Can chickens
and ducks
live
together?

Answers

Answer 1

Answer:

no chickens and ducks not together live

Answer 2

Answer:Yes

Explanation:

I had my chickens and duck live together for a long time. The ducks might try to peck the chickens but it is just them figuring out the pecking order. Hope this helps!


Related Questions

For a species with a haploid number of 23 chromosomes, how many different combinations of maternal and paternal chromosomes are possible for the gametes based on the independent assortment of chromosomes during meiosis

Answers

Answer:

About 8 million

Answer:

About 8 million

Explanation:

What is difference between a skeletal muscle and a general animal cell

Answers

No se exactamente, pero general animal cell son más pequeñas...

A typical eukaryotic nucleus has to exchange a great deal of protein and nucleic acid material with the surrounding cytosol of the cell. Which choice correctly describes a feature of most nuclei that helps promote this exchange

Answers

Answer: A typical Eukaryote has an organized nucleus as well as an organized cell organelles.

The nucleus is enclosed in a nuclear envelope and the whole cell organelles are further enclosed in a plasma membrane (cell membrane).

From the question,the choice that correctly describe the feature of most nuclei that helps to promote the exchange of protein and other nucleic acids between the nucleus and the surrounding environment is the presence of nuclear pores which allows for selective movement of materials/items in and out of the nuclear space in a regulated manner.

Order the levels of organization from smallest (top) to largest (bottom)
A group of the same species in a living area, all living and nonliving things in an area, a living thing, all species living in an area

Answers

Answer:

a living thing

same species in a living area

all species living in an area

all living and nonliving things in an area

Explanation:

A living thing is one organism. The same species in a living area only includes one species in that area. All species living in an area includes all organisms in an area. All living and nonliving things in an area include all biotic and abiotic factors.  

Answer:

1. A living thing

2. A group of the same species living in an area

3. All species living in an area

4. All living and nonliving things in an area

Explanation:

(Was on my test and got it all right - hope it helped)

Domestication produced more food per unit area of land than had hunting and gathering, meaning Group of answer choices more storage was necessary for the extra food provided by domestication. fewer people were available for labor. more people were needed to produce more food. more people could be fed from the same amount of land.

Answers

Answer:

The correct option is;

More people could be fed from the same amount of land  

Explanation:

Domestication is the sustained integration of wild plant and animals into private use by the application of human effort selection, adaptation and development of suitable hereditary traits to oversee their care and reproduction in a mutual relationship,such that food is sustainably produced from a given portion of land than in the wild forest.

Consider the diagram that depicts the lysogenic and lytic cycles.

The steps of the lysogenic cycle are shown. In Step A, attachment and entry occurs. In step B, the provirus is formed. In step C, the cell begins to divide. In step D, the provirus leaves. In step E, the virus is replicated and assembled. In step F, lysis and release of the virus occurs.

In which step of the diagram are new viruses assembled?
step B
step C
step E
step F

Answers

The diagram is not given in the question, so the diagram is attached below: Answer:

step E

Explanation:

The viruses are assembled in Step E.

The assembly of the virus occurs in nucleus or cytoplasm of host cell. In step D, viral components of virus are synthesized and in the next step E, The viral component assembled into mature virus.

Hence, the correct option is "Step E".

Answer:

C. step E

Explanation:

just took the test from E D G E and got 100% :D

hope this helps ya'll

Deciduous forests can only be found in North America.

Answers

No actually the statement is false... Deciduous forest's can be found in many other places too

Answer:

This statement is false.

Explanation:

Deciduous forests can be found in other places that are not North America.

Here are the only places they can be found in.

eastern North America

western Eurasia

and northeastern Asia

Those are the only places where the Deciduous forests can be found.

describe the complex carbohydrate cellulose

Answers

Answer:

Complex Carbohydrates comprises starches and dietary fibers. Starches ate polymers of glucose. Dietary fibers are mainly indigestable complex Carbohydrates in plant cell walls (cellulose, hemicellulose, and pectin) and a variety of gums, mucilage, and algal polysaccharides.

brainliest All of the following are considered stress hormones except __________. A. epinephrine B. cortisol C. norepinephrine D. estrogen

Answers

Hey There!!

Your answer will be D. Estrogen.

Good Luck <3!!

By ♡Itsbrazts♡

Answer:

Hey!

Estrogen is your answer!

Explanation:

It is the Female developmental Hormone...

Hope This Helps!!

:>

How are vertebrates different from invertebrates?

Answers

Answer:

Vertebrates are those that have backbones or vertebral column, and invertebrates are those that do not have backbones or vertebral column.

Answer:

Vertebrates are those that have backbones or vertebral column and they dont

Explanation:

You read the following headline in the newspaper: "Scientists Find Gene Linked to Schizophrenia." As exciting as this news seems, the reality is that many more years of research will be required before this new knowledge will have any impact on people who have schizophrenia. How will this information likely benefit scientists as they continue to search for treatments

Answers

Answer:

Explanation:

This newfound information will ultimately allow scientists involved in the field to identify the DNA mutations that cause the disease. Once the scientists have correctly identified the exact DNA mutation that causes Schizophrenia then they will be able to begin targeting that specific DNA mutation and test different methods of stopping it in order to develop a treatment for the disease.

Sensory pathways are ____________ pathways that conduct information about limb ____________ and the sensations of ____________ , temperature, pressure, and pain. Stimuli received from receptors within the skin, muscles, and joints are processed through ____________ sensory pathways, while ____________ sensory pathways process stimuli received from the organs. Sensory pathways use a series of two or three neurons to transmit nerve signals from the ____________ .

Answers

Answer:

Ascending, Position, Touch, Somatosensory Pathways, Viscerosensory Pathways.

Explanation:

Sensory pathways are ascending pathways that conduct information about limb position, and the sensations of touch, temperature, pressure, and pain to the brain.

Stimuli received from receptors within the skin, muscles, and joints are processed through somatosensory pathways, while viscerosensory pathways process stimuli received from the organs.

I hope this answer helps.

Nancy Scheper-Hughes and Margaret Lock observed students at a teaching hospital trying to diagnose a woman's debilitating headaches. Students were impatient with the woman's description of her life circumstances, including an abusive husband and an ailing mother-in-law, but her description might BEST be termed as which of the following?
a. an illness narrative
b. a biomedical diagnosis
c. the human microbiome
d. alternative medicine

Answers

Answer:

The answer is option A.

Explanation:

An illness narrative is defined as "patients’ stories about their experiences of illness" on Oxford Medicine. According to the information given in the question, she is telling her experience in an autobiographical fashion with the environmental details, description and other things that may affect her situation, so her description can be best categorized as an illness narrative. The answer is option A.

I hope this answer helps.

Serratia marcescens bacteria has a gene that regulates red pigment production by cells. A student inoculates two nutrient agar plates of Serratia and incubates one at 250C and the other at 370C. Following incubation, the student observes that colonies on the 250C plate are red while those on the 370C plate are nonpigmented.
Which of the following statements is a logical conclusion based on these results?
A. Low temperatures cause repression of certain housekeeping genes.
B. Serratia cells undergo a genotypic change that is proportional to changes in temperature.
C. This is an example of constitutive gene expression.
D. Serratia genes for pigment production are induced at certain temperatures.

Answers

Answer:Serratia genes for pigment production are induced at certain temperatures

Explanation:

The red pigment production is dependents on temperature.

Some bacteria are thermophile doing very well in extreme temperature while some are very sensitive to temperature changes.

The red pigment production is regulated by certain gene in the bacteria but can only be activated at certain temperature. 25°C was suitable for the red pigmentation that is why the plate color changed this indicate the sensitivity of the pigment production to temperature changes.

Conclusion - To get the best of serratia it is best to keep them at a temperature lower than the normal room temperature for the gene to be activated and full express itself.

2. a) What is gene flow? (3 points)
) v
b) How does gene flow affect the fitness of a population? (2 points)
3. a) What is an index fossil? (2 points)

Answers

Answer:

Gene flow is the transfer of genes in and out of a population.

2. Geneflow affect the fitness ofva population.

Gene flow within a population can cause an increase in the genetic variation of the population, whereas gene flow between genetically distant populations can reduce the genetic difference between the populations.

Index fossil is any animal or plant preserved in the rock record of the Earth that is use to identify and gate geologic periods.

Explanation:

Gene flow is the transfer of genes or genetic variation in and out of a population.

Gene flow is cause by movement of organisms that reproduce in their new population or movements of gametes. For example, when bees carry pollen from a flower in one location to flowers in another location, the bees are causing gene flow.

Gene flow within a population can cause an increase in the genetic variation of the population, whereas gene flow between genetically distant populations can reduce the genetic difference between the populations. Thereby affecting it's genetic fitness.

Index fossil is any animal or plant preserved in the rock record of the Earth that is use to identify and gate geologic periods. Examples of index fossils include: Ammonites were common during the Mesozoic Era (245 to 65 mya

Meristic traits are characterized by having phenotypes that are described by ________. Meristic traits are characterized by having phenotypes that are described by ________. irrational numbers prime numbers imaginary numbers whole numbers complex numbers

Answers

Answer:

whole numbers

Explanation:

Meristic traits are referred to as traits that are countable, hence the phenotypes are described by whole numbers instead of irrational, prime, complex or imaginary numbers. Meristics traits are usually associated with fishes, it is used to characterize different known species of fish or can also be employed in identifying unknown fish species. Meristic studies are mostly done on dead fishes than on living fishes

An example of a countable trait in fishes is the number of gill rakers. The identification of the number of gill rakers can be used in identifying the specie of fish.

During an intramuscular injection procedure, the medication label should be checked:

Answers

Answer:

The medication label should be checked by comparing it with the  MAR (Medication Administration Records or therapeutic documentation care plan TDCP).That is the label  printed on the medication should be compare with the Medication  Administrations records  

Explanation:

Ideally this should be done three times, when it is removed from the medication cart,and before and after  it was removed form the  medication  cart.

Besides,the date of expiration should be checked,and the regulations concerning administrations of multi-does vial should be  taken into considerations.

The medications mode of storage should be taken into confederation,proper storage must be ensured.

Generally the application of medication through injection into the muscles for faster absorption  into the blood streams for fast distribution is called IM. This is aided by the rich blood supply to the muscles.Therefore it is a faster mode of blood application than the subcutaneous routes.

What is the role of acid in our stomach?

Answers

break down food

synthesis protein

kill bacteria

Answer:

The role of acid in our stomach is to help breakd down, digest, and absorb nutrients such as proteins.  It also aids in eliminating viruses and bacteria in the stomach to protect the stomach from becoming infected, since it is apart of helping protect the lining of the stomach.

Explanation:

Any process used to ask and answer testable questions about observations of the natural world” defines which term?

Answers

Answer:

That is the definition of a hypothesis.

Explanation:

Which form of natural selection does the graph represent? A graph has trait value on the horizontal axis and proportion of individuals on the vertical axis. The original population increases to a maximum point at the center, and then decreases. The population after selection increases, decreases, increases, and then decreases again. The maximum of the original population is the minimum of the population after selection. directional selection disruptive selection sexual selection stabilizing selection

Answers

Answer:

directional selection

Explanation:

Directional selection is the most common type of natural selection and occurs when some individuals with characteristics favorable to the conditions of the environment in which they live, have survival advantages over individuals who do not have this advantage, who end up dying.

Imagine, for example, a graph showing the directional selection in the same species of moths. Moths of the same species have white and brown collations, in summer, brown moths can camouflage themselves on tree trunks, while white moths cannot and are easily captured by their predators, which means that the amount of white moths decrease.  In this graph, the population of white moths would be at a minimum, at the same time that the population of brown moths would be at maximum.

However, with the arrival of the reverse, snow begins to cover the trees, allowing white moths to camouflage themselves more easily. The brown moths, then, are very exposed to predators, causing their population to reach the minimum while the population of white moths reaches the maximum.

Answer: Graph A

Explanation:

why does my cat act rough with her kittens ? WHO GIVES A REASONABLE ANSWER GET'S BRAINLIEST.(This is not from a subject just curious)

Answers

Answer:dude hes just beingplayful its all good

Explanation:

Answer:

Mother cats are cranky and have health issues that cause them temporary pain and discomfort.  When the kittens get too annoying or come too close, the mother cat may swap at them to go away and scram.  The kittens, however, are not affected in the least bit.

Explanation:

Which was the first “cell” viewed by the light microscope? microbe atom DNA oak bark

Answers

Answer:

Option d (Oak bark) is the correct choice.

Explanation:

Throughout 1665, Robert Hooke would be the very first individual who saw cells through some kind of microscopic examination. The innovation as well as advancement and implementation of microscopy allowed this to happen.Microscopic constructions would not have been seen already therefore researchers haven't understood which one living creatures were managed to make from.

The other three alternatives are not related to the given particular instance. So that option d would be the correct one.

Answer:

Oak bark

Explanation:

Confirm if all of these are correct for 10 points + brainliest. If they are incorrect, please correct it.

Answers

Answer:

Correct

I am not sure.

Explanation:

Hope it helps you...

Which phrase describes a feature of an earthquake’s epicenter?

starting point of an earthquake
place around the center of an earthquake
region directly above the focus
point about 100 kilometers deep in the lithosphere

Answers

Answer:

It is answer c

Explanation:

i know this because The epicenter is directly above the earthquake's hypocenter (also called the focus)

The phrase which describes a feature of an earthquake’s epicenter is: C. region directly above the focus.

An earthquake can be defined as a sudden, natural shaking of the ground, as a result of movements within the Earth's crust and upper mantle (lithosphere) that typically creates seismic waves.

An epicenter is the point on the surface of planet Earth, which is perpendicular to the hypocenter (focus) and it indicates where the seismic waves from an earthquake are most intense.

On a map, an earthquake’s epicenter is located at the point where the three (3) circles intersect because earthquake are generally shallow.

Read more: https://brainly.com/question/21620194

When taking a person's blood pressure, after proper inflation of the cuff, the first pulse sound that is heard through the stethoscope indicates that blood is flowing through the artery past the cuff. The reading on the pressure gauge at this point represents:_________.

Answers

Answer:

Diastolic pressure

Explanation:

The reading on the pressure gauge at this point represents the Diastolic pressure. In a medical context, this is the pressure of the blood in the arteries when the heart is filling. In the numerical readings, this is represented by the lower end of the two blood pressure measurements. For example, if the individual's blood pressure is taken and the measurement of 120/80 is taken, then 80 is the diastolic pressure in this scenario.

When males reach a certain age, the body begins the process of puberty.
How does the body control this process?
O A. Hormones are released by the endocrine system.
B. A fallopian tube is produced by hormones.
C. Reproductive organs are formed by the body.
D. The nervous system produces gametes.

Answers

D. The nervous system produces gametes

Answer:

A. Hormones are released by the endocrine system.

Explanation:

ap.ex

What structure of the endocrine system releases insulin if blood sugar levels get too high?

A. Thyroid

B. Adrenal Gland

C. Thymus

D. Pancreas

Answers

Answer:

The answer is Pancreas.

It releases two types of hormone that is insulin and glucagon.Insulin and glucagon are opposite in function. Insulin decreases the glucose level in blood whereas glucagon increases glucose level in blood.

hope it helps...

Which of the following is not an advantage that glycogen provides to muscle cells in which it is stored? Group of answer choices It is available for quick energy spurts. It requires no energy to mobilize the glucose residues for metabolism. It gives anaerobic metabolism a boost.

Answers

Answer: C: It gives anaerobic metabolism a boost

Explanation:

Glycogen doesn't really have anything to do with anaerobic metabolism, but both other statements are correct

The last few miles of the marathon are the most difficult for Heather. Her hair is plastered to her head, sweat clings to her arms, and her legs feel as if they had nothing left. Heather grabs a cup of ice water. The ice cubes smash against her nose as she gulps some cool refreshment and keeps on running. Then a breeze kicks up and she finally feels some coolness against her skin. Drops of sweat, once clinging to her forehead, now spill down, and Heather feels a stinging as the sweat flows into her eyes.Sweat on Heather’s forehead and arms formed drops because of the ______.

Answers

Answer:

heat.

Explanation:

Answer:

Hello! I am sorry I am late.

The answer is heat.

Explanation:

Hope this answer helped you. Have a great day or night! Good luck on your work!

<3 <3 <3

A plants can have either brown (B) or red (b) leaves. Brown is the dominant trait. If a plane has a genotype bb; which best describes the plant.

Answers

Answer:

Explanation:

A plants can have either brown (B) or red (b) leaves with brown being a dominant trait meaning that it can be BB or Baby

While the red leaves are inherited in the recessive condition as bb.

Thus, a plant with a genotype of bb can be described as having a phenotype/ an appearance with red leaves i.e. the plants produces red leaves due to this genotype.

Other Questions
John's lyrics are somewhat autobiographical and introspective on this '65 song that features brilliant harmonies throughout and lyrics that offer help to the forlorn listener. It is... Which two statements best describes the purpose of the passage ? please Evaluate ( 8/3) to the 2 power A). 8/9 B). 64/9 C). 64/3 D). 55 Line CD passes through points (0, 2) and (4, 6). Which equation represents line CD? Which of the following was true when Truman met Stalin in Potsdam in 1945? A.Their two nations were already enemies The war in the Pacific was still being fought. Britain had decided not to join them. World War II had ended. Please Help asap!!! Please give explanation If the price of biscuit per packet increased from N250 to N500 and the quantity bought per week decreased from 300 to 200 packets, determine the elasticity of demand for biscuit. Please answer this correctly without making mistakes What is the slope of the line passing through the points (6,7) and (1,5) An education researcher claims that 58% of college students work year-round. In a random sample of 400 college students, 232 say they work year-round. At alphaequals0.01, is there enough evidence to reject the researcher's claim? Complete parts (a) through (e) below. It is a well-known fact that Dr. Barnes rides a skateboard, sometimes even on campus. Suppose that Dr. Barnes selects a skateboard by first picking one of two skateboard shops at random and selecting a skateboard from that shop at random. The first shop contains two "rad" skateboards and three "gnarly" skateboards, and the second shop contains four "rad" skateboards and one "gnarly" skateboard. What is the probability that Dr. Barnes picked a skateboard from the first shop if he has selected a "gnarly" skateboard? What the answer to the question If a circle has a diameter with endpoints of (-3, 0) and (5, 4) then the equation of the circle is? Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code. B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein. C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein. D) Both B and C are possible outcomes. g A spontaneous process is one in which: A. releases a large amount of heat B. may happen (is possible) C. will rapidly approach equilibrium D. will happen quickly Based on the function F(x) = x^4 - 3x^3+ x^2 +2 and the graph of G(X) below,which of the following statements is true? The goal of a statement of purpose is: 62(1+2) isn't that should be 1 , cause in the calculator it said 9 but the order is the parenthisis/brakets first ?? so it should be like 2 times 3 then 66 which gives 1 . Which of the following pitches is a non-chord tone for the I chord in G major? - G - B - A - D When a negative amount is in the base period and a positive amount is in the analysis period (or vice versa), a meaningful percent change cannot be calculated.A. TrueB. False