Enter the coordinates of the vertex of the graph of y=2(x+5)^2

Answers

Answer 1

Answer:

The vertex is ( -5,0)

Step-by-step explanation:

The vertex form of a parabola is

y = a( x-h) ^2 +k

where ( h,k) is the vertex

y=2(x+5)^2

y=2(x - -5)^2 +0

The vertex is ( -5,0)

Answer 2

Answer:

vertex = (- 5, 0 )

Step-by-step explanation:

The equation of a parabola in vertex form is

y = a(x - h)² + k

where (h, k) are the coordinates of the vertex and a is a multiplier

y = 2(x + 5)² , that is y = 2(x + 5)² + 0 ← is in vertex form

with (h, k) = (- 5, 0 )


Related Questions

Someone help quick!!!

The diagram shows several points and lines. Which statements are true based on the diagram? Select two options.

A. Points K, M, and N are collinear
B. Points J, K, and Q are collinear
C. Points are is the intersection of the line KN and the line MQ
D. Find JQ, KM, and MQ all
intersect at point K
E. There is only one line that can be drawn through points L and P

Answers

Answer:

B, E

Step-by-step explanation:

J, K, Q are all on the same line: collinear

You can draw only one line through L and P

Answer:

b,e

Step-by-step explanation:

e2020

In the picture down below

Answers

Answer:

b

Step-by-step explanation:

The answer is b because we are looking for opposites

The opposite of +x is -x

While the opposite of -3 is +3

with this, we can switch them around.

this gives us the inverse of 3-x

Please help mee What is the smallest positive integer whose proper divisors add up to more than the integer itself?

Answers

Answer:

12

Step-by-step explanation:

The proper divisors of 12 are

1 2 3 4 6

Add those together you get 16

5/16 = 15/18 is proportion

Answers

Answer:

  False

Step-by-step explanation:

In a proportion, the two fractions are equal. Here the denominators are different for the same numerator, so the fractions are not equal. The given expression is not a proportion.

Fredo has a coupon for $1.00 off the price of a loaf of bread at the grocery store.After he arrived at the store,he found out the bread had already been marked down $2.00.what is the total discount on the price of the bread.

Answers

Answer:

$3 discount

Step-by-step explanation:

If Fredo originally had the markdown as $0 (meaning no change), then he arrived at the store, seeing the markdown was $2, the current markdown is $2.

Now that he has an extra $1 off, he gets 2+1 = $3 off the bread.

Hope this helped!

HELP JOHN CHEN I need help

Answers

Answer

B. I and IV

Explanation

For it to classify as a function, it has to be a mapping of one-to-one or many-to-one.

The only answers which are applicable here are I and IV

Answer is B.

For the inequality y+4x≤x2+2, where is the graph shaded and is the curve solid or dotted?

Answers

Answer:

The graph shaded outside the parabola and the curve is solid.

Step-by-step explanation:

The given inequality is  

[tex]y+4x\leq x^2+2[/tex]

It can be rewritten as

[tex]y\leq x^2-4x+2[/tex]

The sign of inequality is [tex]\leq[/tex], so the curve is a solid line.

The related equation of line is

[tex]y=x^2-4x+2[/tex]

Table of values is

x          0          2          4

y          2         -2          2

Plot these points and draw a U-shaped curve.

Check the equality for (0,0).

[tex]0\leq (0)^2-4(0)+2[/tex]

[tex]0\leq 2[/tex]

This statement is true. So, (0,0) lies in the shaded portion.

So, shade the graph outside the parabola.

Coffee is sold in two different sized canisters. The smaller canister has a diameter of 9 cm and a height of 12 cm. The larger canister is double the size of the small canister (i.e., the diameter and height are doubled). Calculate the volume and surface area of each canister and compare the results of doubling the dimensions.

Answers

Answer:

Below

Step-by-step explanation:

The canister has a cylindric form

The volume of a cylinder is given by the following formula :

V= r^2 * Pi *h

H is the heigth and r os the radius(half of the diameter)

Let Pi = 3.14

●●●●●●●●●●●●●●●●●●●●●●●●

V= 3.14*4.5^2 * 12

V= 763.02

V = 763 cm^3(after rounding to the nearest unit)

●●●●●●●●●●●●●●●●●●●●●●●●

The surface area of a cylinder is given by the followong formula:

Sa = 3.14*r^2*2 + Pi*d*h

r is the radius, d the diameter and h the heigth

Let Pi= 3.14

Sa= 3.14*4.5^2*2 + 3.14*9*12

Sa= 466.29 cm^2

Sa= 466 cm^2 ( after rounding to the nearest unit

●●●●●●●●●●●●●●●●●●●●●●●●

The dimensions of the second canister are the double of the first one

V= r^2*Pi*h

V= 9^2 *3.14*24

V= 6104.16 cm^3

V= 6104 cm^3 (after rounding to the neatest unit)

Sa= 2*3.14*r^2+ 3.14*d*h

Sa= 2*3.14*9^2 + 3.14*24*18

Sa= 1865.16 cm^2

Sa= 1865 cm^2 (after roundong to the nearest unit)

●●●●●●●●●●●●●●●●●●●●●●●●

The volume and the surface area of the second canister are bigger than the first one

Divide the second volume by the first one :

V2/V1= 6104/763 = 8

We deduce that the voulme of the second canister is greater 8 times than the first one

Do the same for the surface area

Sa2/Sa1 = 1865/466 = 4.002 = 4 (after rounding to the nearest unit)

The second surface area is greater 4 times than the first one

Answer:

Yeah, what they said above.

Step-by-step explanation:

plz help me 3y+x=7
4x-2y=0​

Answers

Answer:

x = 1

y = 2

Step-by-step explanation:

3y +   x = 7       first equation

-2y + 4x  = 0      second equation

multiplying by -4 the first equatión

-4(3y + x = 7)

-4*3y -4*x = -4*7

-12y -4x = - 28

and sum the second equation:

-12y -  4x = -28

- 2y - 4x  =  0

-14y   -  0  =  -28

-14y = -28

y = -28/-14

y = 2

from the first equation:

3y + x = 7

3*2 + x = 7

6 + x = 7

x = 7 - 6

x = 1

Check:

from the second equation:

4x - 2y = 0

4*1 - 2*2 = 0

4 - 4 = 0

Logan Chivery owns her own car. Her june monthly interest was $300. The rate is 8 1/2 percent. Logans principal balance at the beginning of June is $42,335.14.

Answers

Logan Chivery owns her own car. Her June monthly interest was $300. The rate is 8.5 percent. Logan's principal balance at the beginning of June is: (Use 360 days-do not round the denominator.)

A. $42,353.14

B. $42,335.14

C. $2,335.14

Answer: A. $42,353.14

Step-by-step explanation:

When taking a loan, we have to pay interest. The Simple Interest Formula is:

Simple Interest (I) = Principal (P) × Interest Rate (r)

Principal (P) is the borrowed amount.

Interest Rate (r) is the percent of the principal to be paid.

Time (t) is the length of time that money is borrowed.

If Logan Chivery has the monthly interest of $300  at a rate of 8.5% per year, first, we have to convert the year rate to the month of June rate.

30 days = 8.5÷360÷30 = 0.7083333333 interest rate

Then, find the Principal by using the formula

Simple Interest (I) = Principal (P) × Interest Rate (r)

4,2352.94×0.7083333333÷100=299.99

What are the zeros of the function y = 2x2 + 5x+2 ?
pls helppp!

Answers

Answer:

answer is a

Step-by-step explanation:

zeros are x intercepts

Answer:

A

Step-by-step explanation:

(2x+1)(x+2)

so

2x=-1

x=-1/2

x=-2

A

One number is 5 times another. If their
difference is 96, find the numbers.

Answers

Answer:24

Step-by-step explanation:

24*5=120.

So the difference between 120-24=96.

The required number, one number is 5 times another and their difference is 96 is 24 and 120.

One number is 5 times another. If their difference is 96, To find the numbers.

What is arithmetic?

In mathematics, it deals with numbers of operations according to the statements.

Let the number be x and y
According to the first condition,
One number is 5 times another.So,
y = 5x

Following the second condition,
their difference is 96. So,
y - x = 96 - - - - - (1)
Now put y = 5x in the above equation
5x - x = 96
4x = 96
x = 96/4
x = 24
Now put x = 24 in y = 5x
y = 5*24
y = 120

Thus the required number, one number is 5 times another and their difference is 96 is 24 and 120.

Learn more about arithmetic here:

brainly.com/question/14753192

#SPJ5

Jason is playing a trivia game with his friends. At the end of each round, his score updates to the square of 1 less than the previous round’s score. If he has 8 points in the first round, which of the following recursive formulas can be used to determine his score at the end of future rounds? Assume that the number of rounds is unlimited, and n is the number of rounds.

Answers

Answer:

8+n^2

Step-by-step explanation:

Answer:

f(n+1)=(f[n]-1)^2, where f(1)=8

Step-by-step explanation:

"it appears your explanation includes a link" so you don't get an explanation

Solve the system algebraically. 2x+ y - 10 = 0 x - y - 4 = 0 What is the value of y? 1/3 2/3 14/3

Answers

Answer:y = 2/3

Step-by-step explanation:

2x + y = 10

x - y = 4

-----------------add

3x = 14

x = 14/3

x - y = 4

14/3 - y = 4

-y = 4 - 14/3

-y = 12/3 - 14/3

-y = -2/3

y = 2/3 <==

Answer:

2x + y = 10

x - y = 4

-----------------add

3x = 14

x = 14/3

x - y = 4

14/3 - y = 4

-y = 4 - 14/3

-y = 12/3 - 14/3

-y = -2/3

y = 2/3 <==

Step-by-step explanation:

Using leaner combination method what is the solution to the system of linear equations 7x-2y=-20 and 9x+4y=-6

Answers

Answer:

x = -2 and y = 3

Step-by-step explanation:

In linear combination method we try one of the variables from bopth of equations by

first making the variable equal in vlaue

then either subtracting or adding the two equation as required to eliminate the variable.

_____________________________________________

7x-2y=-20   equation 1

and 9x+4y=-6   equation 2

we see that y has

has value -2 and +4

4 = 2*2

thus, if we multiply equation1 with 2 we will give value for variable y as 4y and hence y can be eliminated easily.

7x-2y=-20  

multiplying the LHS and RHS with 2

2(7x-2y)=-20 *2

=> 14x - 4y = -40   eqaution 3

now that we have got 4y

lets add equation 2 and equation 3

  9x +4y=   -6

+14x - 4y = -40

________________________________

=> 23x + 0 =  -46

x = -46/23 = -2

Thus, x = -2

substituitinng x = -2 in 7x-2y=-20

7*-2 -2y=-20

=> -14 -2y = -20

=> -2y = -20+14 = -6

=> y = -6/-2 = 3

Thus, y = 3

solution is x = -2 and y = 3

PQRS is a parallelogram. Find the values of a and b. Solve for the value of c if c = a + b.

A. 5
B. 14
C. 0
D. 7

Answers

Answer:

a = 7

b = 7

c = 14             [Correct option is B. 14]

Step-by-step explanation:

Since the shape is a parallelogram, to solve this problem, use some of the properties of a parallelogram:

(i) Opposite sides are parallel and congruent. Being congruent means the sides are identical. In other words, they have the same length.

From the diagram, this means that sides PQ and SR are identical. i.e

=> PQ = SR

=> 6a + 10 = 8a - 4          [collect like terms and solve]

=> 14 = 2a

=> a = 7

(ii) Opposite angles are congruent. Angles PQR and PSR are identical. i.e

<PQR = <PSR = (9b + 2)°

Also,

<SPQ = <SRQ = (18b - 11)°

(iii) Consecutive angles are supplementary. The sum of any two angles that are not opposite to each other is 180°. i.e.

<SPQ + <PQR = 180°

<PQR + <QRS = 180°

<QRS + <RSP = 180°

.

.

.

Also,

<PSR + <SPQ = 180°      

(9b + 2)° + (18b - 11)° = 180°        [expand bracket and solve for b]

9b  + 2 + 18b - 11 = 180

27b - 9 = 180

27b = 189

b = 7

Now, since a = 7 and b = 7;

c = a + b = 7 + 7 = 14

Therefore;

a = 7

b = 7

c = 14

Let $f(x)=x+5$ and let $g(x)=x^2+1$. Let $p(x)=g(x)+f(x)$ and let $q(x)=g(x)-f(x)$. Find $p(x)\cdot q(x)$.

Answers

Answer:

The data that we have is:

f(x) = x + 5

g(x) = x^2 + 1

p(x) = g(x) + f(x) = (x^2 + 1) + (x + 5) = x^2 + x + 6.

q(x) = g(x) - f(x) =  (x^2 + 1) - (x + 5) = x^2 - x - 4

We want to find  p(x)*q(x)

well, we can replace:

p(x)*g(x) = (g(x) + f(x))*(g(x) - f(x))

Now, you can recall the relationship:

a^2 - b^2 = (a + b)*(a - b)

then we have that:

(g(x) + f(x))*(g(x) - f(x)) = g(x)^2 - f(x)^2

now we can replace g(x) and f(x) by the expressions that we know:

g(x)^2 - f(x)^2 = (x^2 + 1)^2 - (x + 5)^2

now we can simplify this:

(x^2 + 1)^2 - (x + 5)^2 = (x^4 + 2*1*x + 1^2) - (x^2 + 2*5*x +5^2)

= x^4 + 2*x + 1 - x^2 - 10x - 25

= x^4 - x^2 - 8*x - 24

p(x)*q(x) = x^4 - x^2 - 8*x - 24

Answer:

x^4+x^2-10x-24

Step-by-step explanation:

A 5-column table has 4 rows. The first column has entries A, B, C, Total. The second column is labeled X with entries 15, 5, 30, 50. The third column is labeled Y with entries 5, 8, 15, 28. The fourth column is labeled Z with entries 10, 7, 5, 22. The fifth column is labeled Total with entries 30, 20, 50, 100. Which two events are independent?

Answers

Answer:

hey! it's A and X on edge :)


Tins of milk each of volume 77cm^3 and weight 170g
were packed into an empty carton of volume 1540cm^3
and weight 5ooo g.

How many tins of milk can be packed to fill the carton ?
What is the weight of the carton when packed with the tins of milk?

Answers

Answer:

1.  20 tins of milk

2.  Weight of the Carton = 8,4kg ot 8400g

Step-by-step explanation:

Given

Volume of a Tin = 77cm³

Weight of a tin = 5000g

Volume of Empty Carton = 1540cm³

Weight of Empty Carton = 5000g

Calculating the number of tins of milk

To do this, we have to make use of the given volumes;

And this is done as follows;

[tex]Number = \frac{Volume\ of\ Empty\ Carton}{Volume\ of\ a\ Tin}[/tex]

Substitute  77cm³ for Volume of a Tin and 1540cm³ for Volume of an Empty Carton

[tex]Number = \frac{1540cm^3}{77cm^3}[/tex]

[tex]Number = 20[/tex]

Hence, 20 tins of milk will filled the empty carton

Calculating the weight of the Carton after filled with tins of milk

This is calculated as thus;

Total Weight = Weight of Empty Carton + Weight of Tins of Milk

Substitute 5000g for Weight of Empty Carton

Total Weight = 5000g + Weight of Tins of Milk

_________________________________________

Calculating Weight of Tins of Milk

Since 20 tins of milk will fill the empty carton, the

Weight of Tins of Milk = 20 * Weight of 1 Tin of Milk

Weight of Tins of Milk = 20 * 170g

Weight of Tins of Milk = 3400g

_________________________________________

Substitute 3400g for Weight of Tins of Milk

[tex]Total\ Weight = 5000g + 3400g[/tex]

[tex]Total\ Weight = 8400g[/tex]

In Kilograms:

[tex]Total\ Weight = 8.4kg[/tex]

Please answer this in two minutes

Answers

Answer:

[tex] x = 6.6 [/tex]

Step-by-step explanation:

Given ∆WXY,

<X = 15°

<Y = 23°

y = 10

x = ?

To find side x, use the Law of sines as shown below:

[tex] \frac{x}{sin X} = \frac{y}{sin Y} [/tex]

Plug in the values of y, Y, and X

[tex] \frac{x}{sin 15} = \frac{10}{sin 23} [/tex]

[tex] \frac{x}{0.2588} = \frac{10}{0.3907} [/tex]

Cross multiply

[tex] x*0.3907 = 10*0.2588 [/tex]

Divide both sides by 0.3907 to solve for x

[tex] \frac{x*0.3907}{0.3907} = \frac{10*0.2588}{0.3907} [/tex]

[tex] x = \frac{2.588}{0.3907} [/tex]

[tex] x = 6.624 [/tex]

[tex] x = 6.6 [/tex] (to nearest tenth)

please hellppp please someone help me fast​

Answers

I believe it’s A, a scale factor of 2.

I hope this helps!

Find the product.

7xy(3x2y3)

PLEASES HELP!!! ASAP!!!

Answers

Answer:

21x³y^4

Step-by-step explanation:

7xy(3x^2y^3)=

21x³y^4

Answer:

21x^3y^4

Step-by-step explanation:

Multiply each term:

21x^3y^4

Plz mark me brainliest!!

Simplify (8j3 − 10j2 − 7) − (6j3 − 10j2 − j + 12).

Answers

Answer:

Step-by-step explanation:

8j^3-10j^2-7-6j^3+10j^2+j-12

2j^3+j-12

7th grade-Post-test Summer Sc...
Show all steps
ܝ
Which of the following pairs are like terms? Select all that apply.
11a and 13a power of 2
18k and 18b
7x and 16x

17yz and 12y

9pq and 8qp

Answers

Answer:

9pq, 8qp, and 7x, 16y

Step-by-step explanation:

these pairs have the same variable and exponent. To be a like term, you have to have same variables and same exponents, so therefore 11a and 13a^2 can't be like terms.

What does x equal in the equation 4x + (−3) = 5x + 3?

Answers

Answer:

x = -6

Step-by-step explanation:

First write the equation.

4x + -3 = 5x + 3

The isolate x in the equation. Add -4x to both sides.

4x + -3 + -4x = 5x + 3 + -4x

-3 = x + 3

Then add -3 to both sides.

-3 + -3 = x + 3 + -3

-6 = x

Now you have the value of x = -6.

Cheers.

Answer:

             x = -6

Step-by-step explanation:

4x + (−3) = 5x + 3

          +3             +3

        4x  = 5x + 6  

          -5x       -5x

         -x  =  6

            ÷(-1)     ÷(-1)    

           x = - 6

WILL GIVE BRAINLEIST!!!!!

Find the surface area of the right triangular prism shown below.

Answers

Answer:

144 units²

Step-by-step explanation:

Surface area of a traingular prism is given as:

Area = 2(B.A) + P*L

Where,

B.A = base area of the triangular prism = ½*b*h

b = base of the triangular base = 4 units

h = height of the triangular base = 3 units

Base Area (B.A) = ½*4*3 = 2*3 = 6 units²

P = Perimeter of triangular face = sum of all sides the triangle = 3 + 4 + 5 = 12 units

L = length or height of prism = 11 units

Plug in all values into the formula for surface area of triangular prism = 2(B.A) + P*L

[tex] Area = 2(6) + 12*11 [/tex]

[tex] = 12 + 132 [/tex]

[tex] Surface Area = 144 [/tex]

Surface area of the triangular prism = 144 units²

NEED HELP NOWWW Which of the following is a monomial?
O A. 9/x
O B. 20x - 14
O C. 11 x^2
D. 20^9 - 7x

Answers

Answer: C

Step-by-step explanation:

A monomial is a expression where in it is x to the power of something, and x cannot be a denominator

What is the solution to this system of linear equations? 3x – 2y = 14 5x + y = 32 (3, 5) (6, 2) (8, –1) (14, –18)

Answers

Answer:

work is shown and pictured

The solution to the system of linear equation is (x, y) = (6, 2)

3x - 2y = 14 (1)

3x - 2y = 14 (1)5x + y = 32 (2)

From (2)

y = 32 - 5x

Substitute y = 32 - 5x into (1)

3x - 2y = 14 (1)

3x - 2(32 - 5x) = 14

3x - 64 + 10x = 14

13x = 14 + 64

13x = 78

x = 78/13

x = 6

Substitute x = 6 into (2)

5x + y = 32 (2)

5(6) + y = 32

30 + y = 32

y = 32 - 30

y = 2

(x, y) = (6, 2)

Read more:

https://brainly.com/question/2159099

Find the domain of each function: g(x)= 1/x−9

Answers

Answer:

x ∈ R, x ≠ 9

Step-by-step explanation:

Given

f(x) = [tex]\frac{1}{x-9}[/tex]

The denominator of f(x) cannot be zero as this would make f(x) undefined.

To find the value that x cannot be, equate the denominator to zero and solve for x

x - 9 = 0 ⇒ x = 9 ← excluded value

Thus the domain is x ∈ R, x ≠ 9

Choose the best estimate for the division problem below
6.7 /0.6
A. 16
B. 15
C. 11

Answers

Answer:

11

Step-by-step explanation:

6.7 / .6

Multiply top and bottom by 10

67/6

66/6 = 11 so this is close to 11

the answer i believe is C which is 11

Step by step just divide man shouldnt be hard
Other Questions
An education researcher claims that 58% of college students work year-round. In a random sample of 400 college students, 232 say they work year-round. At alphaequals0.01, is there enough evidence to reject the researcher's claim? Complete parts (a) through (e) below. It is a well-known fact that Dr. Barnes rides a skateboard, sometimes even on campus. Suppose that Dr. Barnes selects a skateboard by first picking one of two skateboard shops at random and selecting a skateboard from that shop at random. The first shop contains two "rad" skateboards and three "gnarly" skateboards, and the second shop contains four "rad" skateboards and one "gnarly" skateboard. What is the probability that Dr. Barnes picked a skateboard from the first shop if he has selected a "gnarly" skateboard? What the answer to the question If a circle has a diameter with endpoints of (-3, 0) and (5, 4) then the equation of the circle is? Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code. B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein. C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein. D) Both B and C are possible outcomes. g A spontaneous process is one in which: A. releases a large amount of heat B. may happen (is possible) C. will rapidly approach equilibrium D. will happen quickly Based on the function F(x) = x^4 - 3x^3+ x^2 +2 and the graph of G(X) below,which of the following statements is true? The goal of a statement of purpose is: 62(1+2) isn't that should be 1 , cause in the calculator it said 9 but the order is the parenthisis/brakets first ?? so it should be like 2 times 3 then 66 which gives 1 . Which of the following pitches is a non-chord tone for the I chord in G major? - G - B - A - D When a negative amount is in the base period and a positive amount is in the analysis period (or vice versa), a meaningful percent change cannot be calculated.A. TrueB. False A cookie recipe requires 3 teaspoons of baking soda for 36 cookies. If the baker would like to make 480 cookies, how much baking soda will be required? a13.33 teaspoons b12 teaspoons c40 teaspoons d108 teaspoons The flesh of infants may be used asgloves and summer boots Swift objects to eating girls as old as 14because they would serve better asbreeders, and because people wouldobject that it is "a little bordering oncruelty"Although there are many suffering"aged, diseased," or injured people,nothing needs to be gone for thembecause they are already dying "as fastas can be reasonably expected"Poor Irish tenants, who have already soldtheir crops and cattle to pay the rent,will now be able to pay by selling theirchildren Jerry solved the system of equations. x minus 3 y = 1. 7 x + 2 y = 7. As the first step, he decided to solve for y in the second equation because it had the smallest number as a coefficient. Max told him that there was a more efficient way. What reason can Max give for his statement? The variable x in the first equation has a coefficient of one so there will be fewer steps to the solution. The variable x in the second equation has a coefficient of 7 so it will be easy to divide 7 by 7. The variable y in the second equation has a coefficient of 2 so it will be easy to divide the entire equation by 2. The variable x in the second equation has the largest coefficient. When dividing by 7, the solution will be a smaller number. Probability of landing on even # on a spinner; probability of rolling an odd # on a die The amount of flow through a solenoid valve in an automobile's pollution-control system is an important characteristic. An experiment was carried out to study how flow rate depended on three factors: armature length, spring load, and bobbin depth. Four different levels (low, fair, moderate, and high) of each factor were chosen, and a single observation on flow was made for each combination of levels.A) The resulting data set consisted of how many observations?B) Is this an enumerative or analytic study? Explain. Simplify each expression. 6mn3 -mn2 + 3mn3 +15mn2?? Read the following excerpt. The journalist spent a year researching the foreign government's sanctions. Finally, it was time to synthesize all of the relevant information that he had learned. His editor asked him to write a comprehensive article for the first piece in the series that was sure to win awards, inform the public, and elicit significant change in foreign policy. Using the context, the word "elicit" meansdeclarecausecriticizeend y=tan(x-30) period and amplitude which platonic solid has eight faces that are equilateral triangles? A, dodecahedron, B, octahedro, C, tetrahedron, D, icosahedron