1- What kind of "mikros" can remain in a state of dormancy for several years?
Group of answer choices
oryza sativa
giardia
all the answers are correct
rotifers
2- Deep sea microbes are not "aliens" because
Group of answer choices
their DNA to line up with everything else on Earth.
they can grow on Petri dishes
all the answers are correct
the have the same morphology as known microbes
they have the same "metabolism" as known microbes

Answers

Answer 1

Kind of "mikros" can remain in a state of dormancy for several years is: all the answers are correct,

and Deep sea microbes are not "aliens" because: their DNA to line up with everything else on Earth.

1- The type of "mikros" that can remain in a state of dormancy for several years are known as psychrophiles. These are microscopic organisms that are capable of surviving and thriving in extremely cold temperatures, down to -20 degrees Celsius. Examples of psychrophiles include rotifers, Oryza sativa, and Giardia, among others.

These organisms are able to remain in a dormant state by entering a state of dormancy, which allows them to suspend their growth and metabolic activity in order to survive in unfavorable temperatures.



2- Despite the fact that deep-sea microbes are isolated from the surface of the Earth and can withstand extreme temperatures, pressures, and lack of light, their genetic material lines up with other organisms on Earth.

Additionally, these microbes can be grown in a laboratory setting on a Petri dish, which also serves as evidence that they are not extraterrestrial in origin. Furthermore, deep sea microbes have the same morphology, metabolism, and behavior as known microbes on Earth, further indicating that they are not aliens.

To know more about microbes refer here:

https://brainly.com/question/14571536#

#SPJ11


Related Questions

The auxotrophic strain of E. coli that will be used today cannot independently synthesize tryptophan, an amino acid. They possess a ____ mutation that prevents tryptophan synthesis and are thus said to be trp-

Answers

The auxotrophic strain of E. coli that will be used today cannot independently synthesize tryptophan, an amino acid. They possess an AUXOTROPHIC mutation that prevents tryptophan synthesis and are thus said to be trp-.

Strains of E. coli are strains of E. coli bacteria that have lost the ability to synthesize or manufacture an essential compound or amino acid required for its growth in a defined medium. This means that the auxotrophic E. coli strains cannot grow on media that lack the essential compound or amino acid that the strain cannot synthesize on its own. The E. coli strain used today is an auxotrophic strain and is unable to synthesize the amino acid tryptophan (Trp) on its own.

Therefore, they possess a Trp mutation that prevents tryptophan synthesis and are thus said to be trp-. The E. coli Trp mutants are grown in a medium containing a complete nutrient base, except for the amino acid tryptophan (Trp-) to avoid competitive inhibition of other amino acids by the tryptophan that is synthesized by the wild-type E. coli bacteria. The growth of the E. coli Trp- mutants can then be tested to see if tryptophan was supplied to the medium.

Learn more about tryptophan synthesis at https://brainly.com/question/776786

#SPJ11

The products of photosynthesis are: a. O2 and CO2
b. O2 and sugar
c. H2O and sugar
d. CO2 and sugar

Answers

The products of photosynthesis are b. O2 and sugar.

Photosynthesis is a process in which plants convert light energy from the sun into chemical energy in the form of glucose (sugar). This process occurs in the chloroplasts of plant cells and involves two main reactions: the light-dependent reactions and the Calvin cycle.

In light-dependent reactions, light energy is absorbed by pigments in the chloroplasts and used to produce ATP (energy) and NADPH (an electron carrier). Oxygen is also released as a byproduct of these reactions.

In the Calvin cycle, the ATP and NADPH produced in the light-dependent reactions are used to convert carbon dioxide into glucose. This process is also known as carbon fixation.

Therefore, the products of photosynthesis are oxygen (O2) and glucose (sugar).

To know more about photosynthesis click here:

https://brainly.com/question/29775046

#SPJ11

Question 5. As you are about to sneak out of lab early to prepare for your own Valentine's Day plans the following day, another friend rushes in confessing that he is desperate to impress this girl he met in the Biotechnology club. She is meeting him at the library tomorrow and he has racked his brain for a special Valentine's Day treat with no luck. As his crush is a huge Biotechnology fan, your friend begs for your help in creating a functional nucleic acid or protein Valentine for her. What do you help him create? (Design a molecule, expression system, epigenetic system or form of regulation to that will help woo his crush. You don't have to be as specific as including sequence information but describe the concept of your design and suggest how you might make it if possible) (4 marks)

Answers

The best Valentine's Day treat your friend can create for his crush is a functional protein or nucleic acid.

He can design a molecule that has a specific structure, such as a single-stranded DNA or RNA molecule with a 3D model.

He could also create an expression system that expresses a specific gene or set of genes, such as a recombinant protein or enzyme. He could also create an epigenetic system, where he modifies the expression of a gene without changing the sequence.

Finally, he could design a form of regulation such as an activator or repressor that will control the expression of a gene. If your friend has access to the necessary equipment, he can make his Valentine's Day gift in a lab or home setting.

To know more about nucleic acid click on below link:

https://brainly.com/question/11309892#

#SPJ11

phenotypic plasticity...select all that apply?
-is the ability of heterozygotes to produce different phenotypes than homozygotes
-typically increases fitness under different environmental conditions
-typically deceases fitness under different environmental conditions
-is the ability of one phenotype to produce different genotypes
-is the ability of one genotype to produce different phenotypes
-always results in changes that are reversible

Answers

Phenotypic plasticity is the ability of one genotype to produce different phenotypes in different environments. It can result in changes that are reversible. Option D and Option E.

Phenotypic plasticity is the ability of one genotype to produce different phenotypes in different environments. This means that the same genotype can produce different phenotypes depending on the environment.

The phenotype of an organism is influenced by both its genotype and its environment. When the environment changes, an organism can adjust its phenotype accordingly. This is known as phenotypic plasticity.

Phenotypic plasticity can be beneficial for an organism. By adjusting its phenotype to match the environment, an organism can improve its chances of survival and reproduction. This is known as adaptive phenotypic plasticity. In contrast, maladaptive phenotypic plasticity can reduce an organism's fitness.

Typically increases fitness under different environmental conditions.

Phenotypic plasticity typically increases fitness under different environmental conditions. By adjusting its phenotype to match the environment, an organism can improve its chances of survival and reproduction.

To learn more about genotype, click here:

https://brainly.com/question/12116830

#SPJ11

In response to viral or intracellular bacterial infection, the afflicted cell can signal immune action to prevent spread of the infection to other cells. In this process where is antigen presented?
a.Proteosome
b.Phagolysosome
c.Phagosome
d.Nucleus
e.Cytoplasm
f.Endoplasmic reticulum
g.Transport vesicle

Answers

The correct answer to the question related to immune response is option f, Endoplasmic reticulum, In response to viral or intracellular bacterial infection, a cell can signal immune action to prevent the spread of the infection to other cells.

This immune response is triggered by the presentation of antigens on the cell surface.

The Endoplasmic reticulum is an organelle that plays a crucial role in the synthesis, folding, and transport of proteins.

The Endoplasmic reticulum also processes and presents antigens on the cell surface to trigger immune action.

This process is called antigen presentation and is essential for the activation of the immune response.

Therefore, the correct answer to the question related to immune response is option f, Endoplasmic reticulum.

Read more about Antigen.

https://brainly.com/question/15694610

#SPJ11

How can variation in scientific data show how to conditions
aren't different? Please give visual aid.

Answers

Variation in scientific data can show that conditions are not different by illustrating how similar data points are across different conditions. For example, a graph of average temperatures across a geographical area can illustrate the fact that temperatures in the different regions are not significantly different.

When analyzing scientific data, the data points should be similar if the two conditions being compared are not different. Conversely, if the two conditions being compared are different, the data points should be diverse or have a high degree of variation. This is due to the fact that the data points will be influenced by the condition they are measuring. If the conditions are similar, there should be little to no impact on the data points, resulting in a lower degree of variation. A visual aid to demonstrate this concept could be a scatter plot. Two sets of data points with little variation or that are close together could represent two similar conditions. Two sets of data points with a high degree of variation could indicate two different conditions.

Visual aid can help emphasize the data points. For example, a scatter plot or line graph can be used to show the data points and the similarity in their values. The colors of the data points or lines can be used to visually emphasize the similarities. By using visual aids to illustrate similarities in scientific data, one can demonstrate that conditions are not significantly different.

Learn more about variation in data here: https://brainly.com/question/13154114

#SPJ11

Select the advantage of using dry reagent strip tests for urinalysis. a) requires large sample volume. b) difficult to use and read. c) difficult to train user. d) easy instrument for reading.

Answers

The advantage of using dry reagent strip tests for urinalysis is "easy instrument for reading". Therefore, the correct answer to this question is (d): "easy instrument for reading".

Dry reagent strip tests are a simple and convenient way to perform urinalysis. They are easy to use and require only a small sample volume. The strips contain reagents that react with substances in the urine to produce a color change, which can be read using an instrument or visually. This makes them an easy and convenient tool for performing urinalysis.

You can learn more about reagent strip tests at

https://brainly.com/question/28357972

#SPJ11

Which TWO of the following are key movements of laryngeal vestibular closure (LVC) achieved via the intrinsic laryngeal muscles, innervated by CN X RLN

Answers

The two key movements of laryngeal vestibular closure (LVC) achieved via the intrinsic laryngeal muscles, innervated by CN X RLN are Adduction and Elevation.

1. Adduction of the arytenoid cartilages: This movement is achieved through the contraction of the lateral cricoarytenoid muscles, which are innervated by the recurrent laryngeal nerve (RLN) of the tenth cranial nerve (CN X).
2. Elevation of the larynx: This movement is achieved through the contraction of the thyrohyoid muscles, which are innervated by the recurrent laryngeal nerve (RLN) of the tenth cranial nerve (CN X).
These two movements are crucial for LVC, as they help to close off the larynx during swallowing, preventing food or liquids from entering the airway. The adduction of the arytenoid cartilages brings the vocal folds together, while the elevation of the larynx moves the entire structure upward, further closing off the airway. Both of these movements are controlled by the intrinsic laryngeal muscles, which are innervated by the RLN of CN X.

For more question on cartilages click on

https://brainly.com/question/24851479

#SPJ11

Correct form of question should be:

Which TWO of the following are key movements of laryngeal vestibular closure (LVC) achieved via the intrinsic laryngeal muscles, innervated by CN X RLN?

A. Elevation

B. Adduction

C. Depression

D. Abduction

Highly amplified recordings at the neuromuscular junction can occur from small spontaneous post synaptic depolarization events in the absence of an action potential. (T/F)

Answers

The statement "Highly amplified recordings at the neuromuscular junction can occur from small spontaneous post synaptic depolarization events in the absence of an action potential" is True.

Small spontaneous post synaptic depolarization events, called miniature endplate potentials (MEPPs), can result in a highly amplified signal recorded at the neuromuscular junction in the absence of an action potential. Highly amplified recordings at the neuromuscular junction can occur from small spontaneous post-synaptic depolarization events, known as miniature endplate potentials (MEPPs), in the absence of an action potential.

These events are caused by the spontaneous release of a single vesicle of acetylcholine (ACh) from the presynaptic terminal, which results in a small depolarization of the postsynaptic membrane. Although the depolarization is small, it can be detected and amplified by recording techniques, such as intracellular or extracellular electrodes, leading to a highly amplified signal.

For more question on neuromuscular click on

https://brainly.com/question/17076742

#SPJ11

A temperature-sensitive mutant yeast strain stops dividing when shifted from 25°C to 37°C. These cells are analyzed at different temperatures by a machine that measures the amount of DNA they contain, and the following graphs are obtained.
Q1: Cells in G1 phase should have ___1 or 2___ unit(s) amount of DNA.
Q2: Which of the following would explain the behavior of your mutant? Mark yes or no for each of the following choices.
[ Select ] ["yes", "no"] Inability to initiate DNA replication
[ Select ] ["yes", "no"] Defect in chromosome condensation
[ Select ] ["yes", "no"] Defect in centrosome duplication
[ Select ] ["yes", "no"] Defect in cytokinesis

Answers

A1: Cells in G1 phase should have 1 unit amount of DNA. This is because the G1 phase is the first phase of the cell cycle, before DNA replication occurs. Therefore, cells in this phase have not yet duplicated their DNA and should only have 1 unit amount.

A2: The behavior of the mutant yeast strain can be explained by an inability to initiate DNA replication. This would prevent the cells from moving from the G1 phase to the S phase, where DNA replication occurs, and would result in the cells stopping division when shifted to a higher temperature. Therefore, the answer to this choice is "yes". The other choices, defect in chromosome condensation, defect in centrosome duplication, and defect in cytokinesis, would not explain the behavior of the mutant strain, as these defects would occur in later phases of the cell cycle. Therefore, the answer to these choices is "no".
[ Select ] ["yes", "no"] Inability to initiate DNA replication - yes
[ Select ] ["yes", "no"] Defect in chromosome condensation - no
[ Select ] ["yes", "no"] Defect in centrosome duplication - no
[ Select ] ["yes", "no"] Defect in cytokinesis - no

For more question on DNA click on

https://brainly.com/question/16099437

#SPJ11

Q3. The drawings show some plant and animal cells. Each cell has a different function.
a) Give the name of cell C.

The main functions of two of the cells are listed below. Write the letter of the correct cell next to each function.
i) photosynthesis
ii) improvement of mucus

Give the name of the organ where cell E is produced.

Give the name of the part of a plant where cell B is found.​
(I attempted a few but they might be wrong)

Answers

The diagram shows that cell C represents a red blood cell, photosynthesis is performed by a plant cell depicted as B, mucus is produced by a cell depicted as A, cell E is the sperm cell that is produced from the male testicles, and cell B is produced in the leaves of plants.

What are plant and animal cells?

Plants and animals have different cell types; for example, plants have root hairs and cells for photosynthesis, and animal cells have red blood cells that help in the transportation of the nutrients and a sperm cell that is also known as a gamete.

Hence, the diagram shows that cell C represents a red blood cell, photosynthesis is performed by a plant cell depicted as B, mucus is produced by a cell depicted as A, cell E is the sperm cell that is produced from the male testicles, and cell B is produced in the leaves of plants.

Learn more about plant and animal cells here.

https://brainly.com/question/1493437

#SPJ1

Question 3: Construction of a major highway in Banff National Park divided a once continuous stretch of forest that was home to a large deer population. The highway split the deer population into two separate smaller populations, as the deer could not safely cross the highway. Over many generations, these two now isolated populations have begun to evolve independently. On one side of the highway, deer are lighter in color and mate late in the year. On the other side of the highway, the deer are darker in color and mate two months earlier than the other population. Recently, a wildlife crossing (see below) was established to allow deer and other wildlife to safely cross over the highway. Explain the possible outcomes now that these two populations have increased contact with one another.

Answers

Answer: Your welcome!

Explanation:

Now that the two deer populations have contact with one another, they may interbreed and their gene pools may merge. This could result in the two populations becoming one, with the offspring taking on characteristics of both populations. For example, the offspring may be a mix of light and dark coloration and mate at a time in between the two original populations. This could significantly reduce the genetic diversity of the population and make it less resilient to environmental changes. Alternatively, the two populations may remain distinct due to differences in mate selection or other behavior, and the gene pools may remain separate. This could result in the offspring having characteristics from both parents, forming a hybrid population. This would increase the genetic diversity of the population and could provide a greater range of traits for the deer population to draw from.

Does the continued cellular reproduction result in an overabundance
of body cell?

Answers

The single parent cell divides into two daughter cells during cytokinesis, which is the last process. Cells divide to create new cells with similar, if not identical, contents after duplicating their own contents during the process of cellular reproduction.

What is body cell?Cells give the body structure, absorb nutrients from meals, transform those nutrients into energy, and perform specific tasks. They produce copies of themselves and include DNA, the body's genetic material. The simplest functional unit of the human body is the cell.The body's somatic cells are those that are neither sperm or egg cells (which are called germ cells). Somatic cells in humans are diploid, which means they have two sets of chromosomes, one from each parent. In reality, red blood cells make up the majority of the cells in our body. Despite making up more than 80% of our body, they only make up about 4% of our entire body mass.

To learn more about body cell, refer to:

https://brainly.com/question/13920046

A 10-year-old boy consumes a cheeseburger, fries, and chocolate shake. The meal stimulates the release of several gastrointestinal hormones. The presence of fat, carbohydrate, or protein in the duodenum stimulates the release of which of the following hormones from the duodenal mucosa?

Answers

The presence of fat, carbohydrate, or protein in the duodenum stimulates the release of the hormone cholecystokinin (CCK) from the duodenal mucosa.

CCK is a peptide hormone that is released in response to the presence of nutrients in the small intestine, specifically the duodenum. It is released from the cells of the duodenal mucosa, and its main function is to stimulate the secretion of digestive enzymes from the pancreas and bile from the gallbladder. This helps to break down the nutrients, specifically fat, carbohydrate, and protein, so that they can be absorbed and used by the body.
In addition to CCK, the presence of nutrients in the duodenum also stimulates the release of other gastrointestinal hormones, including secretin and gastric inhibitory peptide (GIP). Secretin stimulates the release of bicarbonate from the pancreas, which helps to neutralize the acidic chyme from the stomach. GIP inhibits gastric acid secretion and stimulates insulin release from the pancreas, which helps to regulate blood sugar levels.
For more such questions on cholecystokinin, click on:

https://brainly.com/question/15253822

#SPJ11

K+ ions are continuously forced into neurons by A. their high
internal concentration. B. their high external concentration. C.
the negative resting potential. D. the action of the Na-K pump E.
both C

Answers

The correct option is D. the action of the Na-K pump. K+ ions are continuously forced into neurons by the action of the Na-K pump. This pump moves three sodium ions out of the cell and two potassium ions into the cell for each ATP molecule that is hydrolyzed.

The Na-K pump creates a concentration gradient for both sodium and potassium ions, which can drive their movement into or out of the cell via ion channels. The high internal concentration of K+ ions means that there are more K+ ions inside the cell than outside the cell. K+ ions are forced into the neurons because they are not in equilibrium.

The concentration gradient drives K+ ions into the cell because there are more K+ ions inside the cell than outside. The high external concentration of K+ ions could have the opposite effect and drive K+ ions out of the cell, but this is not the case because of the action of the Na-K pump. The negative resting potential of the cell is also not responsible for driving K+ ions into the cell because K+ ions are positively charged and would be repelled by a negative charge.

The action of the Na-K pump is responsible for continuously forcing K+ ions into the neurons. This pump moves three sodium ions out of the cell and two potassium ions into the cell for each ATP molecule that is hydrolyzed. This creates a concentration gradient for both sodium and potassium ions, which can drive their movement into or out of the cell via ion channels.

For more about concentration:

https://brainly.com/question/13872928

#SPJ11

PLEASE HELP!
Which of the following describes how certain organelles developed in eukaryotic cells?


a) Prokaryotic cells were taken in by a larger prokaryotic cell and they were consumed.


b) Prokaryotic cells were taken in by a larger prokaryotic cell and they became symbiotic.


c) Two cells came together to create one giant cell and then organelles began to form inside of them by fusion of their membranes.


d) Prokaryotic cells were taken in by larger eukaryotic cells and they were consumed.


Which of the following best explains the process the results in step 5 of the student's model?


a) The engulfed bacteria must be engulfed again by the newly divided eukaryotic cells, so endosymbiosis is a continual process even today.


b) The engulfed bacteria needs to go through mitosis, like the eukaryotic cell, first in order to be found in all eukaryotic cells.


c) The engulfed bacteria is broken down by the host cell, and then the cell rebuilds it to form as many of the organelles as needed prior to cell division.


d) The engulfed bacteria reproduces separately from the main cell so when cell division does occur, the engulfed bacteria can be spread to other cells.

Answers

1) Certain οrganelles develοped in eukaryοtic cells as A larger prοkaryοtic cell tοοk in prοkaryοtic cells and fοrmed a symbiοtic relatiοnship with them. Optiοn B is cοrrect.

2) The prοcess that results in step 5 οf the student's mοdel - The hοst cell degrades the engulfed bacteria befοre rebuilding it tο fοrm as many οrganelles as necessary priοr tο cell divisiοn. Optiοn C is cοrrect.

What is the endοsymbiοtic theοry οf the develοpment οf οrganelles?  

The endοsymbiοtic theοry is a scientific theοry that explains hοw mitοchοndria and chlοrοplasts, twο types οf οrganelles fοund in eukaryοtic cells, gοt their start. This theοry prοpοses that these οrganelles οriginated as free-living prοkaryοtic cells that eventually develοped a symbiοtic relatiοnship with larger cells after being engulfed.

Accοrding tο the endοsymbiοtic theοry, the earliest eukaryοtic cell was a primitive cell withοut οrganelles and a straightfοrward structure.

The endοsymbiοtic theοry οf οrganelle develοpment is at the heart οf these twο cοncerns. This theοry prοpοses that the symbiοtic relatiοnship between prοkaryοtic cells that were engulfed by larger cells led tο the develοpment οf certain οrganelles in eukaryοtic cells, such as mitοchοndria and chlοrοplasts.

Learn more about Endosymbiotic theory:

brainly.com/question/1698852

#SPJ1

PLEASE HELP b) How does one of the processes you named in part (a) show that the water cycle connects nonliving and living things? (5 points)​

Answers

a) Transpiration is a type of water movement in water cycle.

b) Transpiration occurs when water is absorbed by the roots of plants and transported to the leaves where it is released into the air through tiny pores called stomata.

How is the process of transpiration described?

One of the processes involved in the water cycle is transpiration, which is the release of water vapor into the atmosphere by plants. This process not only helps to regulate the temperature of the plant, but also helps to maintain the water balance in the plant.

Plants play a critical role in the water cycle by absorbing water from the soil, releasing water vapor into the atmosphere through transpiration, and also by releasing oxygen during photosynthesis. The water released through transpiration provides moisture in the atmosphere which can form clouds and contribute to precipitation necessary for the survival of all living things on earth, including plants and animals.

Learn more on transpiration here: https://brainly.com/question/2951421

#SPJ1


The complete question is:

a) What is one way water moves through the nonliving parts of an ecosystem during the water cycle?​

b) How does one of the processes you named in part (a) show that the water cycle connects nonliving and living things? (5 points)​

Q. The incisors that Stefano Benazzo and his team examined from
Riparo Fredian were filled with what?
a. bitumen
b. ancient bacteria
c. beeswax
d. necrotic tissue

Answers

The incisors that Stefano Benazzo and his team examined from Riparo Fredian were filled with beeswax.

So, the correct answer is C.

Beeswax is composed of long-chain fatty acid esters, long-chain hydrocarbons, free fatty acids, and various other compounds.

The incisors that Stefano Benazzo and his team examined from Riparo Fredian were filled with beeswax. This discovery suggested that beeswax was used as a type of dental filling in ancient times. The use of beeswax as a dental filling is significant because it suggests that ancient humans had some knowledge of dentistry and were able to use natural materials to treat dental problems.

So, the correct answer is C.beeswax

Learn more about incisors at https://brainly.com/question/29346606

#SPJ11

For passive diffusion, when equilibrium is reached that means? A.There are equal amounts of the solute both instead and outside B.The membrane potential will be O mv C.there is no net movement of solutes D.all molecular motion ceases

Answers

For passive diffusion, when equilibrium is reached that means there is no net movement of solutes. The correct answer C.

At equilibrium, the concentrations of the solute are equal on both sides of the membrane, so there is no net movement of the solute in either direction. However, this does not mean that all molecular motion ceases, as molecules are still moving randomly, just not in a net direction.

Additionally, the membrane potential is not necessarily 0 mV at equilibrium, as this depends on the specific solute and membrane involved.

Learn more about passive diffusion:

https://brainly.com/question/28496142

#SPJ11

Question is in the screenshots

Answers

When a chinchilla coat color ([tex]\rm C^{ch}c^h\\[/tex]) rabbit has offspring with a full-color coat rabbit (C[tex]\rm c^h[/tex]), then the offspring produced is 50% full-color coat, 25% chinchilla, and 25% Himalayan.

What are the genotypes of offspring?

The genotype of offspring, when a mother rabbit with chinchilla coat color  ([tex]\rm C^{ch}c^h\\[/tex]) has offspring with full-color coat rabbit (C[tex]\rm c^h[/tex]), are full-color coat ([tex]\rm CC^c^h[/tex]), full coat color ([tex]\rm Cc^h[/tex]), Chinchilla ([tex]\rm C^c^h\\[/tex][tex]\rm c^h[/tex]), and Himalayan ([tex]\rm c^hc^h[/tex]). Thus, 50% offspring will be full-color coat rabbits and 50% offspring will be Himalayan.

Genotype percentage:

C[tex]\rm C^c^h[/tex] = 25%

C[tex]\rm c^h[/tex] = 25%

[tex]\rm C^c^h\\[/tex][tex]\rm c^h[/tex] = 25%

[tex]\rm C^c^h\\[/tex][tex]\rm c^h[/tex] = 25%

The image is attached below.

Learn more about genotypes, here:

https://brainly.com/question/16882362

#SPJ1

Explain the statistical meaning of a chi-square value with an associated p-value of less than 0.05. Use a hypothesis that had a p-value <.05 from lab 7 as an example. Explain in as much detail

Answers

The statistical meaning of a chi-square value with an associated p-value of less than 0.05 is that the null hypothesis should be rejected as there is enough evidence to conclude that the variables are dependent. This implies that the variables are linked or associated in some way.

Let's use the hypothesis that had a p-value <.05 from lab 7 as an example:
Null hypothesis: There is no association between the type of workout and weight loss in individuals.
Alternative hypothesis: There is an association between the type of workout and weight loss in individuals.
Suppose, the chi-square test was performed with a significance level of 0.05 and obtained a chi-square value of 10. This would mean that there is a 95% chance that the p-value is less than 0.05, and hence, the null hypothesis should be rejected. Therefore, we can conclude that there is an association between the type of workout and weight loss in individuals.

Learn more about hypothesis here: https://brainly.com/question/11555274

#SPJ11

Q1: A couple have conceived a child. The father's blood type is O positive and the mother's is A negative. The child
is Rh positive. Which of the following statements is correct?
A. The first birth of this mother will be in danger.
B. It is not possible for the mother's blood type to be A negative .
C. It is not possible for the child to be Rh positive.
D. The second birth of this mother will be in danger.

Answers

Answer: D. The second birth of this mother will be in danger.

Explanation:

The Rh factor is an antigen found within the red blood cell (RBC) membrane if someone is positive for this antigen.The Rh factor is what people refer to when they say they are are positive or negative in regards to blood type.Rh Positive people can receive both negative and positive blood because their body does not see the Rh factor as foreign.Rh Negative people do not naturally have Rh factor on their red blood cells and therefore if they encounter the antigen they will produce antibodies towards it through their adaptive immune system.In the case of pregnancy with an Negative mother and a Positive Child there are points near the end of the pregnancy where their blood may come in contact with each other. This will cause an immune response to occur in the mother causing her to produce antibodies. This is not an issue as the first baby will be unlikely to come in to contact with these antibodies prior to birth.The second positive baby is in danger because the mother has already produced the antibodies and they will "attack" the babies RBCs by crossing the placenta.Medications can be administered to destroy the mother's Rh Antibodies or suppress the immune system.

Describe the current measles vaccine and how this type of vaccine is produced (include both general information and MeV vaccine specific details).

Answers

The current measles vaccine is a live attenuated vaccine, meaning that it contains a weakened form of the measles virus (MeV) that is unable to cause disease.

About current measles vaccine

This type of vaccine is produced by growing the virus in cell culture and then weakening it through a process called attenuation. The attenuated virus is then used to produce the vaccine, which is administered through injection.

The MeV vaccine is typically given in two doses, with the first dose given at 12-15 months of age and the second dose given at 4-6 years of age. The vaccine is highly effective, with a 93% effectiveness rate after one dose and a 97% effectiveness rate after two doses. The MeV vaccine is also typically given in combination with vaccines for mumps and rubella, known as the MMR vaccine.

In addition to the general information about the measles vaccine, there are some specific details about the MeV vaccine that are important to note. One important detail is that the MeV vaccine is produced using a strain of the measles virus called the Edmonston-Enders strain.

This strain was originally isolated from a child with measles in 1954 and has been used to produce the MeV vaccine since the 1960s. Another important detail is that the MeV vaccine is typically produced using chick embryo cell culture, which is a common method for producing live attenuated vaccines.

In conclusion, the current measles vaccine is a live attenuated vaccine that is produced by growing the measles virus in cell culture and then weakening it through attenuation.

The MeV vaccine is typically given in two doses and is highly effective at preventing measles. It is also typically given in combination with vaccines for mumps and rubella, and is produced using the Edmonston-Enders strain of the measles virus and chick embryo cell culture.

Learn more about vaccine at

https://brainly.com/question/29570766

#SPJ11

The gene c2 in chickens is responsible for a condition known as creeper (chickens walk poorly due to shortened deformed legs). The allele of this gene that is responsible for normal development is c1. Individuals that are homozygous for c1 develop normally, but heterozygous individuals (c1c2) have creeper. Chick embryos that are homozygous for creeper (c2c2) die during incubation and never hatch. If two chickens showing the creeper phenotype are crossed, what phenotypic ratio is expected for the progeny that hatch? 1 normal: 2 creeper 1 creeper: 1 normal 3 creeper: 1 normal 3 normal: 1 creeper 2 normal: 1 creeper

Answers

Chick embryos that are homozygous for creeper (c2c2) die during incubation and never hatch. If two chickens showing the creeper phenotype are crossed, the phenotypic ratio is expected for the progeny that hatch is a. 1 normal: 2 creeper.

Creeper is a type of bird that is commonly raised as a source of protein by humans. Chickens walk poorly due to shortened and deformed legs as a result of a genetic mutation that affects a gene known as c2. The allele c1 is responsible for normal development, and homozygous individuals are unaffected by the creeper phenotype. However, heterozygous individuals will have creeper.

Therefore, Chick embryos that are homozygous for creeper (c2c2) die during incubation and never hatch. Two chickens displaying the creeper phenotype are crossed in the given scenario. The expected phenotypic ratio for the progeny that hatch is: 1 normal: 2 creeper.

Learn more about genetic mutation at:

https://brainly.com/question/368851

#SPJ11

Assignment: think like a biologist!
You are becoming scientists and have been studying Biology. This particular Biology course focuses on living organisms and their environments. What we know about Biology has been learned or inferred by using the scientific method. For this assignment, you will say what the scientific method means to you and practice parts of it! You will make an interesting observation about something in our big, bad, beautiful world related to what you have studied recently in this course. It must make you curious! And then proceed with scientific method planning - you don’t have to test it, just do all the thinking!
1. What is an organism? Define ‘organism’ in your own words.
2. Choose an organism (or group of organisms), or a biological phenomenon that has interested you in the course so far, from lectures or lab. Tell me what interested you about what you learned. Then make an observation about this organism/phenomenon (one which could be investigated by researchers, using the scientific method).
3. Pose a specific question based on this observation.
4. Devise a hypothesis about some specific aspect of your question that could be tested using the scientific method.
5. Finally, make a prediction – what specific, measurable results do you expect to observe?
You can either type online in the assignment box or upload a separate document - simply answer the questions in which ever style suits you. There is a 750 word limit.

Answers

1.  An organism is a living being that has the ability to grow, reproduce, and respond to its environment.

2. One organism that has interested me in this course is the honeybee.

3. How does the hierarchy within a honeybee colony affect the behavior and roles of the individual bees?

4. My hypothesis is that the hierarchy within a honeybee colony plays a crucial role in the division of labor and the overall functioning of the colony.

5. My prediction is that if the hierarchy within a honeybee colony is disrupted, it will have a negative impact on the overall functioning of the colony.

1. An organism is a living being that has the ability to grow, reproduce, and respond to its environment. It can be a single-celled organism, such as bacteria, or a multi-celled organism, such as plants and animals.
2. One organism that has interested me in this course is the honeybee. I find it fascinating how these insects work together in a colony to produce honey and how they communicate with each other through different pheromones and dances. My observation about honeybees is that they seem to have a specific hierarchy within the colony, with the queen bee at the top and worker bees and drones below her.
3. My specific question based on this observation is: How does the hierarchy within a honeybee colony affect the behavior and roles of the individual bees?
4. My hypothesis is that the hierarchy within a honeybee colony plays a crucial role in the division of labor and the overall functioning of the colony. I believe that the queen bee's role is to reproduce and lay eggs, while the worker bees are responsible for collecting nectar and pollen, and the drones are responsible for mating with the queen.
5. My prediction is that if the hierarchy within a honeybee colony is disrupted, it will have a negative impact on the overall functioning of the colony. For example, if the queen bee is removed from the colony, the worker bees and drones may not be able to perform their specific roles effectively, leading to a decrease in honey production and potentially the collapse of the colony.

For more such questions on organism, click on:

https://brainly.com/question/30852565

#SPJ11

Mountains can often create a rain shadow effect, this occurs on the

A. windward side
B. leeward side
C. north slopes
D. western facing slides ​

Answers

Answer:

Leeward side

Explanation:

Example of cooperative enzymes and how cooperativity relates to function
Example of cooperative binding protein and how cooperativity relates to function
Examples for allosteric regulation in metabolic pathways
Example of allosteric regulation of a particular enzyme and how this relates to function
Please also include some methods used in the research how these effects were analyzed

Answers

An example of cooperative enzymes is the enzyme complex pyruvate dehydrogenase, which is responsible for converting pyruvate to acetyl-CoA in the citric acid cycle. This enzyme complex is made up of three different enzymes, each with a different function, but they work together to enhance the overall reaction.

An example of a cooperative binding protein is hemoglobin, which binds to oxygen molecules to enhance the transport of oxygen throughout the body. Hemoglobin has four subunits, each with a binding site for oxygen, and the binding of one oxygen molecule increases the affinity of the other subunits for oxygen, leading to enhanced oxygen transport.

An example of allosteric regulation in metabolic pathways is the regulation of the enzyme phosphofructokinase in glycolysis. This enzyme is regulated by the molecules ATP and AMP, which bind to different sites on the enzyme and cause a change in its shape and function, leading to either an increase or decrease in the rate of the reaction.

One example of allosteric regulation of a particular enzyme is the regulation of the enzyme glycogen phosphorylase, which is responsible for breaking down glycogen into glucose. This enzyme is regulated by the molecules ATP, AMP, and glucose-6-phosphate, which bind to different sites on the enzyme and cause a change in its shape and function, leading to either an increase or decrease in the rate of the reaction.

Methods used in the research of these effects include enzyme assays, kinetic studies, and structural studies using techniques such as X-ray crystallography and nuclear magnetic resonance (NMR) spectroscopy. These methods allow researchers to analyze the effects of different molecules on the activity and structure of enzymes and proteins, and to understand how these effects relate to their function.

Learn more about enzyme cooperativity https://brainly.com/question/13710586

#SPJ11

In Genome Wide association a technique that includes a sample of about 1 million molecular markers that are distributed across the genome. Researchers are rarely lucky that a set of markers contains the specific casual variant that are responsible for variation in a trait of interest. Thus, when researchers find a GWAS marker exhibits a significal statistical association with the trait, what should be concluded about the likely location of a casual variant?

Answers

In Genome Wide Association studies, when a GWAS marker exhibits a significant statistical association with a trait, it can be concluded that the likely location of the causal variant is within a region of linkage disequilibrium with the GWAS marker.

This means that the causal variant is likely to be located within a genomic region that is inherited together with the GWAS marker due to the lack of recombination events.

However, it is important to note that the specific causal variant may not be the GWAS marker itself, but rather another variant within the same region of linkage disequilibrium. Further fine-mapping studies may be necessary to identify the specific causal variant within this region.

To know more about Genome Wide association refer here:

https://brainly.com/question/29894104#

#SPJ11

a) Explain how glucose moves into a cell and why it must use this particular transport mechanism.b) Explain why energy would not normally be required for this process.

Answers

a) Glucose moves into a cell through a process called facilitated diffusion. This process involves the use of a specific transport protein, called a glucose transporter, that is embedded in the cell membrane.
b) Energy is not normally required for this process because facilitated diffusion is a form of passive transport.

The glucose molecule binds to the transporter, which then changes shape and allows the glucose to move into the cell. This transport mechanism is necessary because glucose is a polar molecule and cannot easily pass through the hydrophobic interior of the cell membrane. This means that the movement of glucose is driven by the concentration gradient, with glucose moving from an area of high concentration outside the cell to an area of low concentration inside the cell. As a result, no additional energy is needed to move the glucose into the cell.

Learn more about Glucose: https://brainly.com/question/7224754

#SPJ11

Summarize the Centers for Disease Control and Prevention's winnable battles of the 21st century.
What term refers to the factors that drive health behaviors and environmental conditions?
a. ​risks
b. ​precedents
c. ​cognitive patterns
d. ​antecedents

Answers

The Centers for Disease Control and Prevention's winnable battles of the 21st century. The term that refers to the factors that drive health behaviors and environmental conditions is d. antecedents. These are the factors that come before a behavior or condition and can influence or predict it.

The Centers for Disease Control and Prevention (CDC) has identified several "winnable battles" for the 21st century, which are public health priorities that have a large impact on health and can be addressed through evidence-based interventions. These include reducing tobacco use, improving nutrition and physical activity, preventing healthcare-associated infections, reducing motor vehicle injuries, preventing teen pregnancy, and reducing HIV infections.

Each of these winnable battles is influenced by a variety of antecedents, including individual behaviors, social and environmental factors, and access to healthcare. By understanding and addressing these antecedents, the CDC aims to make progress in improving public health and preventing disease in the 21st century. So the answer is d. ​antecedents

Learn more about antecedents at:

https://brainly.com/question/15887044

#SPJ11

Other Questions
CO(g) + Cl (g) = COCh2 (g)If Ke 5.0 at 600 K for this reaction, what are the equilibrium partial pressures of the three gasesif a reaction vessel initially contains a mixture of the reactants in which Pco = Pc2=0.265 atmand there is no COCl? A stretch of DNA thought to be involved with cancer suppression is sequenced and compared amongst people who have succumbed to cancer and those that have not. It is believed that the region encodes a protein of some sort. Identify the type of mutation and its effect on the protein.Normal individual : (wild type) 5'CACATGAACGAGCCCTTTGCGAGTGACTA3'Cancer patient 1 5' CACATGAACGAGCCTTTTGCGAGTGACTA 3'Cancer patient 2 5' CACATGAACGAGCCCTTTTGAGAGTGACTA 3' What is the fluid found within the body's cells called? Why was the acquisition of land so critical for the newly freed slaves?A. Without land, freedmen were not allowed to hold officeB. Without land, freedmen were not allowed to voteC. Without land, freedmen would be unable to generate their own incomeD. Without land, freedmen could only enter the economy as laborers or craftsmen A 17-year-old Senior High School student visited the clinic for consultation with history of 4-day diarrhea, inappetence, mild abdominal pain, and fatigue, after spending the weekend in their province. Stool samples were collected and placed in 10% formalin and Zn-PVA fecal preservatives and were sent to the laboratory for analysis. Photomicrographs below show organisms seen by the Medical Technologist in a trichrome-stained slide of the Zn-PVA sample. He also mentioned that the organisms' size ranges from 12-26m. What is your diagnosis? Based on what criteria? What further testing, if any, would you recommend? What statement describes the cause for sibling rivalry between both brothers? The windpipe is properly called the At its lower end it divides into right and left into progressively smaller The aveolar ducts of the lungs terminate in structures called whose walls are composed of A true breeding pink flowered petunia plant is crossed with a true breeding white petunia plant, and the F1s have purple flowers. The F1 is selfed, and F2 plants are obtained. Of the 80 F2s, 53 have pink flowers, and 27 have white flowers. If the phenotypic difference is due to two alleles of one gene, what ratio of purple to white flowered plants do you expect in the F2?Using the chi-squared test, determine if the results in the F2 generation support the hypothesis that the phenotypic difference is due to two alleles in one gene. Explain your answer with math. Q: In the case of Pakistans economy, write down in your own words the implications of following two situations on the parameters (such as depreciation, population growth, productivity, saving rate) of the Solow Model.a. Situation 1: Extreme wave of Covid-19 leading towards mobility restrictions.b. Situation 2: Russian attack on Ukraine lead to more uncertainty. The company believes it will be able to hire a qualified individual for a $95,000.00 annual salary. The company pays $150.00 of each employees $400.00 monthly insurance premium. Determine the total annual salary and payroll tax expense for the employee, assuming the company does not have an IRS-approved health care plan. What happens when sample size is small and population S.D is unknown?i. Values on the Z row on the table (or Z values) can't be used.( note that Z is normal distribution)ii. we use the sample distributionA. i onlyB. i and ii onlyC. ii onlyD. None of the abov 1. Answer the following characteristics for BasidiomycotaFungi.A. ColorB. TextureC. FormD. SizeE. Starch storage (where) The monthly salary of Mr. Jha is Rs. 16,500. He spend his income in every month in the following ways:Food:- 20%, House:- 25%, Fuel:- 10%, Miscellaneous:- 15% (i) Find his monthly expenditure on each item. (ii) How much does he save every month? What advice does Pericles give to the parents of the deceased soldiers? What is the purpose of his advice? Given cost and price (demand) functions C(q) = 100q43,800 and p(q) = -29.860, what profit can the company ear by selling 40 items? It can expect to earn sin profit. (Round answer to nearest dollar) A skydiver is laying out a circular target for his next jump that has a diameter of 16 FEET. Which EXPRESSION can be used to determine the area of the target?Pls hurryyy thxxxxsss PLSSS HELP !! Sarah asked the students in her class if they had a pet cat. Of the students, 6 out of 20 had a pet cat. If there are360 students in the school, how many could be expected to have a pet cat? When in the Course of human events, it becomesnecessary for one people to dissolve the political bandswhich have connected them with another... a decentrespect to the opinions of mankind requires that theyshould declare the causes which impel them to theseparation.-Declaration of Independence,1776What does this quotation from the introduction of theDeclaration of Independence do?It explains what the rest of the document will doIt acknowledges the authority of the monarchy.OIt lists the rights that nature gives all menIt states the colonists' lack of respect for GreatBritain How many fatty acids are in a triglyceride triacylglycerol molecule? The writer wants to ensure that the organization of paragraphs effectively conveys the passages line of reasoning. In order to accomplish this goal, the fourth paragraph (sentences 11-13) should be placed