of the product of four and nine table saws you can use with __ or __ but not both at the same time HELP PLS What is the value of the x variable in the solution to the following system of equations? (1 point)4x + 2y = 6x - y = 3O-15-22 Do violence and alcohol have anything to do with each other? If so, what do they have in common? If they don't have anything in common, tell me why? (SAT Prep) Find the value of x. He math team does practice drills that each last hour. In February the team did practice drills for a total of 24 hours. How many practice drills did the math team do in feburary PLEASE ANSWER FAST!!!!Explain why the U.S. decided to change its goal from protecting western settlements to attacking Native Americans and forcing them onto reservations. i just asked my best friend if she talk ab me behind my back bc i kinda have trust issues and i dont get what she means by this.... do yall have any idea? Write and solve an equation to determine the value of x in the figure. a. 3x 84; 252 b. 3x 84; 28 c. 3x 84; 84 d. 3x 84; 81 Find the value of x. Plsssssss Help!!!!Look at the map. How might the Gupta empire have been able to flourish through trade? Identify geographic features to support your answer. transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC Hey can somebody get this for me been stuck for five min Select the correct answer from the drop-down menu.What is implied by the underlined section in the passage?Caesar's statement to Brutus implies that imagine being in spanish course on edmentum its pretty hard not gonna kap features of liberalism theory A square has side lengths as shown in the picture and a perimeter of 54.8 centimeters. Write an equation to find the measure of each side length. On January 1, Year 1, a contractor began work on a $3.2 million construction contract that is expected to be completed in 3 years. The contractor concludes that it is appropriate to recognize revenue over time using the input method based on costs incurred (cost-to-cost method). At the inception date, the estimated cost of construction was $2.4 million. The following data relate to the actual and expected construction costs: Year 1 Year 2 Year 3 Costs incurred $720,000 $1,170,000 $1,110,000 Expected future costs $1,680,000 $810,000 $0 For this long-term construction contract, the contractor needs to calculate the estimated dollar values of the revenue and gross profit (loss) to be recognized each year. Complete the contractor's long-term construction contract using the information above. Write the appropriate amounts in the associated cells. Indicate losses by using a leading minus (-) sign. Round all amounts to the nearest dollar. If no entry is necessary, enter a zero (0). Revenue Gross profit (loss) Year 1Year 2 Need help with english class