Describe erosion in six steps

Answers

Answer 1
1. Erosion is the process by which soil, rocks, and other materials are worn away by wind, water, and other natural forces.

2. Wind and water are the two main agents of erosion, but other forces such as gravity, ice, and temperature changes can also cause erosion.

3. Wind erosion occurs when wind carries away particles of soil, sand, and other materials.

4. Water erosion occurs when water carries away particles of soil, sand, and other materials.

5. Gravity erosion occurs when gravity causes particles of soil, sand, and other materials to move downhill.

6. Ice erosion occurs when ice melts and carries away particles of soil, sand, and other materials.

HOPE THIS HELPS
please rate this answer 5 stars

Related Questions

How completing SBA assists in obtaining a NSC

Answers

The NSC gives students access to a range of post-secondary programs. Entry-level work, acceptance to learnerships and internships, and admittance to colleges, universities.

What is a National Senior Certificate in South Africa?

The South African school-leaving certificate is known as the National Senior Certificate, or NSC. It is equivalent to a high school diploma. As grade 12 is the matriculation grade, this document is also known as a matriculation (matric) certificate.

With more than 1,000 communications sites spread around the nation, SBA South Africa is a leader in the provision of wireless communications infrastructure, including towers, buildings, and rooftops.

Thus, The NSC gives students access to a range of post-secondary programs.

For more information about National Senior Certificate in South Africa, click here:

https://brainly.com/question/17410632

#SPJ1

What are some ways that the nitrogen cycle overlaps with or influences the oxygen and carbon cycles?

What does this discussion suggest about the nature of the Earth as one large system?

Answers

The nitrogen cycle overlaps with and influences the oxygen and carbon cycles in several ways:

Nitrogen fixation: Nitrogen-fixing bacteria in soil and water convert atmospheric nitrogen gas (N2) into forms that can be used by plants, such as ammonium (NH4+). This process requires energy, which is often obtained through the process of photosynthesis, where carbon dioxide (CO2) is taken in and oxygen (O2) is produced.

Nitrification: Nitrifying bacteria convert ammonium into nitrite (NO2-) and then into nitrate (NO3-), which is an important source of nitrogen for plants. This process requires oxygen.

What is the  nitrogen cycle about?

The above interactions suggest that the Earth's biogeochemical cycles are interconnected and that changes in one cycle can affect the others. For example, changes in nitrogen availability can affect plant growth and productivity, which in turn can affect carbon uptake and release by plants.

Therefore, the nitrogen, carbon, and oxygen cycles are part of a larger system that regulates the composition of the Earth's atmosphere and supports life on the planet. This interconnectedness highlights the importance of understanding and managing the Earth's natural systems in a holistic way.

Learn more about  nitrogen cycle from

https://brainly.com/question/1380063

#SPJ1

How does “I say that if you check a boy's backpack, it will always be a mess, and if you check his uniform, it will be dirty. This is not my opinion. This is just a fact,” contribute to the tone?

A The author is using hyperbole to create a humorous tone.
B The author is using a metaphor to create a formal tone in the text.
C The author is using personification to create a serious tone in this section of the text.
D The author is using alliteration to evoke the sound of a phone ringing, creating an anxious tone.

Answers

Answer:

A The author is using hyperbole to create a humorous tone.

Explanation:

A The author is using hyperbole to create a humorous tone.

This is the only one that makes sense

There are no metaphors, personification, or alliteration

Select the correct answer.
Which line from the text supports the inference that Juliet will pursue her interest in Romeo?

A. Good pilgrim, you do wrong your hand too much.
B. Come hither, Nurse. What is yond gentleman?
C. His name is Romeo, and a Montague, The only son of your great enemy.
D. Prodigious birth of love it is to me, That I must love a loathed enemy.

Answers

That I must love a hated adversary seems to be the prodigious birth of love. Juliet will apparently follow her interest in Romeo, as suggested by the text.

When Romeo departs from Juliet, what does he intend to do?

Romeo will pay Juliet a visit that evening, but he must be sure to leave Verona and her chamber before dawn. This is the plan the friar lays out. After that, Romeo will stay in Mantua until their marriage can be announced.

Why is he offended by Romeo's name?

Romeo implies that Juliet is his enemy simply by virtue of his name. Romeo and Juliet's words are to be interpreted. Romeo is more worried about upsetting Juliet than dying since the Capulets will kill him if they see him.

To know more about Romeo visit:-

https://brainly.com/question/30043581

#SPJ1

ANSWER TO NUMBER 1? 20 points

Answers

In "The Ways We Lie," Stephanie Ericsson's tone shifts from one of impartiality when describing the different types of lies people tell to a tone of condemnation when describing the more harmful lies such as omission and stereotypes, which highlights the writer's realization that some forms of lying can have serious negative consequences and contribute to societal injustices.

What is "The Ways We Lie,"?

Generally, The white lie, facades, ignoring the simple facts, deflecting, omission, stereotypes and clichés, groupthink, out-and-out falsehoods, dismissal, and delusion are the 10 sorts of lying that Ericsson discusses.

The first form of deception he discusses is the white lie. A "white lie" is a deception that is spoken when the consequences of telling the truth would be more severe than the benefits of telling the lie.

Read more about "The Ways We Lie,"

https://brainly.com/question/7413592

#SPJ1

There’s a part of me that keeps mourning for the soft cocoon where I lay, a part of me that keeps pining for the delicate chrysalis smashed and destroyed before my eyes that day.

I’m tossed to and fro, from here to there, caught between compulsions; I’m thrown left and right and back and forth, longing for the freedom of flight and yet craving those soft consolations.

When my soul broke free, a part of me thrilled at the lift of its arc, but another shrank back in cowering fear from the threatening fires, from the lowering smoke that awaited me in here.

All this makes me wonder greatly about contrary desires. There’s something in me approves of flying, applauds the thought of bravely dying, yet I weep for the cocoon’s demise

Answers

We can see here that given passage seems to express conflicting emotions and desires within the speaker. On one hand, there is a desire for freedom and flight, which is described as a thrilling experience.

On the other hand, there is a sense of loss and mourning for the comfort and safety of the cocoon or chrysalis, which represents a state of being before breaking free.

What is a passage?

In literature, a passage refers to a specific section or segment of a larger written work, such as a novel, poem, or play. A passage can be a single sentence, a paragraph, or even an entire chapter or scene.

The speaker seems to be struggling with these contradictory desires and feelings, as they are "tossed to and fro" and "thrown left and right and back and forth." There is a sense of being caught between compulsions or conflicting urges.

Learn more about passage on https://brainly.com/question/24729251

#SPJ1

Read the sentence.

Our family woke early the first day at the beach house and watched the fog crawl quietly away from the shore.

Which object is personified in this sentence?

the family
the house
the fog
the shore

Answers

Answer: The fog.

Explanation: The fog is being personified because fog cannot crawl quietly. Fog can't crawl period.

THIS IS FOR ECONOMICS
When the price charged for a good or service is lower than the _____________________, the market will suffer a _________________________.

Answers

Explanation:

When the price charged for a good or service is lower than the cost of producing it, the market will suffer a loss or negative profit.

what are some holidays or traditions that you do not feel connected to, and why? Cite examples to explain how you would reimagine or reframe one celebration to be more inclusive.

Answers

Festivals and traditions are an important part of cultural identity and heritage. However, some holidays or traditions may not be appropriate for certain groups of people.

The required details for celebration in given paragraph

For example, Columbus Day, which commemorates the arrival of Christopher Columbus in America, is not celebrated by all Americans as some see it as a celebration of colonialism and the genocide of indigenous peoples. In order to reinvent or redesign a celebration to be more inclusive. To honor the history, culture, and accomplishments of Indigenous peoples, several towns in the United States have started commemorating Indigenous Peoples Day in instead of Columbus Day.

Another example is Thanksgiving, celebrated in the United States to commemorate the gathering and distribution of food among pilgrims and the Wampanoag tribe in 1621.

To know about celebration click here

https://brainly.com/question/25338370

#SPJ1

the public library in your community does not make provision for people living with disabilities. write the letter to the local newspaper in which you voice your views and Suggest measures that the library to be more accessible for people living with disabilities​

Answers

Often times, the disabled or handicapped are seen as "less than human" by society  Hence, just like everyone else, people with disabilities should have access to public libraries.

What is the purpose of writing letters?

A letter is a written communication that uses a medium to get from one person to another. It might be formal, informal, or semi-formal when words are used to express a concept to a recipient about a certain subject. A formal letter is one that adheres to a particular prescribed structure and is written in a systematic and formal manner.

                                                                                              John,

                                                                                              16, wall street,

                                                                                               Oregon,

11th Nov, 2020

The editor,

The New york times

Sir, I am writing this letter to highlight the need for special measures so  that the library to be more accessible for people living with disabilities​.They may not experience pain in the same way that most people do. Yet, they do not have the same needs, wants, or emotions as typical people, hence they are not entitled to the same rights and considerations as typical people.

So, finding strategies to make it easier for patients with disabilities to access libraries is crucial. By making entrances larger so that wheelchairs and mobility scooters may easily pass through, you can increase accessibility for people with disabilities. Also, there should be restrooms, fire alarms, and ramps available. I hope this issue will be resolved soon. Thanking you.

To learn more about formal letter, visit:

https://brainly.com/question/30390939

#SPJ1

SAMO's Inspiration

Jean-Michel Basquiat was part of a wave of new artists in the emerging neo-expressionist movement of the 1980s.
Basquiat drew from his experiences growing up in New York City. His mother strongly encouraged him to develop his
artistic skills. He attracted attention in the 1970s with his graffiti art under the name "SAMO." Basquiat would later
collaborate with Andy Warhol and exhibit his work in Europe and Africa.

Which of the following is the best summary of these details?

Answers

Answer: i think it B

Explanation: maybe

A story ending with the statement "had I known, I wouldn't have told him my secret"

Answers

While I write this account, I'm in a complete state of agony. I made a choice many years ago that I will now live the rest of my life regretting. Ronke is my name, and I am 23 years old. I'll live long enough to slander the Dare for ruining my entire life.

My family is incredibly well-off. Even though we are not particularly affluent, my family and I uphold moral principles, and I am proud of them. But with my regrettable actions, I have brought shame and disgrace upon them. I would act differently if I could turn the hands of time back.

I was only eighteen and had recently received my undergraduate degree.

"A Good Man Is Hard to Find" is mainly told from a
A. second-person omniscient
B. first-person
C. third-person omniscient
OD. third-person limited
point of view.

Answers

The answer is C , Third person omniscient
The correct answer is c

Which section from the article BEST explains why the EPA says the train derailment in a low risk for residents of East Palestine?

Answers

The section from the article that BEST explains why the EPA says the train derailment is a low risk for residents of East Palestine is "The derailed train was carrying thousands of gallons of crude oil, but none of the tankers leaked and no contamination of the environment was detected.

According to the EPA, there is no risk to the locals from the East Palestine railway crash.

The absence of environmental damage and the fact that none of the tankers carrying thousands of gallons of crude oil leaked led to this conclusion.

The tankers were transporting potentially dangerous goods, but fortunately, no tanker experienced a rupture due to the incident, preventing any potential environmental damage.

The EPA is still keeping an eye on the issue and will take whatever action is required to protect the safety of the locals. The EPA further suggests that locals avoid the area and, if possible, avoid contacting any spilled substance.

To know more about crude oil,

https://brainly.com/question/14281081

#SPJ4

He has failed in the examination. He cannot stand before his parents

Answers

The sentence "He has failed in the examination. He cannot stand before his parents" suggests that the person in question is feeling ashamed or embarrassed because of their exam results, and is therefore unable to face their parents.

The use of the word "failed" implies that the results were not just below expectations, but that the person did not pass the exam at all. This can be a difficult and stressful situation for a student, and the sentence suggests that the person may be feeling a sense of failure or disappointment in themselves.

The fact that they cannot stand before their parents further emphasizes the gravity of the situation, suggesting that the person is afraid of the consequences or judgment that may follow from their parents.

To know more about examination here

https://brainly.com/question/29803572

#SPJ4

What words (diction) stands out to you most while reading? What effect do these words have on the speech? What is the tone of the speech? What words help create that tone? Give an example of where Lincoln uses pathos to help engage or persuade his audience. What emotion does he make them feel? Is he effective? Where does Lincoln use logos in his speech? In your own words, what is he reasoning with the audience? What, in your own words, is Lincoln’s main claim (one sentence)? Lincoln addresses a counterclaim — that they do not have the right to consecrate this ground. What reasoning does he give to back this counterclaim (why can they not consecrate it)? What is his rebuttal to this counterclaim — what should those present do instead? Pick a phrase from the speech that you think is the most powerful, memorable, or impressive. Why do you think it stands out to you so much? Could you use his style in your own writing?

This is all from the Gettysburg Address

Answers

The diction that stands out in the Gettysburg Address is Lincoln's use of concise and simple language, which emphasizes the gravity of the occasion.

The effect of this language is to convey the seriousness of the task at hand and to appeal to the common humanity of the audience.

An example of where Lincoln uses pathos is when he refers to the "great task remaining before us" and invokes the memory of the soldiers who died on the battlefield.

Lincoln uses logos throughout the speech, reasoning with the audience that it is their duty to continue the work of the fallen soldiers and to ensure that the United States remains a nation dedicated to liberty and equality.

Lincoln argues that those present do not have the right to consecrate the ground because it has already been consecrated by the blood of the soldiers who died there.

The phrase "government of the people, by the people, for the people" is the most powerful in the speech, as it succinctly captures the essence of American democracy.

For such more question on Gettysburg

https://brainly.com/question/21348287

#SPJ4

write a
paragraph describing what preparation the tribe takes to set-up for the
Sundance Ceremony. in fools's crow.

Answers

Welch's references to Sun Chief (sun) and Night Red Light (moon), both commonly used to describe the natural world, speak to Pikuni's spirituality.

What is the natural world?

All living and non-living objects occurring naturally or, in this example, without the use of artificial means are included in the natural environment or natural world. This expression is most commonly used to refer to the earth or specific regions of it. This ecosystem contains the interaction of all living things, climate, weather and natural resources that influence human existence and economic activities. Entire ecological entities, including all flora, microbes, soils, rocks, atmosphere, and natural phenomena occurring within their boundaries and nature, functioning as natural systems without the intervention of civilized man.

Energy, radiation, electric charge and magnetism are universal natural resources and physical phenomena that have no clear boundaries. Other examples are air, water and climate.

Learn more about nature here

brainly.com/question/28240473

#SPJ1

Who is the first suitor Odysseus kills? Does the person see it coming? What are they doing at
the time?

Answers

Answer:

Antinousis the first of the suitors to be killed. Drinking in the Great Hall, he is slain by an arrow to the throat shot by Odysseus. Eurymachus then tries to blame Antinous for the suitors' wrongs.

Explanation:

///

In “Goodbye to All That,” Joan Didion writes that the “lesson” of her story is that “it is distinctly possible to remain too long at the Fair.” What does she mean? How does the final section of the essay portray how she came to this understanding, her feelings about it, and the consequences of it?

I'm depreciate please

Can someone help me right write 4 paragraphs ik its not a lot of points but I really need help I'm not asking u to do it for me just kinda help me out please

Answers

In Joan Didion's essay "Goodbye to All That," she reflects on her time living in New York City in the 1960s. The phrase "remain too long at the Fair" is a metaphor.

How does Joan Didion reflect on her life in New York City in the final section of her essay "Goodbye to All That," and what understanding does she come to about it?

The final section of the essay portrays how Didion came to this understanding, her feelings about it, and the consequences of it. Didion reflects on how her life in New York had become routine, predictable, and unfulfilling.

She describes feeling a sense of emptiness and disillusionment, as if she had lost her sense of purpose and direction. Didion's experiences led her to realize that she had been staying in New York for too long, and that it was time for her to move on to something new.

Didion's feelings about this realization are complex. On the one hand, she is saddened by the idea of leaving behind the life she had built in New York, with its familiar streets and routines.

On the other hand, she is excited by the prospect of starting over, of discovering something new and unexplored. Didion's writing captures the mixed emotions that come with leaving behind a place that has become both comfortable and suffocating.

The consequences of Didion's decision to leave New York are not explicitly stated in the essay, but the tone of the writing suggests that she ultimately found fulfillment and purpose in other aspects of her life.

In this way, Didion's essay serves as a cautionary tale about the dangers of staying in one place for too long, and the importance of being open to new experiences and opportunities.

To learn more about Didion follow the given link:

https://brainly.com/question/29486613

#SPJ1

VIEW RUBRIC Click to place the reading side by side with this page. SPLIT SCREEN MODE
Throughout most of the book, the point of view is limited to Wiesel at the age when the events are happening. Why on page 34 does the author choose to break format and comment on the events of the book from his adult perspective? How does the author’s use of language and tone contribute to his purpose when he addresses the things he will never forget? Write an essay of at least 150 words exploring these ideas and cite specific evidence from the text in your answer

Answers

Wiesel violates the rules on page 34 of "Night" to highlight the Holocaust's enduring effects. His emotive language and tone highlight how crucial it is to recall and stop such crimes.

Elie Wiesel mainly recounts the events of the Holocaust in "Night" from his viewpoint as a young child. On page 34, he departs from this structure and offers his mature view of the events. His ability to communicate the severity of his trauma and the lasting effects it has had on his life is enhanced by his ability to ruminate on his experiences from a mature viewpoint.

In this section, Wiesel uses extremely emotive and potent language. As he considers the incidents that have shaped his existence, his tone is one of intense sorrow and grief.

Learn more about Elie Wiesel:

https://brainly.com/question/16018698

#SPJ4

Choose the correct alternatives.


1 Do you take / Are you taking a selfie now?

2 I never check/ am never checking my phone after 10 p.m.

3 She doesn't smile / isn't smiling in that picture.

4 You go / 're going to the gym a lot at the moment!

5 I never wear / am never wearing yellow. Most of my
clothes are blue.

6 He understands / 's understanding why we did it.

Answers

Answer:

Explanation:

Are you taking a selfie now?

I never check my phone after 10 p.m.

She isn't smiling in that picture.

You're going to the gym a lot at the moment!

I never wear yellow. Most of my clothes are blue.

He understands why we did it.

What might change for Mr. Walter and Markus now that Ms. Jameson has introduced them? Use evidence from the text to support your answer. Answer

Answers

In "A Raisin in the Sun," Mr. Jameson informs Walter that Markus has moved away, and Walter's plans for his family's future may be affected by this revelation. As a result of this revelation, the whole younger family reunites to achieve their dream of buying a house.

What's the plot of A Raisin in the Sun?

The Lorraine Hansberry play "A Raisin in the Sun" explores issues of housing discrimination, racism, and assimilation while describing the struggles of a black family in south Chicago as they try to improve their financial situation with an insurance settlement after the father's passing.

In Raising in the Sun, the heroes fight against outside forces in an endeavor to achieve their goals. The story is about passionate dreams and how they are realized. Every member of the younger family has a unique desire in the book.

To learn more about A Raisin in the Sun, visit:

https://brainly.com/question/16783158

#SPJ1

passive voice for the teacher had brought extra books for the learners to read​

Answers

Teacher had brought extra books by the learners to read.

What is Passive voice?

Writing will be stronger, clearer, and, you guessed it, more active when using the active voice. The verb in the sentence's subject performs the action of something that the subject is.

The subject is affected by another person doing the verb in the passive voice. The voice described in the previous two phrases is used, in case you weren't paying attention.

Nonetheless, using the passive voice is acceptable. In fact, there are circumstances in which it is useful. Continue reading to understand how to use the active and passive voice, when it's appropriate to use it, and how to distinguish it from similar forms.

Therefore, Teacher had brought extra books by the learners to read.

To learn more about Passive voice, refer to the link:

https://brainly.com/question/19693849

#SPJ1

1. Think about your own assumptions. Are they useful? Are they okay? Who do you make eye contact with? Who do you feel safe around? Do our choices reinforce damaging racial or other kinds of stereotypes? Do we react differently to the
person who cuts us off in traffic depending on their color, gender, age, or other observation we might make? Do we smile at one stranger and then flinch at the next?
2. What responsibility do we have for interrupting oppression?.

Answers

Answer:

My assumptions can be usefull in some cases. They are okay in my opinion others may disagree. I like to make them by looking on whats right rather than what benefits me. When I make eye contact it's with people I care and trust. I feel safe around my friends that I know are there for me. I feel safe around some family and some teachers. Some peoples choices of words can be damaging racial and other sterostypes. People may make comments that are offensive without even known. I think that some times it has to do with how a person is raised. How they were brought up determins who they are today. I think people should think before they say things about a sensetive topic. Some people respond with anger, confusion, and fear when getting cut off in traffic. For people who get treated diffrent from color they may react with fear or anger that someone would do that because of there color. People who think they cut off because of gender may respond with anger for thinking that people will do so because of there gender or perferred gender. People who get cut off because of age may react with fear and confusion. If they are younger they be confused as to why someone would do so knowing they are at a young age and most likely just started driving. They also be scared because they may think that driving is scary and since they have little experience they may nevery want to drive again. The eldery might also act with fear. Observations in the world can affect a persons mood and emotions. If you smile at an eldery person or a little kid because they look friendly we should flinch at someone who looks scary or tense. You don't know how they are maybe they just need to see a smile to change there day. We are responsible for what we say and what we do. If we say something offensive or interupt a momment we have the responsiblity to either make it better or worse.

Explanation:

Hope this helps. I havent done something like this before. I hope I answered them correct. :)

Analyze how the authors of the science procedure accomplished their purpose. Which features or phrases were most helpful to you? Include specific features and phrases from the text in your answer and tell how they helped you understand the procedure.

Break down the prompt and make sure you know what is being asked.

1. Name text features (there are 3 )

2. Explain how each of these features helps you understand the author's purpose (his purpose is that he is writing to EXPLAIN HOW TO DO SOMETHING RELATED TO SCIENCE)

Answers

By providing clear, step-by-step instructions and using simple language, the authors of the science procedure demonstrate that they were able to effectively convey their goal.

They also broke up the steps and stressed the significance of each one by using phrases like "record your observations" and "draw a conclusion."

How does a procedure work?

A procedure is a set of steps taken to solve a problem or complete a specific task. Most of the time, procedures are written down with step-by-step instructions on how to get the desired result.

A variety of outcomes, including the completion of a lab experiment, the resolution of a problem, or the execution of a program, can be achieved through the use of procedures.

In addition, they provided the reader with guidance by including pertinent illustrations and diagrams. The procedure was presented in a clear and concise manner by each of these features and phrases, making it easier for the reader to comprehend and follow the instructions.

Learn more about procedure :

brainly.com/question/968907

#SPJ1

What is the subject of the sentence below?
Grant listened to the crackle in his earphones as the pilot talked to the tower

Answers

Answer:

jurassic park

Explanation:

Answer:

Jurassic Park, I believe. Grant was from the original Jurassic Park and shows up in the newest one.

what is an essential characteristic of political activity

Answers

The essential characteristic of political activity is power, authority, legitimacy, and sovereignty.

What do you mean by political activity?

Political activity is any activity that supports or is in connection with any campaign for elected office or any political organization.

Most of the employees are free to participate in political activities: fighting for or against candidates in partisan elections, distributing campaign material, organizing or managing political rallyings or meetings, circulating naming petitions, working to file voters, and making campaign speech act.

Therefore, power, authority, legitimacy, and sovereignty are an essential characteristics of political activity.

Learn more about political activity, here;

https://brainly.com/question/6205531

#SPJ1

Read the passage from A Doll’s House.

Nora: Come here. [Pulls her down on the sofa beside her.] Now I will show you that I too have something to be proud and glad of. It was I who saved Torvald's life.

Mrs. Linde: "Saved"? How?

Nora: I told you about our trip to Italy. Torvald would never have recovered if he had not gone there—

Mrs. Linde: Yes, but your father gave you the necessary funds.

Nora: [smiling] Yes, that is what Torvald and all the others think, but—

Mrs. Linde: But—

Nora: Papa didn't give us a shilling. It was I who procured the money.

Mrs. Linde: You? All that large sum?

Nora: Two hundred and fifty pounds. What do you think of that?

Mrs. Linde: But, Nora, how could you possibly do it? Did you win a prize in the Lottery?

Nora: [contemptuously] In the Lottery? There would have been no credit in that.

Mrs. Linde: But where did you get it from, then?

Nora: [humming and smiling with an air of mystery]. Hm, hm! Aha!

Mrs. Linde: Because you couldn't have borrowed it.

Nora: Couldn't I? Why not?

Mrs. Linde: No, a wife cannot borrow without her husband's consent.

Nora: [tossing her head] Oh, if it is a wife who has any head for business—a wife who has the wit to be a little bit clever—

Based on this passage, which statement is the most accurate inference to make about Nora?

Nora thinks that her husband is incapable of getting enough money to save himself.
Nora deceives her husband so that she can have her own money to spend as she wishes.
Nora has a deep love for her husband to go to such an extreme length to save him.
Nora is resentful that she is not allowed to borrow money without her husband’s consent.

Answers

The conclusion that can be drawn about Nora that is the most correct is:-

Choice D -Nora is miffed that she cannot take out a loan without her husband's approval.

What does Nora claim to have purchased as a Christmas gift for her son Bob?

Nora: It will, I promise. But come on over so I can show you what I've bought. Also, everything is extremely affordable! Look, a new suit and sword are here for Ivar; a horse and trumpet are here for Bob; a doll and doll's bedstead are here for Emmy; they are really plain, but she will soon smash them to bits.

Ibsen had to write a second consummation, which he called an uncouth shock to be used only when necessary because the play was so doubtful.

The discussion centred on Nora's decision to leave her children, and in the second installment, she comes to the conclusion that they require more of her than she can give.

Henrik Ibsen, a Norwegian playwright, created the three-act play A Doll's House. After being distributed earlier in the month, it made its debut on December 21 at the Royal Theater in Copenhagen, Denmark.

Later in the play, it is revealed that he was once in love with Kristine Linde, who ended up getting married to another man in order to have enough money to support her elderly mother and young brother.

To know more about Nora visit:

https://brainly.com/question/11706194

#SPJ1

: 3. Write a quote from the passage that supports your answer to #2.​

Answers

To write a quote from a passage as an answer, you should first identify the relevant sentence or phrase that provides the information you need. Then, copy the exact words of that sentence or phrase, putting it in quotation marks to indicate that it is a direct quote.

How to explain the quote

For example, if the question asks for the definition of a particular term and the passage contains a sentence that defines it, you might write:

"The passage defines the term as 'the process of turning raw materials into finished products through the use of various tools, machines, and labor.'"

In this example, the quoted text is enclosed in quotation marks and is an exact copy of the words used in the passage.

P.S: An overview was given as your information is incomplete.

Learn more about quote on:

https://brainly.com/question/2762082

#SPJ1

Which sentence contains an analogy?
O A. My room is a lot messier than my sister's but cleaner than my
brother's.
• B. My room just shows how incredibly unique and complicated I am.
• C. My room is like a used-clothing shop after a tornado.
O D. My room is full of piles of washed and unwashed clothes.

Answers

Answer:

Possibly answer C

An analogy is the comparison between two things which are usually for the purpose of explanation or clarification

Examples of analogy -

She was as blind as a bat

You need to be as busy as a bee

Finding a lost cat is like finding a needle in a haystack

Since C says, "My room is like a used-clothing shop after a tornado" I believe its an analogy

Other Questions
When the Europeans arrived in Central America, most countries fell to Spanish rule except ______, which became a British colony. i need help 16 divided by 6032 full solution A jet flying at 200 m/s north accelerates at a rate of 18.2 m/s for 15 seconds. What is the jet's final velocity? The RNA sequence GGAUCUCUUGUAGAUCUGUUCUCUAAACGAAC lies in a section of the COVID-19 viral genome that sets up translation, which is the process of reading the RNA to create the proteins the virus needs to survive.(a) Use the webserver to predict the lowest energy structure of the sequence. Print out a picture of it. (b)What do you think the effect will be of the RNA being longer than the stretch you just similated? (c) Design an RNA sequence that folds into a single stem-loop. Run it through the RNAfold server and print a picture of your folded design. consider a political discussion group consists of 6 democrates, 3 republicans, and 5 independents. suppose that two group members are randomly selected, in succession, to attend the political convention. find the probability of selecting a independent then a democrat According to the Kaplan-Meier plot, amplification of more than 10 copies of myc in neuroblastoma (see fig. 4-11b), decreases disease-free survival by more than 80% post-treatment. Explain two mechanisms that may contribute to gene amplification of myc? Even though both lens cells and liver cells have numerous transcription factors that are present in both colls, the lens cell makes the crystallin protein (not albumin), whereas the liver cell makes albumin (not crystallin) Which of the following explains this cell specificity?A. Different specific transcription factors made in each cell determine which genes are expressedB. At fertilization, specific colls are destined for certain functionsC. The activators needed for expression of the crystallin gene are present in all cells.D. The promoters are different for the different genes How does the author's discussion of different death rates help readers understand the spread of the Black Death? Use evidence from the text in your responsepls i need help!! a rock rolling down a slope from rest covers a distance of 4 m in the first second. What distance will it covers in 3 sec? 5 3/10 = 5 ?/50If anyone can please help me with the rest what happened to some native Americans during the Jackson presidency ? In order for following to be consistent,-3x +4y +7z =-4-11x +24y +kz = -452x -5y -8z =9solve for k ?please show full steps Air passes over the top of an airplanewing at 170 m/s, and over the bottomat 130 m/s. What is the difference inpressure between the top andbottom of the wing? Scarlett and Roger sipped their drinks on the porch, discussing all the things they still had to do before the Easter holiday. As Roger finished her last bit of burger, he sighed, "I'm stuffed." He complained of having a burning sensation in his lower chest. "You probably ate too much. How about taking some antacid?" asked Scarlett. "I use it every time I get indigestion." Roger left to search the medicine cabinet. He eventually felt better. Roger got his body test results the next day. He glanced at them briefly and put the paper in his bag. "Maybe later I will get a better sense of what all this means," he said.'Roger's test results(at rest and fasting levels)TEST Roger's Result Normal RangeHeart rate 90 beats/min 60-100 beats/minBlood pressure 138/95 mm/Hg 120/80 mm/HgTotal cholesterol 242 mg/dL create a journal from the perspective of a citizen living in paris during the french revolution CAN SOMEONE HELP ME PLEASE ASAP write three rations that are equivalent to 6/9 Is this a function? Why or why not? Explain your reasoning for each part. How did Claudette Colvin's social status contribute to why civil rights groups didn't use her actions to inspire the bus boycott? Has your social status ever influenced the way people treat you? If so, describe the experience. According to the graph, in the United States how much land is used by cities compared to other land uses?A- Cities use one third as much of the land as forests.B- Cities use very little land compared to any other category.C- Cities use half as much land as agriculture.D- Most land is used by cities. Suppose when Sweetland (a hypothetical country) opens to trade, it imports computer software, a capital-intensive good.a. According to the HeckscherOhlin theorem, is Sweetland capital-abundant or labor-abundant? Briefly explain. (1 mark)b. What is the impact of opening trade on the real wage in Sweetland? Briefly explain. (2 marks)c. What is the impact of opening trade on the real rental on capital? Briefly explain. (2 marks).d. Which group (capital owner o