At a restaurant the bill came to $62.00. If you leave $69.44, what percent tip is
that?

help me please :0000

Answers

Answer 1
The answer would be 12%
Answer 2

Answer:

12%

Step-by-step explanation:

Take 69.44 and subtract 62.

You should get 7.44.

If you take the original 62 & multiply by .12, you get the 7.44 tip.


Related Questions

The ratio of two supplimentary angles is 4:1. Find the measures of both angles.​

Answers

Answer:

The Measures of both angles are 144° and 36°

Step-by-step explanation:

A car travels 238 miles in 3 hours and 30 minutes. Hi many miles does it travel per hour

Answers

Answer:

68 miles

Step-by-step explanation:

1. Which of the following is NOT a true statement?
a) A quadrilateral with 2 pairs of parallel sides is a parallelogram.
b) Every rhombus has 2 pairs of parallel sides.
c) Every quadrilateral with 4 right angles is both a rectangle & rhombus.
d) Every rectangle is also a parallelogram

Answers

Answer:B

Step-by-step explanation: not cause you have trapeziums not c cause you have squares not d cause it just aint

Answer:They are all true statements

Step-by-step explanation:

what’s the equation for this table?

Answers

Answer:

y=2.5x-3

Step-by-step explanation:

first, we find the y-intercept, which is the number with a zero in the x

That would be -3

next, we find the slope

to do this, we have to take two numbers on the y side next to each other and subtract.

For this example we will use 7 and 2

7-2=5

And just to be positive, we will also do 12 and 7

12-7=5

Okay, now that we know that the number is growing by 5 every time, we know that it is now 5/2 because y is growing by 5 and x is growing by 2

Now, we make the x side grow by only 1, so to do this, we will divide both sides by two.

Now we have 5/1 or just 5

Finally, to put that into the right format, we do y=5x-3

You're Welcome

Good Luck

*5 EXTRA POINTS* The height of a cylinder is 8 units. The circumference of the base of the cylinder is 10π units.
Which measurement is closest to the volume of the cylinder in cubic units?

Answers

the answer would be 80 cubuc unitsStep-by-step explanation:

Answer:

628.32

Step-by-step explanation:

the circumference is ALWAYS Pi times more than the diameter so the diameter must be 10, and 10/2 is 5 so the radius is 5

5 squared is 25

25 times π is 78.5398163397

and 78.5398163397 times 8 is around 628.32

3х+бх
What is 3x +6x simplified

Answers

Answer:

9x

Step-by-step explanation:

because they're like terms add them together

3x + 6x = 3 + 6 =

9x, could i have brainliest if possible thanks!

9x. Simply add the 3 and 6. You can do that because they both have the same variable. You have 3 x’s and 6 x’s, so you’ll have 9 x’s.

HELP ASAP PLS I NEED HELP

Answers

Answer:

A would be tour awnser for today

Unit rate 5 breaks in 8 hours

Answers

.625 I think but sorry if not

please help me with this question.

Answers

Answer: D! :)

Explanation:
18 = 3/5(30)
18 = 18

There were some zombies in the kitchen, however, the lunch lady was able to eliminate 5 zombies. There are now 12 zombies in the kitchen. How many zombies were in kitchen before the lunch lady took care of a few? J K L 60 8 17​

Answers

Answer is 17.
There were 17, before the lunch lady... killed... 5. Leaving us with12.

Your welcome :))

18=3(3x-6)
4x+6+3=17

Answers

Answer:

3(3x -6)=9x-18

4x +6+3=4x +9

Find the area of the figure. Use 3.14 for it.
4 ft
8 ft
L
3 ft
4 ft
3 ft
8 ft
3 ft
The area of the figure is
ft.

Answers

9216 i just multiplied with the calculator

n - 3 = 10

pls someone help

Answers

Answer:

n-13

Step-by-step explanation:

im not up for this bc didn't sleep a lot hope i did ok

What is the volume of a sphere with radius 4?
Round to the nearest whole number.

Answers

Answer:

268.08

rounded number- 268

find the number in the whole number place, 8, and look one place to the right for the rounding digit on the right side of the decimal point, 0. round up if this number is greater than or equal to 5, and round down if it is less than 5.

formula for sphere volume- 4/3 (pie- 3.14) r^2

what 1x0 i now it is 0

Answers

Answer:

haha yes it's 0 good job!

Step-by-step explanation:

Answer:

0

Step-by-step explanation:

Yes you are right.

also it's "know" not "now".

I need help! I'm running out of coins!!!​

Answers

Answer:

4) m∠F ≈ 67°

5) m∠x ≈ 53°

6) m∠? ≈ 16°

Step-by-step explanation:

(It's not letting me post, so I'll attach screenshots:)

hey does anyone know what 4/5 times 7/8 is ?- its for my math hw and its due in a hour thx!

Answers

Answer:

0.7

Step-by-step explanation: (4/5)*7)/8

Hope this helps:)

Mrs. Barkley is making a snack mix out of different flavors of pretzels and chips. The weight of each snack package she used to make the mix is shown on the line plot below. What is the total weight, in ounces, of the snack mix?

Answers

Answer:

20 ounces

Step-by-step explanation:

The line plot is attached below.

From the line plot, we can see that there is a total of 7 snack mix. Two of the snack mix weigh 1 and half (1.5) ounces each, one snack measure 2 and three quarter (2.75) ounce, three snack mix measure three and half (3.5) ounce each and one snack measure 3 and three quarter (3.75) ounce. Therefore the total weight of the snack mix is:

Total weight = (2 * 1.5) + (1 * 2.75) + (3 * 3.5) + (1 * 3.75)

Total weight = 20 ounces

What is the approximate circumference of a circle with a radius of 12 ft? Use 3.14
for TT.
A. 3.82 ft
B. 7.64 ft
C. 37.68 ft
D. 75.36 ft.

PLEASE I NEED HELP

Answers

answer:

D 75.36

explanation:

i did 3.14x12x2

i hope i am right

Answer:

D. 75.36 ft

Step-by-step explanation:

The formula for circumference is C=2TTr.  3.14x12=37.68  37.68x2=75.36


What does point A represent?

Answers

Point A is (12, 300). What this is saying: For every 12 teachers there are 300 students.

Which net represents the figure?
Please help

Answers

Answer:

the first one

Step-by-step explanation:

the rest of the options have triangles and a rectangular prism doesnt have any triangle shaped sides. hope my answer makes sense :)

Answer: the one that looks like an upside t or it can be called (A)

Step-by-step explanation:

do the folding in your head

help pleaseee?? explain

Answers

Answer:

sorry I didn't know what to do in this

really really sorry of which class you are .?

what is the value of 7 in the number 8975

Answers

Answer:

70?

Step-by-step explanation:

8975
^ 7 is on tens

In a certain city, E Street, W Street, C Street, and
D Street are parallel streets that intersect K Street
and M Street. How long is K Street between C Street
and D Street?

Answers

Answer:

it is d because the age of 200

The required measure of Street K between Street C and D is 337.5 ft.

Given that,
In a certain city, E Street, W Street, C Street, and D Street are parallel streets that intersect K Street and M Street. How long is K Street between C Street and D Street is to be determined.

What is the Ratio?

The ratio can be defined as the proportion of the fraction of one quantity towards others. e.g.- water in milk.

here,
Let the distance of street K between C and D be x,
Now,
Taking the equality of the proportionality expression of triangles,
600 / 400 = 600 + x / 400 + 250
6 / 4 = 600 + x / 625
3750/4 = 600 + x
937.5 = 600 + x

x = 337.5

Thus, The required measure of Street K between Street C and D is 337.5 ft.

Learn more about ratios here:

brainly.com/question/13419413

#SPJ2

Whoever gets this right I will mark u brainliest
Which equation matches the graph below

Answers

Answer:

y= -x-5

Step-by-step explanation:

Hope this helps !

Answer:

y=-x-5

Step-by-step explanation:

The x intercept is -5

Hope this helps ^-^

alos heres a hint...use desmos

if 9 out of 25 people are left-handed what percent are right-handed

Answers

Answer:

64%

Step-by-step explanation:

If  9 out of 25 people are left-handed

That means 25-9 = 16 people are right handed

or 16/25 are right handed

Multiply the top and bottom by 4 to get it out of 100

64/100

Percent means out of 100

64% are right handed

shari has 7 months to save $294 for a vacation. how much must shari save each month in order to save at least $294 for her vacation

Answers

$42 because shari needs 294 so divide that by seven and then you get $42

(x+8)(x-5)
[tex] (x + 8)(x - 5) [/tex]

Answers

Answer: [tex]\huge\boxed{\ x^2+3x-40}[/tex]

My step-by-step explanation:

1. First thing we do is: Distribute

(x+8)(x−5)x

(x−5)+8(x−5)

2. Second thing:Distribute

x(x−5)+8(x−5)

x^2−5x+8(x−5)

3.Third thing: Distribute

x^2−5x+8(x−5)

x^2−5x+8x−40

4. Fourth thing: Combine like terms

x^2−5x+8x−40

x^2+3x−40

5.And finnaly we find: The solution

x^2+3x−40

Good Luck!


[tex](m{}^{2})(m {}^{?}) = m {}^{5} [/tex]
What is the answer for - ?

Answers

Answer:

5/2

Step-by-step explanation:

[tex](m^{2})(m^{?}) = m^{5}\\ m^{2*?} = m^{5}\\m^{2*5/2} = m^{5}\\(m^{2})(m^{5/2}) = m^{5}[/tex]

You deposit 600$ in a savings account.the account earns 10% simple interest per year
A. What is the interest after 10 years?


B.what is the balance after 10 years

Answers

Answer:

A) $600

B) $1200

Step-by-step explanation:

First, converting R percent to r a decimal

r = R/100 = 10%/100 = 0.1 per year,

then, solving our equation

I = 600 × 0.1 × 10 = 600

I = $ 600.00

The simple interest accumulated

on a principal of $ 600.00

at a rate of 10% per year

for 10 years is $ 600.00.

Other Questions
In 1985, the Gramm-Rudman-Hollings Balanced Budget and Emergency Control Act was passed in order to ensure that the federal government submitted goals to meet the deficit. If the goals are not met, then the president must order spending cuts across the entire budget based on the recommendation of the comptroller general, a position appointed by the president.The scenario above describes which of the following powers attributed to Congress?a. Congressional oversight by reviewing appropriations requests that need to meet certain spending criteriab. Congressional response to presidential budget cuts based on the comptroller general's recommendationsc. Congressional subcommittees that can review improper relationships between the comptroller and the presidentd. Congressional action to block proposed spending cuts to all federal agencies by amending the executive budget to target items from the president's agenda Which is the dominantmouth shape for emojis inthe picture below?How do you know?Smiley = MFrowny = mSchilly ScienceSMILEYFROWNY Gary wants to buy a bike that is 30% off. The original price is $109.56. What is the amount of the discount? Loss of voluntary control over urination is calledO dialysisO incontinenceO neurogenic bladderO urgencyPrevious what is one sixth of the product of four and nine table saws you can use with __ or __ but not both at the same time HELP PLS What is the value of the x variable in the solution to the following system of equations? (1 point)4x + 2y = 6x - y = 3O-15-22 Do violence and alcohol have anything to do with each other? If so, what do they have in common? If they don't have anything in common, tell me why? (SAT Prep) Find the value of x. He math team does practice drills that each last hour. In February the team did practice drills for a total of 24 hours. How many practice drills did the math team do in feburary PLEASE ANSWER FAST!!!!Explain why the U.S. decided to change its goal from protecting western settlements to attacking Native Americans and forcing them onto reservations. i just asked my best friend if she talk ab me behind my back bc i kinda have trust issues and i dont get what she means by this.... do yall have any idea? Write and solve an equation to determine the value of x in the figure. a. 3x 84; 252 b. 3x 84; 28 c. 3x 84; 84 d. 3x 84; 81 Find the value of x. Plsssssss Help!!!!Look at the map. How might the Gupta empire have been able to flourish through trade? Identify geographic features to support your answer. transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC Hey can somebody get this for me been stuck for five min Select the correct answer from the drop-down menu.What is implied by the underlined section in the passage?Caesar's statement to Brutus implies that imagine being in spanish course on edmentum its pretty hard not gonna kap features of liberalism theory