1 and 2 are complementary. if 1 is x + 4 and 2 is 23 + 2 x, find the measure of 1 and 2​

Answers

Answer 1

Answer:

Step-by-step explanation:

x + 4 + 2x + 23 = 90

3x + 27 = 90

3x = 63

x = 21

x + 4 = 21 + 4 = 25 for <1

2(21) + 23  = 42 + 23 = 65 for <2


Related Questions

Split into a sum of two rational expressions with unlike denominators: (2x+3)/(x^(2)+3x+2)

Answers

The sum of two rational expressions with unlike denominators is 1/(x+1) + 1/(x+2).

To split the given rational expression into a sum of two rational expressions with unlike denominators, we will use the partial fraction decomposition method. Here are the steps:

1. Factor the denominator of the given rational expression: (x^(2)+3x+2) = (x+1)(x+2)
2. Set up the partial fraction decomposition: (2x+3)/(x+1)(x+2) = A/(x+1) + B/(x+2)
3. Multiply both sides of the equation by the common denominator to get rid of the denominators: 2x+3 = A(x+2) + B(x+1)
4. Set up a system of equations by equating the coefficients of the like terms: 2x+3 = (A+B)x + (2A+B)
5. Solve the system of equations to find the values of A and B: A=1, B=1
6. Substitute the values of A and B back into the partial fraction decomposition: (2x+3)/(x+1)(x+2) = 1/(x+1) + 1/(x+2)

Therefore, the sum of two rational expressions with unlike denominators is 1/(x+1) + 1/(x+2).

See more about rational expressions at: https://brainly.com/question/25292194

#SPJ11

if the solution of an equation is x=-2, what could the original equation be? A. x+6=8 B. x-6=8 C. x+8=6 D. x-8=6

Answers

Answer:

C: x+8= 6

Step-by-step explanation:

So if you were to work each of these out x + 6 = 8 that problem gives us positive 2, when we are looking for a -2 so that answer is ruled out. Then you go to x-6=8 you move the -6 and add it to the 8 and you get x = 14 still not our answer so thats also ruled out. Then x-8=6 is the same thing as the last one but with a -8 instead of a 6 but you get the same answer which is x=14 so not that one either. Then you work on the choice x+8=6 and you subtract 8 from both sides and you end up with a -2. So our final answer is C: X+8=6

Calculate the following equation: Eight vehicles set out to drive to a destination that is 50 mile away. Only seven vehicles complete the trip and the eighth vehicle only completed 50% of th joumey. What are the total miles that all eight vehicles drove? A. 375 B. 225 C. 900 D. 450

Answers

8 vehicles were supposed to drive 50 miles only 7 drove all the way so 7*50=350miles. The 8th only did 50% so 50% of 50 is 25 , so the 8th vehicle only made it to 25 miles and now we do 350+25=375miles

The total miles that all eight vehicles drove is 375 miles, and the correct answer is A. 375.

To calculate the total miles that all eight vehicles drove, we need to add up the miles driven by the seven vehicles that completed the trip and the miles driven by the eighth vehicle that only completed 50% of the journey.

The seven vehicles that completed the trip each drove 50 miles, so their total mileage is 7 x 50 = 350 miles.

The eighth vehicle only completed 50% of the journey, so it drove 50 x 0.50 = 25 miles.

To find the total miles driven by all eight vehicles, we add the miles driven by the seven vehicles and the miles driven by the eighth vehicle:
350 + 25 = 375 miles

Therefore, the total miles that all eight vehicles drove is 375 miles, and the correct answer is A. 375.

For more information about equation, visit:

https://brainly.com/question/22688504

#SPJ11

28 is the greatest common factor of two numbers. What are several things you know about the prime factorization of each number?

Answers

Both numbers are divisible by 2, 2 and 7.

What is Greatest Common Factor?

The greatest common factor (GCF) is the largest number that divides two or more numbers evenly. It is also known as the greatest common divisor (GCD) or highest common factor (HCF).

If 28 is the greatest common factor of two numbers, it means that both numbers have 28 as a factor. Thus, both numbers are divisible by 2, 2 and 7.

Additionally, the prime factorization of each number must contain all of the prime factors that are factors of 28, which are 2 and 7. However, there may be other prime factors as well. Without additional information, it is not possible to determine the complete prime factorization of each number.

To learn more about Greatest Common Factor from the given link

https://brainly.com/question/219464

#SPJ1

Which equation calculates the number of 13
-foot pieces that can be cut from a piece of wood that is 7
feet long?


CLEAR CHECK

13÷7=121

7÷13=121

13÷7=21

7÷13=21

Answers

Answer:

2

Step-by-step explanation:

Pizza Palace charges $5 for a cheese pizza and $0.20 for each additional topping. Pizza Ranch charges $4 for a cheese pizza and $0.30 for each additional topping. Find the number of toppings, n, where the cost of the pizza is the same.

Write the equation to represent the situation.

Answers

The number of toppings where the cost of the pizza is the same at both Pizza Palace and Pizza Ranch is 10. The equation that represents the situation is $5 + $0.20T = $4 + $0.30T

What is the variable?

A variable is a quantity that may change within the context of a mathematical problem or experiment.

Let's start by defining the variables we will use in the problem:

Cc: Cost of a pizza at Pizza Palace

Cr: Cost of a pizza at Pizza Ranch

T: Number of toppings

According to the problem, we have:

Cc = $5 + $0.20T

Cr = $4 + $0.30T

We want to find the number of toppings, T, where the cost of the pizza is the same at both Pizza Palace and Pizza Ranch. That is:

Cc = Cr

Substituting the expressions for Cc and Cr, we get:

$5 + $0.20T = $4 + $0.30T

Simplifying and solving for T, we get:

$1 = $0.10T

T = 10

Therefore, the number of toppings where the cost of the pizza is the same at both Pizza Palace and Pizza Ranch is 10.

The equation that represents the situation is $5 + $0.20T = $4 + $0.30T

To learn more about variables visit:

https://brainly.com/question/28248724

#SPJ1

oint of bar (PQ) is M=(1,-2). One endpoint is P=(-1,4). coordinates of the other endpoint, Q.

Answers

The coordinates of the other endpoint, Q, are (3,-8).

The midpoint formula is used to find the coordinates of the midpoint of a line segment. The formula is as follows:
M = ((x1+x2)/2, (y1+y2)/2)

In this case, the midpoint M=(1,-2) and one endpoint P=(-1,4) are given. We can plug these values into the formula to find the coordinates of the other endpoint, Q:
(1,-2) = ((-1+x2)/2, (4+y2)/2)

Solving for x2 and y2, we get:
x2 = 2(1) + 1 = 3
y2 = 2(-2) - 4 = -8

Therefore, the coordinates of the other endpoint, Q, are (3,-8).

To know more about coordinates refer here:

https://brainly.com/question/16634867

#SPJ11

21, 9:55:40 PM Watch help video lve the following logarithm problem for the positive solution for x. log_(x)(1)/(256)=-(4)/(3) Answer:

Answers

The positive solution for x in the equation log_x(1)/256 = -4/3 is x = 4.57

To solve the logarithm problem for the positive solution for x, we can use the following steps:

1. First, we can rewrite the equation in exponential form:
x^(-(4)/(3)) = 1/256

2. Next, we can raise both sides of the equation to the power of -(3)/(4) to isolate x:
(x^(-(4)/(3)))^(-(3)/(4)) = (1/256)^(-(3)/(4))

3. Simplify the left side of the equation:
x = (1/256)^(-(3)/(4))

4. Simplify the right side of the equation:
x = 256^((3)/(4))

5. Take the fourth root of both sides of the equation:
x = (256^((3)/(4)))^(1/4)

6. Simplify the right side of the equation:
x = 256^((3)/(16))

7. Simplify the exponent:
x = 256^(3/16)

8. Calculate the value of x:
x ≈ 4.57

Therefore, the positive solution for x is approximately 4.57.

Know more about solution here:

https://brainly.com/question/17145398

#SPJ11

Please help ⚠️⚠️ will give thanks, 5 stars and brainliest if possible.

Answers

Answer: ∠ABC = 29.745°

Step-by-step explanation:

I believe this is the answer , you should be golden.

Answer:

no se     y ademas me aparece en ingles :(

Step-by-step explanation:

The distance between City A and City B is 500 miles. A length of 1.6 feet represents this distance on a certain wall map. City C and City D are 2.56 feet apart on this map. What is the actual distance between City C and City​ D?

Answers

The actual distance between City C and City D is 4,224,000 feet.

What is total distance?

Whole distance refers to the actual travel distance between the origin and destination locations of the item.

We can use the given scale to convert the distance between City A and City B to feet:

500 miles = 500 * 5280 feet = 2,640,000 feet

Since 1.6 feet represents this distance on the wall map, we have:

1.6 feet = 2,640,000 feet / x

where x is the actual distance represented by 1.6 feet on the map. Solving for x, we get:

x = 2,640,000 feet / 1.6 feet = 1,650,000 feet per foot

Therefore, the  total distance between City C and City D, which is 2.56 feet on the map, corresponds to:

2.56 feet * 1,650,000 feet per foot = 4,224,000 feet

So the actual distance between City C and City D is 4,224,000 feet.

To know more about total distance visit,

https://brainly.com/question/25778905

#SPJ1

A valid inference is one that is true about the ____ based on a ____

Answers

A valid inference is a conclusion that is true about the subject based on the evidence or premises provided.

Mathematically, we can represent a valid inference using logical notation. In the example above, we can use the following notation:

Premise 1: All humans are mortal.

Premise 2: Samantha is a human.

Conclusion: Samantha is mortal.

We can use the logical connective "if-then" to represent a valid inference. In this case, we can say, "If all humans are mortal, and Samantha is a human, then Samantha is mortal." This statement is true based on the premises provided.

To determine the validity of an inference mathematically, we can use rules of logic such as the law of detachment or the law of syllogism. The law of detachment states that if we have a conditional statement, "If p, then q," and we know that p is true, then we can validly infer that q is also true.

The law of syllogism is another rule of logic that helps us determine the validity of an inference. This rule states that if we have two conditional statements, "If p, then q," and "If q, then r," we can infer that "If p, then r" is true.

To know more about inference here

https://brainly.com/question/29774121

#SPJ4

A health magazine is interested in knowing the population proportion of people who eat fast food regularly in a certain country. A study showed that 387 out of 900 people eat fast food regularly. We want to construct a 90% confidence interval for the population proportion of people who east fast food .regularly. Find the margin of error
:Select one
a. 0.0142 b. 0.0234 c. 0.0165 d. 0.0271

Answers

The margin of error of a study showed that 387 out of 900 people eat fast food regularly. We want to construct a 90% confidence interval for the population proportion of people who east fast food is   0.0234.The correct answer is option b. 0.0234.

To find the margin of error for a 90% confidence interval, we can use the formula:

Margin of error = z*√(p*(1-p)/n)

Where z is the z-score for a 90% confidence level, p is the sample proportion, and n is the sample size.

In this case, the z-score for a 90% confidence level is 1.645, the sample proportion is 387/900 = 0.43, and the sample size is 900.

Plugging these values into the formula, we get:

Margin of error = 1.645*√(0.43*(1-0.43)/900)

Margin of error = 0.0234

Therefore, the margin of error for the 90% confidence interval is 0.0234. Answer is b. 0.0234

Learn me about confidence interval here: brainly.com/question/17097944.

#SPJ11

The area of a circle is 615.44 sq. inches. what is the diameter of the circle? use 3.14 for π.

Answers

The diameter of the circle is 28 inches.

The formula for the area of a circle is:

[tex]A = \pi r^2[/tex]

Where A is the area and r is the radius.

Any straight line segment that travels through the centre of a circle and has endpoints that are on the circle is said to have a diameter.

To find the diameter of the circle, we first need to find the radius. We can rearrange the formula for the area to solve for the radius:

[tex]r = \sqrt{ (A/\pi )}[/tex]

Plugging in the given values:

[tex]r = \sqrt{(615.44/3.14)} = 14[/tex]

So the radius of the circle is 14 inches. The diameter is twice the radius, so:

d = 2r = 2(14) = 28

Therefore, the diameter of the circle is 28 inches.

for such more question on diameter

https://brainly.com/question/390660

#SPJ4

Answer fast!!!! Please!!!!!

Answers

According to the information, ball B is the one that reaches the highest height because after 1.5 seconds it has a height of 13m, while ball A has a height of 12m.

How to identify the ball that reaches higher?

To identify the ball that reaches the highest we must solve the function shown. Additionally, to know what is the greatest height we must replace the value of x by 1.5 as shown below:

f(x) = -4.9x² + 14.7x + 0.975f(x) = -4.9 * 1.5² + 14.7 * 1.5 + 0.975f(x) = -4.9 * 2.25 + 22.05 + 0.975f(x) = -11.025 + 22.05 + 0.975f(x) = 12

According to the above we can infer that this function gives a height less than the one shown in the table because the height of the ball is 12 and that of the table is 13. So 12 < 13.

Learn more about functions at: https://brainly.com/question/12431044

#SPJ1

3 (a) Using Euclid's algorithm, solve the equation[25]57​⋅X=[4]57​forX∈Z57​. Show your working. [5 marks] (b) Find all solutions to the equation[50]114​⋅Y=[8]114​forY∈Z114​. Justify your answer. [5 marks] [Hint: for part (b) you should notice that([50]114​)−1doesn't exist. Instead, write out what the equation means in terms of ordinary integers, and then relate it to part (a).]

Answers

Y = 4114/5114

3 (a) To solve 2557⋅X=457 for X∈Z57 using Euclid's algorithm, take the GCD of 2557 and 457. That is, the GCD is:

GCD(2557, 457) = GCD(2557 - 457, 457)

                  = GCD(2157, 457)

                  = GCD(757, 457)

                  = GCD(357, 457)

                  = GCD(157, 457)

                  = 457


Therefore, the GCD of 2557 and 457 is 457, and thus the solution to the equation is X = 457/2557.



3 (b) To find all solutions to the equation 50114⋅Y=8114 for Y∈Z114, we need to rewrite the equation in terms of ordinary integers, since the inverse of 50114 does not exist. The equation can be rewritten as Y = 8114/50114 = 8114/(5114⋅2114) = 4114/5114. This equation is the same as the one in part (a), with 25 replaced by 5. Thus, the solution to this equation is Y = 4114/5114, which is the same solution found in part (a). Therefore, there is only one solution to this equation, and this solution is Y = 4114/5114.

Learn more about Euclid's algorithm

brainly.com/question/13443044

#SPJ11

Cary plans to finish her basement. She needs a stove with a surface area that is at 80 sq ft to heart the basement how can she determine wether a stove is large enough

Answers

If the stove's output is greater than or equal to the estimated BTUs, then it should be large enough to heat her basement.

Cary can determine if a stove is large enough to heat her basement by checking the stove's specifications for its heating capacity or output. Typically, a stove's output is measured in British Thermal Units (BTUs) per hour. She can use the following formula to estimate the BTUs required to heat her basement:

BTUs = (Length x Width x Height of basement) x 5

Once Cary has an estimated BTU requirement, she can compare it to the output of the stove she's considering.

To learn more about basement follow the link: brainly.com/question/30630145

#SPJ4

What is the value of x?
to
x = [? ]° PLEASE HELP IM STUCK

Answers

The requried measure of the angle x in at the point of intersection of tangent and secant of the circle is 30°.

What is a circle?

The circle is the locus of a point whose distance from a fixed point is constant i.e center (h, k). The equation of the circle is given by

(x - h)² + (y - k)² = r²

Where h, k is the coordinate of the center of the circle on a coordinate plane and r is the radius of the circle.

Here,
From the figure the,
From a point, a tangent and a secant are drawn to the circle.
Since an equilateral triangle is formed with the help of a cord intersects the tangent and secant on the circumference of triangle.

Again from the figure, the sum of the angle in the triangle is equal to 180°.
90 - 60 + 180 - 60 + x = 180
30 + 120 + x = 180
x = 30°

Thus, the requried measure of the angle x at the point of intersection of tangent and secant of the circle is 30°.

Learn more about circle here:

brainly.com/question/11833983

#SPJ1

2) (3 pts) Independently, find the value of the determinant of the coefficient matrix by performing row operations on it; to reduce it to an echelon (upper triangular) form. Note that you need to show row operations on the determinant, not the matrix. Keep in mind the properties in Theorem 3.13 in section 3.7.3 of the textbook. Once converted to an echelon (upper triangular) form, the value of the determinant is simply the product of diagonal elements. Indicate the row operations by using conventions in the class/videos. Go through solved example 3.7 in that section if necessary. If you show row operations on the matrix, you will receive 0 points even if your answer is correct. If you use conventions outside of class/videos you will receive 0 points even if your answer is correct
-3x + (0)y - 6z = 11
(5)x - 2y + 3z = 17
2x - y - (7)z = -3

Answers

product of diagonal elements is 10 x -2 = -20.

To find the value of the determinant of the coefficient matrix, perform row operations to reduce it to an echelon form. First, multiply the first row by -3, the second row by 5, and the third row by 2. This yields the following matrix:



(-9)x + (0)y - 18z = -33

(25)x - 10y + 15z = 85

(4)x - (2)y - 14z = -6



Next, subtract the first row from the second row and the first row from the third row. This yields the following matrix:



(0)x + (10)y - (18)z = 52

(4)x - (2)y - (14)z = -6



Finally, subtract 4 times the second row from the third row. This yields the following matrix:



(0)x + (10)y - (18)z = 52

(0)x - (0)y - (2)z = -24



This matrix is in echelon form. The value of the determinant is simply the product of diagonal elements, which is 10 x -2 = -20.

Learn more about echelon form

brainly.com/question/30845166

#SPJ11

Question

Christian read 1/4
book every 2/3 week. How long will it take him to read 3 books? I WILL GIVE YOU BRIANLYEST

Answers

The time taken to read 3 books is 8 weeks.

What is the unitary method?

The unitary method is a technique for solving a problem by first finding the value of a single unit, and then finding the necessary value by multiplying the single unit value.

Given that, Christian read 1/4 book every 2/3 week.

Time taken to read 1 complete book is

1 × 2/3 ÷ 1/4

= 2/3 ÷ 1/4

= 2/3 × 4/1 (To divide two fractions, keep the first fraction same and change division to multiplication and inverse the second fraction)

= 8/3

Now, time taken to read 3 complete is

= 8/3 ×3

= 8

Therefore, time taken to read 3 books is 8 weeks.

To learn more about the unitary method visit:

brainly.com/question/22056199.

#SPJ1

Paul posts a music video to a web site. The first day only 8 people listen to the 280.13 points video. As more people hear about it, the number of people who listen to the video How mainy new people listen to the video on the 7th day? Round to the nearest increases by 45% each day Whole number according to the context of the problem______people

Answers

Assuming the number of people who listen to the video increases by 45% each day, there would be approximately 24 new people who listen to the video on the 7th day after the initial 8 people.

According to the problem, the number of people listening to the video increases by 45% each day. Therefore, we can use the formula for compound interest to calculate the number of new people who listen to the video on the 7th day.

Let P be the initial number of people who listened to the video, which is 8.

Let r be the daily increase rate, which is 45% or 0.45 as a decimal.

Let n be the number of days, which is 7.

Then, the formula for compound interest is:

A = P(1 + r)^n

where A is the final number of people who listen to the video.

Plugging in the values, we get:

A = 8(1 + 0.45)^7

A ≈ 32

Therefore, the number of new people who listen to the video on the 7th day is approximately 32 - 8 = 24 people.

For more questions like Interest visit the link below:

https://brainly.com/question/21131501

#SPJ11

9
AL MATHEMATICS
A mall charges a parking fee of
P35.00 for the first two hours and an
extra P15.00 for each hour (or a
fraction of it) after that. If you park
for more than twelve hours, you
instead pay a flat rate of P250.00.
Represent your parking fee using the
function p(t) where t is the number
of hours you parked in the mall.

Answers

p(t) = {

P35.00 if t ≤ 2

P35.00 + P15.00 × (t - 2) if 2 < t ≤ 12

P250.00 if t > 12

} is the required function to represent given information.

What is expression ?

Expressions are commonly used in programming to perform calculations, manipulate data, and make decisions based on the results of evaluations.

According to given conditions:

To represent the parking fee using the function p(t), we need to consider the different rates depending on the number of hours parked. Here are the different cases we need to consider:

If t ≤ 2, the parking fee is P35.00

If 2 < t ≤ 12, the parking fee is P35.00 plus P15.00 for each hour (or fraction of it) after the first two hours. This can be represented by the equation:

p(t) = P35.00 + P15.00 × (t - 2)

If t > 12, the parking fee is a flat rate of P250.00.

We can combine these cases into a single function using a piecewise function. Here is the function p(t):

p(t) = {

P35.00 if t ≤ 2

P35.00 + P15.00 × (t - 2) if 2 < t ≤ 12

P250.00 if t > 12

}

This function represents the parking fee in terms of the number of hours parked (t). To use it, simply substitute the number of hours parked into the function and calculate the resulting fee. For example, if you parked for 4 hours, the fee would be:

p(4) = P35.00 + P15.00 × (4 - 2) = P65.00

Therefore, p(t) = {

P35.00 if t ≤ 2

P35.00 + P15.00 × (t - 2) if 2 < t ≤ 12

P250.00 if t > 12

} is the required function to represent given information.


To know more about expressions visit :

https://brainly.com/question/1859113

#SPJ1

Hal compared the number of black marbles he had to the number of white marbles he had. ** Which statement correctly describes Hal's marbles? A For every 1 white marble, Hal has 3 black marbles. B For every 3 white marbles, Hal has 1 black marble. C For every 3 white marbles, Hal has 2 black marbles. D For every 2 white marbles, Hal has 3 black marbles​

Answers

The correct option is For every 2 white marbles, Hal has 3 black marbles​.

What is proportion?

The size, number, or amount of one thing or group as compared to the size, number, or amount of another, is called proportion.

A proportion is a mathematical comparison between two numbers. Often, these numbers can represent a comparison between things or people.

Proportion is an equation that defines that the two given ratios are equivalent to each other.

Proportions are actually equations with equal ratios.

A proportion or proportional situation occurs when two things are related in such a way that the ratios of corresponding parts are equal.

Given that, Hal compared the number of black marbles he had to the number of white marbles he had.

Number of black marble = 9

Number of white marble = 2

The proportion is 9 /2

= 3/2

Hence, the correct option is For every 2 white marbles, Hal has 3 black marbles​.

Learn more about proportion click;

https://brainly.com/question/7096655

#SPJ9

According to a​ study, 81​% of​ K-12 schools or districts in a country use digital content such as​ ebooks, audio​books, and digital textbooks. Of these 81%, 12 out of 20 use digital content as part of their curriculum. Find the probability that a randomly selected school or district uses digital content and uses it as part of their curriculum.

Answers

The probability that a randomly selected school or district uses digital content and uses it as part of its curriculum is 48.6%.

What is the probability?

Probability refers to the odds, chance, or likelihood that an expected outcome is obtained out of many possible outcomes.

Probability is a fractional value lying between zero and one based on the degree of certainty.

The percentage of K-12 schools or districts using digital content = 81%

The fractional value of those who use digital content as part of their curriculum = 12/20 = 0.6 or 60%.

Thus, the probability of randomly selecting a school or district using digital content as part of curriculum = 48.6% (81% x 60%).

Learn more about probabilities at https://brainly.com/question/13604758.

#SPJ1

What is the value of the perimeter of triangle CAR? (A)6+62​(B)6+63​(C)12+32​

Answers

The value of perimeter of CAR is  12 + 6√2 + 6√3. (C)

The value of the perimeter of triangle CAR can be found by adding the lengths of all three sides of the triangle.

In this case, the perimeter would be the sum of side CA, side AR, and side CR.

To find the perimeter, we can use the formula P = CA + AR + CR.

If we plug in the given values for each side, we can solve for the perimeter:

P = 6 + 6√2 + 6√3

P = 12 + 6√2 + 6√3

To know more about perimeter click on below link:

https://brainly.com/question/6465134#

#SPJ11

Find domain and range

Answers

Domain of function is 0 ≤ x < ∞ , range of function is 0 ≤ y < ∞

What are domain and range?

A function's domain  is the set of values ​​that can be put into the function. This set is the x-values ​​of a function like f(x). A function's range is the set of values ​​that the function takes on. This set is the value that the function outputs after inserting the x value.

Given,

graph of the function is drawn as a ray,

ray is starting from origin and extends to infinity on first quadrant

domain of the function

0 ≤ x < ∞

interval notation

Domain = [0, ∞)

range of the function

0 ≤ y < ∞

interval notation

Range = [0, ∞)

Hence, Domain and range of the function are 0 ≤ x < ∞ and 0 ≤ y < ∞ respectively.

Learn more about domain and range of the function here:

https://brainly.com/question/29452843

#SPJ1

Determine the measure of each arc or central angle.

1.m(arc)MN
2.m(arc) QR
3. m(arc) NQR
4.m (Arc) MRP
5. m(arc) NQ
6.m (arc) MR

Answers

Answer:

Step-by-step explanation:

First off, we need to remember that the arc measure is equal to the angle measure inside the circle. That means m(arc) MN is 70 degrees. Knowing this, we can find the measures of the other arcs:

m(arc)NP = 180 - 70 - 30 = 80

m(arc)QR = 70 based on vertical angles principle

m(arc)MR = 80+30 = 110 based on vertical angles and angle sum principles

Now we can list the answers using this:

1. 70

2. 70

3. 180

4. 210

5. 110

6. 110

Hope this helps!

Which graph is correct?

Answers

The graph of the inequality y ≥ (1/2)x - 1 and x - y > 1 is attached. Shannon's graph is correct.

What is an equation?

An equation is an expression that shows the relationship between two or more numbers and variables. Equations can either be linear, quadratic, cubic and so on depending on the degree.

Inequalities are used for the non equal comparison of numbers and variables.

Given the inequalities:

y ≥ (1/2)x - 1     (1)

and

x - y > 1     (2)

The graph of the inequality is attached. Shannon's graph is correct.

Find out more on equation at: https://brainly.com/question/2972832

#SPJ1

What is the decimal multiplier to increase by 6.1%? Give me the answer pleaseeeeee

Answers

The decimal multiplier to increase by 6.1% is 1.061.

What is multiplication ?

Multiplication is a mathematical operation used for finding the result of adding a number to itself a certain number of times. It involves multiplying two or more numbers to find their product. For example, 2 times 3 is equal to 6, written as 2 x 3 = 6. In multiplication, the numbers being multiplied are called factors, and the result is called the product. Multiplication is often denoted by the symbol "x" or a dot ".".

A decimal multiplier is a factor that is used to increase or decrease a number by a certain percentage. It is commonly used in financial calculations such as interest rates, discounts, and taxes.

To find the decimal multiplier to increase by a certain percentage, you can use the following formula:

Decimal multiplier = 1 + (percentage increase/100)

For example, if you want to increase a number by 6.1%, the decimal multiplier would be:

Decimal multiplier = 1 + (6.1/100)

Decimal multiplier = 1.061

This means that to increase a number by 6.1%, you would multiply it by 1.061. For example, if you had a number of 100, to increase it by 6.1%, you would multiply it by 1.061 to get 106.1.

On the other hand, if you wanted to decrease a number by a certain percentage, you would use a decimal multiplier that is less than 1. For example, to decrease a number by 10%, the decimal multiplier would be 0.9, which means you would multiply the number by 0.9 to get the new decreased value.

Therefore, decimal multiplier to increase by 6.1% is 1.061.

To know more about multiplication visit :

https://brainly.com/question/1135170

#SPJ1

Lewis wants to buy a skateboard that costs $89.99. He has $300 saved. He wants to save $11 each week until he has enough money to pay for the skateboard. The inequality 30 + 11w ≥ 89.99 represents this situation, where w is the least number of weeks Lewis has to save until he has enough money to pay for the skateboard?

Answers

Answer:

Step-by-step explanation:

I'm guessing you meant to say Lewis had $30 starting.

Well since we have an inequality already, that saves time on me and I can show you how to solve!

[tex]30+11w\geq 89.99[/tex]

[tex]11w\geq59.99[/tex]

[tex]w\geq 5.4536[/tex]

If Lewis waited 5 weeks, he'd only have 85, so we need to round up to 6 weeks, where he'd have $96. Hope this helps!

If the surface area of a cube is 160 in2, then which best describes the length of an edge of the cube?

Answers

Answer:

5.16 in

Step-by-step explanation:

If the surface area of a cube is 160 in2, then which best describes the length of an edge of the cube?

find the area of ​​one of the 6 squares that form the cube (total area : 6)find the side of the square using the inverse formula L = √A

160 : 6 = 26.66 L = √26.66 = 5.16 in

Other Questions
If both a and b are positive numbers and ( b)/(a) is greater than 1, then is a-b positive or negative? Assume you are nearing graduation and you have applied for a job with a local bank. Part of the banks evaluation process re- quires you to take an examination that covers several financial analysis techniques. The first section of the test addresses time value of money analysis. See how you would do by answering the following questions:a)(1) What is the future value of an initial $100 after three years if it is invested in an account paying 10 percent annual interest?(2) What is the present value of $100 to be received in three years if the appropriate interest rate is 10 percent?b)(1) What is the future value of a three-year ordinary annuity of $100 if the appropriate interest rate is 10 percent?(2) What is the present value of the annuity?(3) What would the future and present values be if the annuity were an annuity due?c)What is the present value of the following uneven cash flow stream? The appropriate interest rate is 10 percent, compounded annually. Use the following terms and chemical compounds complete the equation that summarized the processes of aerobic cellular respiration: ATP, CO2 , CH2 H12, O2, Heat,H2, O2, O2, Energy 2. Outline for the overview of cellular respiration._____+6______+6_______+_______+ HELP PLSSSSS!!!!!!!Krystal throws a rappelling rope at a speed of 10 m/s down a 50 m cliff.When will the rope hit the ground? Use the drop-down to put the correct order to solve for when the rope will hit theground. Ismail and Sameer are opening a paint store. There are no competing paint stores in the area. They must decide how to organize the business. They anticipate profits of $100,000 the first year, with the ability to sell franchises in the future. Although they have enough to start the business now as a partnership, cash flow will be an issue as they grow. They feel the corporate form of operation will be best for the long term. They seek your advice.Requirements1. What is the main advantage they gain by now selecting a corporate form of business?2. Would you recommend they initially issue preferred or common stock? Why?3. If they decide to issue $10 par common stock and anticipate an initial market price of $40 per share, how many shares will they need to issue to raise $2,250,000?4.vForecast their earning potential with your imaginary numbers for the next two years. Here, you have to prepare forecasted income statements and the year-end balance sheets for the first two years, assuming that they are going the start the business as a joint-stock company?? A soccer ball with a mass of 0.43 kg is thrown to a 63 kg girl at rest who is wearing roller blades. She catches the ball and moves to the right. Her speed just after catching the ball is 0.2 m/s. How did covid affect school kids in Afrikaans 15. \( x=-5, \quad x=4, \quad x=-\frac{1}{2} \) factored form standard form 16. \( x=3, \quad x=-7, \quad x=0 \) (multiplicity of 2) factored form standard form\[ \text { 17. } x=\frac{2}{3} \text { what smaller 5.75 or 9/7 When the Europeans arrived in Central America, most countries fell to Spanish rule except ______, which became a British colony. i need help 16 divided by 6032 full solution A jet flying at 200 m/s north accelerates at a rate of 18.2 m/s for 15 seconds. What is the jet's final velocity? The RNA sequence GGAUCUCUUGUAGAUCUGUUCUCUAAACGAAC lies in a section of the COVID-19 viral genome that sets up translation, which is the process of reading the RNA to create the proteins the virus needs to survive.(a) Use the webserver to predict the lowest energy structure of the sequence. Print out a picture of it. (b)What do you think the effect will be of the RNA being longer than the stretch you just similated? (c) Design an RNA sequence that folds into a single stem-loop. Run it through the RNAfold server and print a picture of your folded design. consider a political discussion group consists of 6 democrates, 3 republicans, and 5 independents. suppose that two group members are randomly selected, in succession, to attend the political convention. find the probability of selecting a independent then a democrat According to the Kaplan-Meier plot, amplification of more than 10 copies of myc in neuroblastoma (see fig. 4-11b), decreases disease-free survival by more than 80% post-treatment. Explain two mechanisms that may contribute to gene amplification of myc? Even though both lens cells and liver cells have numerous transcription factors that are present in both colls, the lens cell makes the crystallin protein (not albumin), whereas the liver cell makes albumin (not crystallin) Which of the following explains this cell specificity?A. Different specific transcription factors made in each cell determine which genes are expressedB. At fertilization, specific colls are destined for certain functionsC. The activators needed for expression of the crystallin gene are present in all cells.D. The promoters are different for the different genes How does the author's discussion of different death rates help readers understand the spread of the Black Death? Use evidence from the text in your responsepls i need help!! a rock rolling down a slope from rest covers a distance of 4 m in the first second. What distance will it covers in 3 sec? 5 3/10 = 5 ?/50If anyone can please help me with the rest what happened to some native Americans during the Jackson presidency ?