“A school is looking to build a new 30 desktop PC computer suite. The school has limited funds available. The PCs will have a lot of different software installed as well as an operating system and multiple students’ profiles.” [6 marks]

Answers

Answer 1

Answer:

it depend on the software the computer has along with how much data it can hold

Explanation:

Answer 2

Answer:

Depends on the software code the computer has

Explanation:


Related Questions

What is the function for displaying differences between two or more scenarios side by side?
Macros
Merge
Scenario Manager
Scenario Summary

Answers

Answer:

its d

Explanation:

Answer:

scenario summary

Explanation:

What is another name for control structure
Object
Sequence
Loop
Decision

Answers

Answer: Sequence

Brainliest me and reply if im right!

What will be the output?
class num:
def __init__(self, a);
self.number = a
def_mul__(self,b):
* return self.number + b.number
#main program
numA = num(8)
numB = num(4)
result = numA* numb
print(result)
O4
O 12
O 32
4096

Answers

Answer : 32

Explanation

the variable a & b and A & B are different. So the only program that work is at #main program.

Hence that A = 8 and B = 4 and the result is A * B so 8*4=32.

Sorry if im wrong

32  will be the output of this question

What is the output?

An industry's output is the total amount of goods and services generated within that industry over a specific time period and sold to customers or other firms. An industry's annual production of boxes of cookies or tons of sugar, for instance, can be considered output.

The quantity a person produces in a particular period of time. d.: energy or power given or produced by a device or system (as for storage or for conversion in kind or in characteristics)Here is how we might define these two phrases in business terms: The results are what the business requires or wants to accomplish. The acts or things that help achieve an outcome are called the outputs.

Variables a and b and A and B are distinct. Thus, the #main program is the only program that functions. Because A = 8 and B = 4, the outcome is A * B, which equals 8*4=32.

Therefore,  the output of this question

Learn more about output here:

https://brainly.com/question/13736104

#SPJ5

1. Write a class Name that stores a person’s first, middle, and last names and provides the following methods:
public Name(String first, String middle, String last)—constructor. The name should be stored in the case given; don’t convert to all upper or lower case.
public String getFirst()—returns the first name
public String getMiddle()—returns the middle name
public String getLast()—returns the last name
public String firstMiddleLast()—returns a string containing the person’s full name in order, e.g., "Mary Jane Smith".
public String lastFirstMiddle()—returns a string containing the person’s full name with the last name first followed by a comma, e.g., "Smith, Mary Jane".
public boolean equals(Name otherName)—returns true if this name is the same as otherName. Comparisons should not be case sensitive. (Hint: There is a String method equalsIgnoreCase that is just like the String method equals except it does not consider case in doing its comparison.)
public String initials()—returns the person’s initials (a 3-character string). The initials should be all in upper case, regardless of what case the name was entered in. (Hint: Instead of using charAt, use the substring method of String to get a string containing only the first letter—then you can upcase this one-letter string. See Figure 3.1 in the text for a description of the substring method.)
public int length()—returns the total number of characters in the full name, not including spaces.
2. Now write a program TestNames.java that prompts for and reads in two names from the user (you’ll need first, middle, and last for each), creates a Name object for each, and uses the methods of the Name class to do the following:
a. For each name, print
first-middle-last version
last-first-middle version
initials
length
b. Tell whether or not the names are the same.
Here is my code. I keep getting a method error with getFullName in the Name.java file. Please help me re-write the code to fix this issue.
//Name.java
public class Name
{
private String firstName, middleName, lastName, fullName;
public Name(String first, String middle, String last)
{
firstName = first;
middleName = middle;
lastName = last;
String fullName = firstName '+' middleName '+' lastName;
}
public String getFirst()
{
return firstName;
}
public String getMiddle()
{
return middleName;
}
public String getLast()
{
return lastName;
}
public String firstMiddleLast()
{
return firstName + ' ' + middleName + ' ' + lastName;
}
public String lastFirstMiddle()
{
return lastName + ", " + firstName + ' ' + middleName;
}
public boolean equals(Name otherName)
{
return fullName.equalsIgnoreCase(otherName.getFullName());
}
public String initials()
{
return firstName.toUpperCase().substring(0,1)
+ middleName.toUpperCase().substring(0,1)
+ lastName.toUpperCase().substring(0,1);
}
public int length()
{
return firstName.length() + middleName.length() + lastName.length();
}
}
//NameTester.java
import java.util.Scanner;
public class NameTester
{
public static void main(String[] args)
{
Scanner input = new Scanner(System.in);
String firstName1 = new String();
String middleName1 = new String();
String lastName1 = new String();
String firstName2 = new String();
String middleName2 = new String();
String lastName2 = new String();
System.out.print("\nPlease enter a first name: ");
firstName1 = input.nextLine();
System.out.print("Please enter a middle name: ");
middleName1 = input.nextLine();
System.out.print("Please enter a last name: ");
lastName1 = input.nextLine();
Name name1 = new Name(firstName1, middleName1, lastName1);
System.out.print("\nPlease enter another first name: ");
firstName2 = input.nextLine();
System.out.print("Please enter another middle name: ");
middleName2 = input.nextLine();
System.out.print("Please enter another last name: ");
lastName2 = input.nextLine();
Name name2 = new Name(firstName2, middleName2, lastName2);
System.out.println();
System.out.println(name1.firstMiddleLast());
System.out.println(name2.firstMiddleLast());
System.out.println(name1.lastFirstMiddle());
System.out.println(name2.lastFirstMiddle());
System.out.println(name1.initials());
System.out.println(name2.initials());
System.out.println(name1.length());
System.out.println(name2.length());
if (name1.equals(name2))
System.out.println("The names are the same.");
else
System.out.println("The names are not the same.");
}
}

Answers

i dont know the answer lol thats too long

Explanation:

Your computer system looses power while you are working on a project for a very important client

Answers

isljgaek jadkghdkjhasdkjfhadskj afhdsfkjdahk dh

Answer:

I never knew that, thank you for telling me! I'll note that down

Pls help I will give points

Answers

Answer:

phone !!

Explanation:

since it's a mobile app, that would apply to a handheld device !!

i hope this helps !!

Answer:

any answer except a desktop or laptop, i.e. tablets, phones, pda's, etc.

Explanation:

Mobile apps are designed for handheld mobile devices, even though laptops are technically mobile, they're based upon desktop computer arcitechture, in which mobile apps will not run, I hope this helps.

Pls help will mark brainliest as soon as u awnser

Answers

Answer:

The answer is...

Explanation:

It is A or D I would go with D tho

Hope this helped

:)

In the computing environment the numerical value represented by the pre-fixes kilo-, mega-, giga-, and so on can vary depending on whether they are describing bytes of main memory or bits of data transmission speed. Research the actual value (the number of bytes) in a Megabyte (MB) and then compare that value to the number of bits in a Megabit (Mb). Are they the same or different

Answers

Answer:

1024 bytes in a megabyte and there are 8000000 bits in a megabyte. They are different.

Explanation:

There are 8000000 bits and 1024 bytes in one megabyte. They are unique.

What is Megabyte?

The megabyte is a multiple of the digital informational unit byte. The suggested unit sign for it is MB. The International System of Units unit prefix mega is a multiplier of 1000,000. As a result, one megabyte is equal to one million bytes of data.

About a million bytes make up a megabyte (or about 1000 kilobytes). Typically, a few megabytes might be required for a 10-megapixel digital camera photograph or a brief MP3 music clip.

1000000 bytes make up one megabyte (decimal). In base 10, 1 MB equals 106 B. (SI). 1048576 bytes make up a megabyte (binary). A megabyte can imply either 1,000,000 bytes or 1,048,576 bytes, according to the Microsoft Press Computer Dictionary. Apparently, Eric S.

To read more about Megabyte, refer to - https://brainly.com/question/2575232

#SPJ2

what are the pros and Con's of human -computer interaction?​

Answers

Answer:

pros-you can talk to a man made intelligence without the drama except for system crashes lol

-you can have them as a romantic partner.

cons-there are programmed emotions so it isn’t that real.

romantic emotion can be fake.

Explanation:

Juan is writing a new program using Python and wants to make sure each step is located on its own line. Which principal of programming is Juan following?

Hand coding
Line coding
Planning & Design
Sequencing
PLEASE HURRYYY THIS IS A FINAL EXAM :C

Answers

Answer:

Its sequencing or planning and design not 100%

Explanation:

Answer:

its sequencing

Explanation:

Write a python 3 function named words_in_both that takes two strings as parameters and returns a set of only those words that appear in both strings. You can assume all characters are letters or spaces. Capitalization shouldn't matter: "to", "To", "tO", and "TO" should all count as the same word. The words in the set should be all lower-case. For example, if one string contains "To", and the other string contains "TO", then the set should contain "to".
1.Use python's set intersection operator in your code.
2.Use Python's split() function, which breaks up a string into a list of strings. For example:

sentence = 'Not the comfy chair!'
print(sentence.split())
['Not', 'the', 'comfy', 'chair!']
Here's one simple example of how words_in_both() might be used:

common_words = words_in_both("She is a jack of all trades", 'Jack was tallest of all')

Answers

Answer:

def words_in_both(a, b):

 a1 = set(a.lower().split())

 b1 = set(b.lower().split())

 return a1.intersection(b1)

common_words = words_in_both("She is a jack of all trades", 'Jack was tallest of all')

print(common_words)

Explanation:

Output:

{'all', 'of', 'jack'}

The program returns the words which exists in both string parameters passed into the function. The program is written in python 3 thus :

def words_in_both(a, b):

#initialize a function which takes in 2 parameters

a1 = set(a.lower().split())

#split the stings based on white spaces and convert to lower case

b1 = set(b.lower().split())

return a1.intersection(b1)

#using the intersection function, take strings common to both variables

common_words = words_in_both("She is a jack of all trades", 'Jack was tallest of all')

print(common_words)

A sample run of the program is given thus :

Learn more : https://brainly.com/question/21740226

(Please Help! Timed Quiz!) Messages that have been accessed or viewed in the Reading pane are automatically marked in Outlook and the message subject is no longer in bold. How does a user go about marking the subject in bold again?

*Mark as Read
*Flag the Item for follow-up
*Assign a Category
*Mark as Unread

Answers

Answer:

D Mark as Unread

Explanation:

I just took the test

Given three subroutines of 550, 290, and 600 words each, if segmentation is used then the total memory needed is the sum of the three sizes (if all three routines are loaded). However, if paging is used, then some storage space is lost because subroutines rarely fill the last page completely, and that results in internal fragmentation. Determine the total amount of wasted memory due to internal fragmentation when the three subroutines are loaded into memory using each of the following page sizes:
a. 100 words
b. 600 words
c. 700 words
d. 900 words

Answers

The answer is D i got it right when I did it

Typically, external fragmentation wastes one-third of memory. Internal fragmentation occurs when space inside a designated region is wasted. Thus, option D is correct.

What wasted memory due to internal fragmentation?

The mounted-sized block is allotted to a method whenever a request for memory is made. Internal fragmentation is the term used to describe the situation where the memory allotted to the method is a little bigger than the amount requested.

Normally, memory is allocated in uniformly sized blocks, but sometimes a process doesn't use the entire block, leading to internal fragmentation.

Memory fragmentation occurs when a memory allocation request can be satisfied by the whole amount of accessible space in a memory heap, but no single fragment (or group of contiguous fragments) can.

Therefore,  when the three subroutines are loaded into memory using each of the following page sizes 900 words.

Learn more about memory here:

https://brainly.com/question/16953854

#SPJ5

what do the three dots : . seen in equations/proof mean

Answers

the three dots usually means “therefore”

Why were low quality video so often use when Internet connection we’re poorer than they are today

Answers

What do you mean? I’m confused with the question, it doesn’t make sense:)

Answer:

The answer is C. "High-quality videos took too long to transfer" in Fundamentals of Digital Media.

A switch on a circuit board can be in two states what are they​

Answers

Answer:

on and off

Explanation:

Assuming even parity, find the parity bit for each of the following data units. a. 1001011 b. 0001100 c. 1000000 d. 1110111

Answers

Answer:

b. 0001100

Explanation:

1100

Write a program that calculates the area & perimeter of a rectangle, where
the values for width and length are given by the users.

Answers

Answer:

In Python:

Length = float(input("Length: "))

Width = float(input("Width: "))

Area = Length * Width

Perimeter = 2*(Length + Width)

print(Area)

print(Perimeter)

Explanation:

This gets the length from the user

Length = float(input("Length: "))

This gets the width from the user

Width = float(input("Width: "))

This calculates the area

Area = Length * Width

This calculates the perimeter

Perimeter = 2*(Length + Width)

This prints the area

print(Area)

This prints the perimeter

print(Perimeter)

CH4 has how many of each type of atom?

Answers

Its easy that moderators that see this answer can think that my answer isn't without explanation.

• Type of atom C (Carbon)

C = 1

• Type of atom H (Hydrogen)

H = 4

You dont understand? JUST SEE THE FORMULA C MEANS ONLY HAVE 1 CARBON ATOM AND H4 MEANS 4 ATOM OF HYDROGEN

oK. have a nice day hope you understands

A room has one door, two windows, and a built-in bookshelf and it needs to be painted. Suppose that one gallon of paint can paint 120 square feet. Write a program that prompts the user to input the length and width (in feet) of: The door Each window The bookshelf And the length, width, and height of the room. The program outputs: The amount of paint needed to paint the walls of the room.

Answers

Answer:

In Python:

doorLength = float(input("Door Length: "))

doorWidth = float(input("Door Width: "))

windowLength1 = float(input("Window 1 Length: "))

windowWidth1 = float(input("Window 1 Width: "))

windowLength2 = float(input("Window 2 Length: "))

windowWidth2 = float(input("Window 2 Width: "))

shelfLength = float(input("Bookshelf Length: "))

shelfWidth = float(input("Bookshelf Width: "))

totalarea = doorLength * doorWidth + windowLength1 * windowWidth1 + windowLength2 * windowWidth2 + shelfLength*shelfWidth

gallons = totalarea/120

print("Gallons: "+str(gallons))

Explanation:

The next two lines get the dimension of the door

doorLength = float(input("Door Length: "))

doorWidth = float(input("Door Width: "))

The next two lines get the dimension of the first window

windowLength1 = float(input("Window 1 Length: "))

windowWidth1 = float(input("Window 1 Width: "))

The next two lines get the dimension of the second window

windowLength2 = float(input("Window 2 Length: "))

windowWidth2 = float(input("Window 2 Width: "))

The next two lines get the dimension of the shelf

shelfLength = float(input("Bookshelf Length: "))

shelfWidth = float(input("Bookshelf Width: "))

This calculates the total area of the door, windows and bookshelf

totalarea = doorLength * doorWidth + windowLength1 * windowWidth1 + windowLength2 * windowWidth2 + shelfLength*shelfWidth

This calculates the number of gallons needed

gallons = totalarea/120

This prints the number of gallons

print("Gallons: "+str(gallons))

Someone please help ASAP will brainlist

Answers

I think it’s audio mixer panel

Find the unknown quantities

Answers

Answer:

I = 11/2 = 5.5

R = 60/11 ≈ 5.5Ω

Explanation:

You use V = I·R twice.

Entire circuit: 140 = I·(20+R)

Resistor: 30 = I·R

Solving this system of equations gives:

140 = I·(20+R) = 20I + IR

30 = I·R

140 = 20I + 30

20I = 110

I = 11/2 = 5.5

R = 60/11 ≈ 5.5Ω

what is the purpose of a head tag

Answers

to contain specific information about a web page, often referred to as metadata. This information includes things like the title of the document (which is mandatory), scripts or links to scripts, and CSS files.

Answer:

Explanation: I don't know English very well but  I will try to explain to you. We need head tag in HTML -> for enter the title of the page, add extra meta data, put a picture title bar of the document and connect with another document

Write a program that takes in a positive integer as input, and outputs a string of 1's and 0's representing the integer in binary. For an integer x, the algorithm is:
As long as x is greater than 0
Output x % 2 (remainder is either 0 or 1)
x = x // 2
Note: The above algorithm outputs the 0's and 1's in reverse order. You will need to write a second function to reverse the string.
Ex: If the input is:
6
the output is:
110
Your program must define and call the following two functions. The function integer_to_reverse_binary() should return a string of 1's and 0's representing the integer in binary (in reverse). The function reverse_string() should return a string representing the input string in reverse.
def integer_to_reverse_binary(integer_value)
def reverse_string(input_string)
Note: This is a lab from a previous chapter that now requires the use of a function.

Answers

Answer:

#include <iostream>//header file

#include <string>//header file

using namespace std;

string integer_to_reverse_binary(int integer_value)//defining a method integer_to_reverse_binary  

{

   string ret = "";//defining string variable

   while (integer_value > 0) //using while loop to check integer_value value is greater than 0

   {

       ret += '0' + (integer_value % 2);//adding zeros in remainder value

       integer_value /= 2;//holding quotient value

   }

   return ret;//return string value

}

string reverse_string(string input_string)//defining a method reverse_string that holds a parameter user_String  

{

   string result;//defining a string variable  

   for (int i = 0; i < input_string.length(); ++i)//use for loop to calculate value  

   {

       result += input_string[input_string.length()-i-1];//add value in result variable

   }

   return result;//result result variable value

}

int main()//defining main method  

{

   int num;//defining integer variable

   string str;//defining string variable

   cin >> num;//input num value

   str = integer_to_reverse_binary(num);//use str variable to call the integer_to_reverse_binary method

   cout << reverse_string(str) << endl;//printing the reverse_string method value

   return 0;

}

Output:

6

110

Explanation:

In this code two string method "integer_to_reverse_binary and reverse_string" is defined that holds one parameter "integer_value and input_string".

In the first method a string variable is defined, that use the while loop to check integer value is greater than 0 and add zeros in the value and return its value as a string.

In the second it reverse the string value and store into the result variable, and in the main method the "num and str" variable is defined, and in the num it takes integer value and pass into the above method and print its return value.    

Pls awnser I will mark brainliest as soon as possible

Answers

what are the multiple choice answers?

Answer:

Andriod

Explanation:

40 POINTS help please

Answers

Answer:

Explanation:

nice dave

ANSWER QUICK 50 POINTS
You have the following code in your program.

from array import *
Which line of code would create an array?


D = array([2.5, 3, 7.4])

D = array('f',[2.5, 3, 7.4])

D = array['f',[2.5, 3, 7.4]]

D = array('f',2.5, 3, 7.4)

Answers

Answer:

D = array('f',[2.5, 3, 7.4])

Explanation:

is the answer

A variable must be declared with an array type before the array itself can be created. Array types resemble other Java types, with the exception that square brackets are placed after them ( [] ). Thus, option D is correct.

What line of code would create an array?

Using the NumPy library, new data types known as arrays can be produced in Python. NumPy arrays are created for numerical studies and only contain one data type.To build an array, use the array() method after importing NumPy. The input for the array() function is a list.

An array, also known as a database system, is a group of things or data that is held in a contiguous memory area in coding and programming. Several instances of the same kind of data are grouped together in an array.

Therefore, D = array('f',2.5, 3, 7.4)  line of code would create an array.

Learn more about array here:

https://brainly.com/question/22296007

#SPJ2

What is the only language that a computer can understand

Answers

Answer: Low-Level language is the only language which can be understood by the computer. Low-level language is also known as Machine Language. The machine language contains only two symbols 1 & 0. All the instructions of machine language are written in the form of binary numbers 1's & 0's.

Explanation:

Answer:

Machine Language (low level language)

Low-Level language is the only language which can be understood by the computer. Low-level language is also known as Machine Language. The machine language contains only two symbols 1 & 0. All the instructions of machine language are written in the form of binary numbers 1's & 0's.

the internet is a network of only ten thousands computers true or false

With saying why true or why false

Thanks ​

Answers

Answer: False

Reason: There's a lot more then 10 thousand computers on the internet.

Pls help I will get points and brainliest

Answers

Answer:

They are both types of interfaces.

Explanation:

Click the answer that includes the word "Interface" or "Interfaces"

Other Questions
(SAT Prep) Find the value of x. He math team does practice drills that each last hour. In February the team did practice drills for a total of 24 hours. How many practice drills did the math team do in feburary PLEASE ANSWER FAST!!!!Explain why the U.S. decided to change its goal from protecting western settlements to attacking Native Americans and forcing them onto reservations. i just asked my best friend if she talk ab me behind my back bc i kinda have trust issues and i dont get what she means by this.... do yall have any idea? Write and solve an equation to determine the value of x in the figure. a. 3x 84; 252 b. 3x 84; 28 c. 3x 84; 84 d. 3x 84; 81 Find the value of x. Plsssssss Help!!!!Look at the map. How might the Gupta empire have been able to flourish through trade? Identify geographic features to support your answer. transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC Hey can somebody get this for me been stuck for five min Select the correct answer from the drop-down menu.What is implied by the underlined section in the passage?Caesar's statement to Brutus implies that imagine being in spanish course on edmentum its pretty hard not gonna kap features of liberalism theory A square has side lengths as shown in the picture and a perimeter of 54.8 centimeters. Write an equation to find the measure of each side length. On January 1, Year 1, a contractor began work on a $3.2 million construction contract that is expected to be completed in 3 years. The contractor concludes that it is appropriate to recognize revenue over time using the input method based on costs incurred (cost-to-cost method). At the inception date, the estimated cost of construction was $2.4 million. The following data relate to the actual and expected construction costs: Year 1 Year 2 Year 3 Costs incurred $720,000 $1,170,000 $1,110,000 Expected future costs $1,680,000 $810,000 $0 For this long-term construction contract, the contractor needs to calculate the estimated dollar values of the revenue and gross profit (loss) to be recognized each year. Complete the contractor's long-term construction contract using the information above. Write the appropriate amounts in the associated cells. Indicate losses by using a leading minus (-) sign. Round all amounts to the nearest dollar. If no entry is necessary, enter a zero (0). Revenue Gross profit (loss) Year 1Year 2 Need help with english class Your teacher has given you two mineral samples. He has told you thatthey have the same crystal structure and hardness.Which other observation would suggest that they are MOST LIKELY thesame mineral?They have the same color.They have the same shape.They have the same size.They have the same mass. 6. To what modern day American event might the medieval tournaments be compared? Une correctamente la pregunta con la respuesta.1. Con quin hablabas? 2. Qu haca tu hermano? 3. Que hacan tus padres? 4. Con quin hablabais? Hablaba con mi hermano. Hablbamos con el estudiante nuevo.Jugaba el ftbol.Caminaban por la playa. A factory uses a special kind of lubricant to maintain its two milling machines. Weekly lubricant usage for each machine is an independent random variable (zero correlation). The first machine has a mean usage of 50.6 gallons and standard deviation of 12 gallons. The second machine has a mean usage of 64.4 gallons and standard deviation of 16 gallons.Suppose that at the beginning of the week, the factory has a total of 135 gallons of lubricant in stock. The factory will not receive any replenishment of lubricant from its supplier until the end of the week. Assume that the total lubricant usage (of the two machines combined) follows a normal distribution. What is the probability that the factory will run out of lubricant before the next replenishment arrives? What is the highest common factor of 72 and 90