Completing the sentence with using ir+ a+ inf
Yo__ un articulo divertido
La profesora ___ un examen
Marco y Juan___ la television
___ Al profesor
____ Al tenis y Al volibol
____ ejercicio en el gimnasio

Answers

Answer 1

The words that complete these sentences are voy a escribir, va a hacer, van a ver, van a hablar, van a jugar, van a hacer.

How to complete the sentence?

The structure ir+ a+ inf is often used to talk about plans for the future. To create a complete and correct sentence with this structure conjugate the verb ir based on the following pattern and then add and infinitive verb (verb that ends in -ir,-ar,-er).

Yo voy

Tu vas

El/ella va

Ellos van

Nosotros vamos

For example, ellos van a cantar o yo voy a cocinar pollo.

Learn more about sentences in https://brainly.com/question/18728726

#SPJ1


Related Questions

Los deportes
Complete cada oración con un deporte de la lista.
basquetbol
beisbol
ciclismo
fútbol
natación
tenis

Answers

   Se practica la natación en una piscina. (Swimming is practiced in a pool.)

   El Tour de Francia es una competencia de ciclismo. (The Tour de France is a cycling competition.)    En los estadios Wrigley Field en Chicago y Fenway Park en Boston se practica el béisbol. (Baseball is practiced at Wrigley Field in Chicago and Fenway Park in Boston.)    Los Knicks de Nueva York y los Lakers de Los Ángeles son equipos de baloncesto famosos. (The New York Knicks and the Los Angeles Lakers are famous basketball teams.)    Las mujeres del equipo estadounidense de fútbol ganaron la Copa Mundial Femenina de la FIFA en 2019. (The women of the U.S. soccer team won the FIFA Women's World Cup in 2019.)    Serena Williams, una jugadora de tenis, ha ganado el torneo de Wimbledon varias veces. (Serena Williams, a tennis player, has won the Wimbledon tournament several times.)

What is the sentences about?

In this exercise, you are given with a list of sports: basquetbol (basketball), beisbol (baseball), ciclismo (cycling), fútbol (soccer), natación (swimming), and tenis (tennis). You are then asked to complete a set of sentences with the correct sport from the list. Each sentence is designed to test your understanding of the vocabulary and context related to each sport.

For example, you are asked to choose the sport that is practiced in a pool (natación) and the sport that is played in Wrigley Field in Chicago and Fenway Park in Boston (béisbol).

Learn more about Serena Williams from

https://brainly.com/question/29454901

#SPJ1


Before you get online, answer the following question
1. ¿Quiénes trabajan abordo del avión?
2. ¿Dónde esperan los pasajeros antes de embarcar?
3. ¿Dónde facturan su equipaje los pasajeros?
4. ¿Cuándo tienen que tener sus cinturones abrochados los pasajeros?

Answers

Some answers to the questions would be: Sí, quiero trabajar abordo de un avión, los pasajeros esperan en la sala de abordaje, los pasajeros facturan su equipaje en los counters de la aerolínea, los pasajeros deben tener su cinturón abrochado en el despegue y el aterrizaje.

How to answer the questions?

To correctly answer the questions, we must know how the boarding procedure of a plane works for passengers. According to the above, the answers to the questions would be:

1. ¿Quiénes trabajan abordo del avión?Sí, quiero trabajar abordo de un avión,2. ¿Dónde esperan los pasajeros antes de embarcar?Los pasajeros esperan en la sala de abordaje antes de embarcar el avión.3. ¿Dónde facturan su equipaje los pasajeros? Los pasajeros facturan su equipaje en los counters de la aerolínea.4. ¿Cuándo tienen que tener sus cinturones abrochados los pasajeros?Los pasajeros deben tener su cinturón abrochado en el despegue y el aterrizaje.

Learn more about planes in: https://brainly.com/question/19511275

#SPJ1

6. Which action describes having a meal outdoors? (1 point)
Ocumplir años
Ollevarse bien
Osaludarse
Ohacer un picnic

Answers

Answer:

Hacer un picnic

Explanation:


a) ¿Qué aspectos o características de las obras se destacan en los tres prólogos?

Answers

Answer:

La función del prólogo es servir como explicación racional de la obra escrita, aumentando el interés de los lectores.

Funciones de otras partes del texto:

Advertencia: Indicar cuales son las precauciones que deben ser tomadas antes de leer el texto, como restricciones de edad, indicaciones acerca de temáticas delicadas, entre otros..

Introducción: servir como una referencia al lector acerca de los temas que se van a tratar en el texto, como la estructura que se le ha dado a el texto finalmente.

Presentación: Indicar la temática, autor o autores y la finalidad de la antología.

Explanation:

Ver más: brainly.lat/tarea/6561432

PARTE. A. IDENTIFIQUE LOS ELEMENTOS EN LA SIGUIENTE SITUACIÓN COMUNICATIVA. (VALOR 12 PUNTOS)

1. En un salón de clases, estaba el profesor de Biología explicando a los estudiantes, las características de los animales vertebrados e invertebrados.

EMISOR: profesor
RECEPTOR: estudiantes
MENSAJE: las características de los animales vertebrados e invertebrados.
CÓDIGO:
CANAL:
CONTEXTO:

2. Un señor está comprando un auto, toma el teléfono para consultar al banco el saldo de su cuenta de ahorros y verificar si le alcanza el dinero para pagar con su tarjeta.

EMISOR:
RECEPTOR:
MENSAJE:
CÓDIGO:
CANAL:
CONTEXTO:

Answers

Los elementos para la primera situación son lenguaje verbal, ondas sonoras y clase  y para la segunda situación son el señor, el banco, el saldo de la cuenta, la voz, vía telefónica y una llamada al banco.

¿Qué elementos hacen parte de la comunicación?

La comunicación es un acto complejo que requiere de 6 elementos básicos:

Emisor: Persona o ente que se comunica.Receptor: Persona que recibe el mensaje.Mensaje: Lo que es transmitido.Código: La forma en la que comunica el mensaje.Canal: El medio a través del que se comunica el mensaje.Contexto: Situación del mensaje comunicativo.

Aprenda más sobre comunicación en https://brainly.com/question/24027388

#SPJ1

What should to be done to develop analysis skill. Why is the analysis skills nece
। (Answer any four questions.)​

Answers

Developing your analysis skills is essential to participate in activities such as analyzing a text or an image.

How to develop analysis skills?

Analyzing involves carefully examining a text, image, etc. to draw conclusions or ideas. This is an essential skill because it is not only applied in academic contexts but to day-to-day situations such as analyzing the information in the news. Due to this, it is important to develop analytical skills which can be achieved by practicing how to analyze a simple text or image. etc. and moving to the analysis or more complex materials.

Learn more about analysis in https://brainly.com/question/29926939

#SPJ1

Complete las siguientes tablas con las forms apropiadas del imperfecto.

Answers

We can complete the chart with the imperfecto form of the verbs in Spanish by keeping in mind that the imperfecto expresses past habits.

Cantar: (yo) cantaba, (tú) cantabas, (él/ella/usted) cantaba, (nosotros/nosotras) cantábamos, (vosotros/vosotras) cantabais, (ellos/ellas/ustedes) cantabanTener: (yo) tenía, (tú) tenías, (él/ella/usted) tenía, (nosotros/nosotras) teníamos, (vosotros/vosotras) teníais, (ellos/ellas/ustedes) teníanSalir: (yo) salía, (tú) salías, (él/ella/usted) salía, (nosotros/nosotras) salíamos, (vosotros/vosotras) salíais, (ellos/ellas/ustedes) salíanSer: (yo) era, (tú) eras, (él/ella/usted) era, (nosotros/nosotras) éramos, (vosotros/vosotras) erais, (ellos/ellas/ustedes) eranIr: (yo) iba, (tú) ibas, (él/ella/usted) iba, (nosotros/nosotras) íbamos, (vosotros/vosotras) ibais, (ellos/ellas/ustedes) ibanVer: (yo) veía, (tú) veías, (él/ella/usted) veía, (nosotros/nosotras) veíamos, (vosotros/vosotras) veíais, (ellos/ellas/ustedes) veían

What is the imperfecto about?

In Spanish, the imperfecto is one of the past tenses and is used to describe actions that were ongoing or habitual in the past. It is also used to describe actions or events that were in progress at a specific time in the past or that set the stage for another event. Additionally, the imperfecto is used to describe physical and emotional states in the past.

Here are some examples:

Cuando era niño, jugaba al fútbol todos los días. (When I was a child, I used to play soccer every day.)De niña, mi abuela vivía en el campo. (As a child, my grandmother used to live in the countryside.)

Learn more about imperfecto here:

https://brainly.com/question/22012802

#SPJ1

Answer:

Cantar

Cantabas

Cantabamos

Cantaban

Tener

Tenía

Tenían

Salir

Salía

Salías

Salíamos

Ser

Eras

Era

Eran

Ir

Iba

Iba

Íbamos

Ver

Veía

Veis

Veíamos

Veian

Explanation:

I need help with my Spanish assignment.

Answers

1. Ellos bailan en la discoteca.

2. Yo barro mi habitacion todos los dias.

3. El lava los platos los lunes.

4. Los estudiantes escriben mucho.

5. Mi madre compra en el supermercado.

6. Vosotros correis muy rapido.

7. Nosotros tellefoneamos a nuestros amigo.

(no one actually says that, it is better to say call or talk through the phone that in Spanish are  "llamamos" o "hablamos por telefono".

8. Tu aplaudes al final del concierto.

9. El corre mucho.

10. Yo abro la puerta de mi casa.

11. La maestra lee un cuento.

12. La hermana siempre baja la escalera corrienda

(it sounds better if you say "las" instead of "la"

You have to USE BOTH WAYS FOR EACH COMPARISON to create a positive as well as a negative comparison.

más + adjective + que and
menos + adjective + que


Follow the example. (TWO SENTENCES PER COMPARISON)

Remember that adjectives must agree with the nouns they describe.

e.g. el fútbol ---- el tenis----- popular.
El fútbol es más popular que el tenis.
El tenis es menos popular que el futbol.

1. Un rascacielos ------ una casa ----- alto
2. El elefante ----- el león ----- grande
3. Los sofás ----- las sillas ------ cómodo
4. La rosa ----- el lirio ----- hermoso
5. Mi carro ------ el carro de mi tío ---- moderno
6. Jugar al fútbol ------ escribir cartas ----- divertido
7. Miguel ----- Luisa ------ mayor/menor

Answers

Un rascacielos es más alto que una casa
El elefante es más grande que el León
Los sofás son más cómodos que las sillas
La rosa es más hermosa que el lirio

Need help with Spanish!!!

Answers

Answer:

tu amas, yo escribo, yo bailo, tu corres, nosotros estudiamos, ellos leen

Explanation:

Opiniones sobre los deportes
Complete cada oración con el artículo o la palabra apropiada.

Answers

Las oraciones se pueden completar con el artículo o la palabra correspondiente de la siguiente manera:

El fútbol es el deporte más popular del mundo.Se dice que Babe Ruth era el mejor jugador de beisebol del mundo.El equipo de los Houston Texans se formó en 1999. Es la equipo más vencedora de la Liga Nacional de Fútbol.El Camp Nou, en Barcelona, Espãna, es lo estadio de fútbol más grande de todo el mundo híspano.¿Qué son los artículos?

Corresponden a clases de palabras que preceden a los sustantivos para indicar si se mencionan de manera definitiva o indefinida. Como:

LoLaLosLas

Por eso, además de los artículos, también observamos en esta actividad algunas palabras que indican superlativos, como mejor, grande, más.

Encuentre más sobre los artículos en:

https://brainly.com/question/30196935

#SPJ1

Use the verbs to describe what these people are doing. Use each verb only once.
Questions
Word Bank reference
Your options are:
hacer,
oír,
poner,
salir,
traer,
ver,

Fernán
Young man sits in front of a blank television screen holding a remote control.

el estudiante
A young man sits at a table with books on it and writes on a piece of paper.

los aficionados
Young people in matching team shirts waving pennants leave a stadium.

nosotros
Young man and young woman sit in theater seats and eat popcorn.

la señora Vargas
Girl shouts in the ear of an older woman.

yo
Young woman holds a soccer ball.

Answers

According to the information we can infer that the verbs used for the sentences are: ver, hace, salen, traemos, oye.

How to write sentences in Spanish correctly?

To write the sentences in Spanish correctly we must know the meaning of each of the verbs on the list. Additionally, we must read the sentences and identify the action that each one is performing. According to the above, we can infer that the sentences would look like this:

Fernán ve la televisión.El estudiante hace las tareas.Los aficionados salen del estadio.Nosotros traemos algo de comer al teatro.La señora Vargas oye a su nieta.Yo traigo mi balón de futbol.

Learn more about Spanish sentences in: https://brainly.com/question/27430013

#SPJ1

Choose the sentence that is NOT grammatically correct.
Estoy compartiéndotelas.
Te las estoy compartiendo.
Las te estoy compartiendo.

Answers

Las te estoy compartiendo the last one

Answer:

О  Las te estoy compartiendo.                                      

Explanation:

Las te estoy compartiendo.  ⇒  Sentence NOT grammatically correct.

...

Fernando is not happy at his job because he has a very bad boss. Complete each sentence with the correct form of the verb in the present subjunctive.

1. Mi jefe me pide que yo le _______ (dar) informes todas las semanas.
2. Él manda que mi colega y yo _________ (trabajar) por lo menos 45 horas a la semana.

3. Él nunca permite que tú ________ (divertirse) en la oficina.

4. Él también prohíbe que las secretarias ________ (hacer) llamadas personales durante el trabajo.

5. Insiste en que yo no _________ (comer) nada en la oficina.

6. Yo quiero que él ________ (irse) de este trabajo: ¡es pesadísimo!

Answers

Answer:

Explanation:

1. Mi jefe me pide que yo le dar) informes todas las semanas.

Answer:

Explanation:

Mi jefe le pide que yo le esté dando informes todas las semanas.Él manda que mi colega y yo estemos trabajando por lo menos 45 horas a la semana.Él nunca permite que tú estés diviertiéndote en la oficina.Él también prohíbe que las secretarias estén haciendo llamadas personales durante el trabajo.Insiste en que yo no esté comiendo nada en la oficina.Yo quiero que él se vaya de este trabajo: ¡es pesadísimo!

1. Un rascacielos ------ una casa ----- alto
2. El elefante ----- el león ----- grande
3. Los sofás ----- las sillas ------ cómodo
4. La rosa ----- el lirio ----- hermoso
5. Mi carro ------ el carro de mi tío ---- moderno
6. Jugar al fútbol ------ escribir cartas ----- divertido
7. Miguel ----- Luisa ------ mayor/menor

Answers

Las oraciones se pueden completar usando el superlativo de la siguiente manera:

Un rascacielos es una casa más alta.El elefante es más grande que el león.Los sofás son más cómodos que las sillas.La rosa es más hermosa que el lirio.Mi carro es más moderno que el carro de mi tío.Jugar al fútbol es más divertido que escribir cartas.Miguel es mayor que Luisa.

¿Qué es superlativo?

Corresponde a formas gramaticales que indican el grado máximo de un adjetivo, es decir, cuando queremos indicar que algo o alguien tiene una característica en mayor grado que todos los demás objetos o personas de la misma categoría.

Por tanto, en español, los superlativos se forman de dos formas, los superlativos absolutos, con la adición del sufijo "ísimo" y los superlativos relativos, formados con el uso de artículos determinados y la preposición "más".

Encuentre más sobre los superlativos en:

https://brainly.com/question/24343382

#SPJ1

8 Siempre pago mis compras en efectivo o con tarjeta de crédito; no me gusta pagar ____

Answers

Answer:

No hay sufficientes detalles para poder contestar.

Answer:

el cheque

Explanation:

Ir+a+ infinitive structure

Answers

Answer:

Explanation:

Mis amigos y yo vamos a mirar un partido de beisbolTú vas a descansar este fin de semana.Angela y David van a asistir a la fiesta de sus amigos. Yo voy a pasar tiempo con mi novio esta noche.Miguel va a correr en el parque- mañana por la mañana

help: re-write the sentences in spanish using direct and indirect pronouns when possible.

Lisa eats apples.
They bought a shirt for me.
He used to play sports.
I want to visit her.
They prefer to make food for her.

Answers

Lisa come manzanas
Ellos compraron una camiseta para mi
El solía jugar deportes
Quiero visitarla
Ellos prefieren hacer la comida para ella

Help with another assignment

Answers

Answer:

Caminar: Camino, Caminas, Camina, Caminamos, Caminan

Platicar: Platico, Platicas, Platica, Platicamos, Platican

Estudiar (to study): Estudio, Estudias, Estudia, Estuidamos, Estudian

Barrer: Barro, Barras, Barra, Barramos, Barran

Leer (to read): Leo, Leas, Lea, Leamos, Lean (to be honest with you, this one doesn't look right to me but i think it'll be ok)

Moler: Molo, Molas, Mola, Molamos, Molan

Reir: Reo, Reas, Rea, Reamos, Rean

Dormir: Dormo, Dormas, Dorma, Dormamos, Doran

Escribir (to write): Escribo, Escribas, Escriba, Escribamos, Escriban

Explanation:

I got an A for Spanish 1, and i have an A for Spanish 2.

4*f(6) - 6*g(5) = can u help me​

Answers

Answer:

it would be 46

Explanation:

Give the appropriate forms of the adjectives

Answers

According to the information, the sentences are completed with the following adjectives: española, españoles, españoles, español, estadounidenses, estadounidense, estadounidenses, estadounidense.

How to complete the sentences correctly?

To complete the sentences we must carefully read the subject and identify the correct way to conjugate the adjective with the subject. According to the above, the sentences would be as follows:

9. Ángela es española.

10. Los turistas son españoles.

11. Nosotros somos españoles.

12. El periodista es español.

13. Clara y Bárbara son estadounidenses.

14. Ella es estadounidense.

15. Rafael y yo somos estadounidenses.

16. Juan Pablo es estadounidense.

Learn more about adjectives in: https://brainly.com/question/11385993

#SPJ1

Algún día, más curas contra enfermedades como el
cáncer. (haber)

Answers

Answer:

О  habrá.                                            

Explanation:

О  Algún día, habrá más curas contra enfermedades como el cáncer.

...

Correct form of estar to describe

Answers

the correct form is están
2. Está
3. Están
4. Está
6. Está
7. Están
8. Estas

Las palabras interrogativas. ¿Con qué palabra interrogativa se asocia la siguiente información?
¿Cuál?
:Cuándo?
¿Cuanto?
De dónde?
Donde?
¿Qué?
¿Quiénes?

Answers

Cual es el 511-2348
Cuando a las 4 de la tarde
Cuanto 20 dólares
De donde de San Juan
Donde en casa de Mari
Que es un DVD
Quienes Miguel y Ana

Please directions. ( The room will be a bedroom and you can make up the colors as you please).

What are the written description requirements?

Your written description must include:

1. An introductory paragraph describing the room you have chosen ( bedroom ) and where your home is located (city/state/country). <— as is !!!

Don't forget that wonderful verb: hay (-there is/there are) when giving a list of things in the rooms.

Don't forget to use un/una for a/an. Use ser for descriptions & estar for locations.

2. A detailed description of your ideal room in your house

location of things in the room in relation to each other physical description of things (size, color, shape)

3. You should use both the verb ser (descriptions) and the verb estar (locations) in your sentences.

Answers

Answer:

Explanation:

This is in english: The room I have chosen is the bedroom.  My home is located in california.  There is a desk in the bedroom so I can do my homework. There are plants around my bedroom. I have a window and a bed in my bedroom. There is also a bathroom in my room.There is a mirror in my bathroom. The color of the plants are green. The desk is infront of my bed.

This is in spanish:

La habitación que he elegido es el dormitorio. Mi casa está ubicada en California. Hay un escritorio en el dormitorio para que pueda hacer mi tarea. Hay plantas alrededor de mi dormitorio. Tengo una ventana y una cama en mi dormitorio. También hay un baño en mi habitación. Hay un espejo en mi baño. El color de las plantas es verde. El escritorio está enfrente de mi cama.

I tried my best,feel free to add anything if something is missing:)

Necesario practicar y perfeccionar la tolerancia Aceptar la diversidad y las diferencias culturales y personales es ser tolerante, afirma Visitador Adjunto de la Comisión de Derechos Humanos del Estado de México. e es tolerante cuando se aceptan la Sieviete diversidad y las diferencias culturales y personales; si se promueve su práctica, Comentó que dicha conducta debe entenderse como un modelo que cada cultura y sociedad debe seguir para habrá mejores relaciones humanas, afirmó garantizar mejores relaciones personales, el Visitador Adjunto de la Comisión de Derechos Humanos del Estado de México, Luis Antonio Hernández Sandoval. justas y pacíficas, pues se ha visto como un medio para resolver muchos grandes males de la humanidad. En la celebración del Día Internacional para la Tolerancia, el Visitador mencionó que ese término se refiere también a una conducta que no es congénita de los seres humanos, por lo que debe practicarse y perfeccionarse. Argumentó que la práctica a la que se refiere es coexistir en paz, hacer un compromiso corresponsable de todos para ver lo que piensan los otros y llegar a un consenso mediante un debate sano, pese a la diversidad de opiniones.
5. Redacta una carta de opinión sobre el contenido de la noticia anterior; emplea los verbos adecuados para reportar hechos y opiniones.

Answers

De acuerdo con la información de la noticia podemos opinar que el visitador expresa los puntos importantes de la tolerancia y la vida en sociedad.

¿Cómo escribir una carta sobre la noticia?

Para escribir una carta sobre la noticia debemos leerla cuidadosamente e identificar las ideas principales. Una vez hemos hecho este proceso podemos escribir esta carta incluyendo una opinión sobre este tema. De acuerdo con lo anterior, un ejemplo de carta sería:

A propósito de la noticia de los visitadores de la Comisión de Derechos Humanos del Estado de México podemos inferir que la tolerancia, el respeto y la vida en sociedad es un aspecto inherente a los humanos en el que debemos trabajar consienten y constantemente para promover una vida social sana.

En general, los humanos debemos respetar y tolerar las diferencias y reconocerlas como fortalezas para una sociedad más justa, más equitativa y más respetuosa. Por ejemplo, si queremos que respeten nuestra cultura, tradiciones y preferencias debemos respetar a los demás.

Aprenda más sobre noticias en: https://brainly.com/question/9718858

#SPJ1

I need letter D
write a short paragraph describing a birthday party in spanish

Answers

Estaba celebrando mi cumpleaños con mis amigos. Todos estaban muy emocionados de estar juntos y pasamos un buen rato. Había mucha comida y bebida para compartir y todos nos divertimos bailando y cantando canciones. También jugamos algunos juegos divertidos, lo que hizo que la fiesta fuera aún mejor. Al final de la noche, todos estábamos cansados ​​pero felices de haber pasado un tiempo tan agradable juntos.
Estaba celebrando mi cumpleaños con mis amigos. Todos estaban muy emocionados de estar juntos y pasamos un buen rato.
Había mucha comida y bebida para compartir y todos nos divertimos bailando y cantando canciones. También jugamos algunos juegos divertidos, lo que hizo que la fiesta fuera aún mejor. Al final de la noche, todos estábamos cansados pero felices de haber pasado un tiempo tan
agradable juntos.

SPANISH 1A: Unit 6 Writing Assignment 2
After watching the video about conjugating-AR verbs, choose TWO-AR verbs from your
vocabulary list and create verb charts like the one below. Make sure to include the forms of
each verb and then how they are translated in English. You may either create tables in an Open
Office document or write them by hand and text a picture of your charts to your teacher. It
would also be a good idea to practice these in your Spanish notebook.
Ejemplo: Hablar ("To talk")
Yo hablo
Tú hablas
El/Ella/Usted habla
Nosotros / Nosotras hablamos
Vosotros/Vosotras habláis
Ellos / Ellas / Ustedes hablan
Verb #1:
Nadar
Yo

Él / Ella / Usted
Nosotros / Nosotras
Vosotros/Vosotras
Ellos/ Ellas / Ustedes
I talk
You talk
TI
He/She talks / You (formal) talk
We talk.
You all talk (Spain)
They/You all talk

PLEASEEE HELPPP I’m struggling

Answers

Answer:

Verb: Nadar

Means: To swim

Yo- Nado (I swim)

Tú- Nadas (You swim)

El/Ella/Usted: Nada (He/ She swims/ You (formal) swim)

Nosotros/Nosotras: Nadamos (We swim)

Vosotros/Vosotras: Nadáis (You all swim)

Ellos/Ellas/Ustedes: Nadan (They/ You all swim)

Verb: Estar

Means: To be

Yo- Estoy (I am)

Tú- Estás (You are)

El/Ella/Usted: Está (He/ She is/ You (formal) are)

Nosotros/Nosotras: Estamos (We are)

Vosotros/Vosotras: Estáis (You all are)

Ellos/Ellas/Ustedes: Están (They/ You all are)

Give the appropriate forms of the adjectives

Answers

Answer:

5. Ellas son trabajadoras.

6. La médica es trabajadora.

7. Los ninos son trabajadores.

8. El es trabajador.

Explanation:


3. «A Roosevelt» presenta una clara advertencia a su interlocutor. ¿De qué lo advierte?
A la vez, la voz poética alaba a otros. ¿Quiénes son éstos, y con qué recursos cuentan!
¿Cuáles son las motivaciones explícitas de Darío al crear este poema? Cita en tu
respuesta frases y versos pertinentes.
C

Answers

De acuerdo con lo anterior, la advertencia del autor al interlocutor es que no va a ser tarea fácil dominarlos. Adicionalmente, el autor alaba a Dios. La motivación principal es destacar las características de América como indominable por los Estados Unidos.

¿De qué advierte el autor a Roosevelt?

En autor advierte a Roosevelt que a pesar de su carácter y gallardía, dominar a la América española no va a ser algo fácil debido a que ellos tienen diferentes características que los hacen fuertes e indominables.

¿A quién alaba el poema?

El poema alaba principalmente a Dios. No obstante, se refiere a varios personajes importantes de América como Netzahualcoyotl, Monctezuma, Cristobal Colón, el Inca, entre otros.

¿Cuáles fueron sus motivaciones explicitas?

Las motivaciones explicitas de Dario para crear este poema fueron demostrarle a Roosevelt que América era indominable con las siguientes frases:

Tened cuidado. ¡Vive la América española!

Se necesitaría, Roosevelt, ser Dios mismo,

el Riflero terrible y el fuerte Cazador,

para poder tenernos en vuestras férreas garras.

Aprenda más sobre poemas en: https://brainly.com/question/24582931

#SPJ1

Other Questions
The RNA sequence GGAUCUCUUGUAGAUCUGUUCUCUAAACGAAC lies in a section of the COVID-19 viral genome that sets up translation, which is the process of reading the RNA to create the proteins the virus needs to survive.(a) Use the webserver to predict the lowest energy structure of the sequence. Print out a picture of it. (b)What do you think the effect will be of the RNA being longer than the stretch you just similated? (c) Design an RNA sequence that folds into a single stem-loop. Run it through the RNAfold server and print a picture of your folded design. consider a political discussion group consists of 6 democrates, 3 republicans, and 5 independents. suppose that two group members are randomly selected, in succession, to attend the political convention. find the probability of selecting a independent then a democrat According to the Kaplan-Meier plot, amplification of more than 10 copies of myc in neuroblastoma (see fig. 4-11b), decreases disease-free survival by more than 80% post-treatment. Explain two mechanisms that may contribute to gene amplification of myc? Even though both lens cells and liver cells have numerous transcription factors that are present in both colls, the lens cell makes the crystallin protein (not albumin), whereas the liver cell makes albumin (not crystallin) Which of the following explains this cell specificity?A. Different specific transcription factors made in each cell determine which genes are expressedB. At fertilization, specific colls are destined for certain functionsC. The activators needed for expression of the crystallin gene are present in all cells.D. The promoters are different for the different genes How does the author's discussion of different death rates help readers understand the spread of the Black Death? Use evidence from the text in your responsepls i need help!! a rock rolling down a slope from rest covers a distance of 4 m in the first second. What distance will it covers in 3 sec? 5 3/10 = 5 ?/50If anyone can please help me with the rest what happened to some native Americans during the Jackson presidency ? In order for following to be consistent,-3x +4y +7z =-4-11x +24y +kz = -452x -5y -8z =9solve for k ?please show full steps Air passes over the top of an airplanewing at 170 m/s, and over the bottomat 130 m/s. What is the difference inpressure between the top andbottom of the wing? Scarlett and Roger sipped their drinks on the porch, discussing all the things they still had to do before the Easter holiday. As Roger finished her last bit of burger, he sighed, "I'm stuffed." He complained of having a burning sensation in his lower chest. "You probably ate too much. How about taking some antacid?" asked Scarlett. "I use it every time I get indigestion." Roger left to search the medicine cabinet. He eventually felt better. Roger got his body test results the next day. He glanced at them briefly and put the paper in his bag. "Maybe later I will get a better sense of what all this means," he said.'Roger's test results(at rest and fasting levels)TEST Roger's Result Normal RangeHeart rate 90 beats/min 60-100 beats/minBlood pressure 138/95 mm/Hg 120/80 mm/HgTotal cholesterol 242 mg/dL create a journal from the perspective of a citizen living in paris during the french revolution CAN SOMEONE HELP ME PLEASE ASAP write three rations that are equivalent to 6/9 Is this a function? Why or why not? Explain your reasoning for each part. How did Claudette Colvin's social status contribute to why civil rights groups didn't use her actions to inspire the bus boycott? Has your social status ever influenced the way people treat you? If so, describe the experience. According to the graph, in the United States how much land is used by cities compared to other land uses?A- Cities use one third as much of the land as forests.B- Cities use very little land compared to any other category.C- Cities use half as much land as agriculture.D- Most land is used by cities. Suppose when Sweetland (a hypothetical country) opens to trade, it imports computer software, a capital-intensive good.a. According to the HeckscherOhlin theorem, is Sweetland capital-abundant or labor-abundant? Briefly explain. (1 mark)b. What is the impact of opening trade on the real wage in Sweetland? Briefly explain. (2 marks)c. What is the impact of opening trade on the real rental on capital? Briefly explain. (2 marks).d. Which group (capital owner o Earthquakes and volcanic eruptions fall into which category of time scales of natural disruptions?A. periodicB. episodicC. diurnalD. random According to the information presented in the passage, what is the general populaces opinion of genius? How do the average rates of change for the pair of functions compare over the given interval?f(x)xg(x)xxQuestion content area bottomPart 1The average rate of change of f(x) over x is enter your response here. The average rate of change of g(x) over x is enter your response here. The average rate of change of g(x) is enter your response here times that of f(x). (Simplify your answers. Type integers or decimals. )